%PDF-1.3 1 0 obj [/PDF /Text /ImageB /ImageC /ImageI] endobj 7 0 obj << /Length 3578 /Filter /FlateDecode >> stream X [nF}y"1 YD d<LsQH̿䇹HV o]֓~'77>#L$yt6{8Έ r"T5?b a6&cF.Rӓ4lM"iMW!1&ܤ_6 9 pW$3ۆ /厸!4R'o q8 0Mdp;=w״piuhikI~)՝xTB 4iq_ Y&i5r'c'<}3Y'{"%1\F۶fy.x~|V8Un_Hr$@ nK`^xp}g7w 14 "r&p,b~8[tM{%S.wkY;M2Qlf"Ⱦ!9$F[V!?Hl&LUd݄,J"|)k)p[G 6]ƏZg4g?ݲipx.>zΠioweMWxWd5w\v]ԋov~BQNeՠ6ާXmQ_K؁zT TXzm=@k{t&;5QtTͲ9^Zk:0߶f7Rt&;5aͯZM~6_gEgsCC]wjy0xk9:<\Ú7~\^u*\`Sm.QUP0gBU d%N4`P*3 ߮Brt&;4qϮߒ @̱Q%o(maUJJ! 3w=e1MN}V,5@dIt<ꠀR6(E-yfqXZ\->2aFumFP֢tRI?05O n ~10U сdl;2ʯǓ—"b"y tt}ӭU.%zpRKcOffՒt &;4+QDX}/K!oڷ"KDWWw5mV]u劻Zއ{Wto޾Xݸ+&kqoҖҝ7W^_,kyxa^ qKxRjҦ6zmbM^y%^觺Z鳼MgyXSw޸}+m,okY&Tŝ7ḟjҦ6qt짺ZTŝkǸu|vTѽI5ԭ*e{pHt,觮Z購M/uV˕⽸F/5TW˕6}vjRI/ƙ9;գ~J5Bzr14*zhf #RqW~?l7܈,OAq7M%{c`69O]U_ /pkׇ׵kơw",A _y(""dBA17i4p4ޔp:tod(fAZh~xog"* 2ɶ~!$YA.K L8 WrJ 8%RگopYS&Ė@|ciK1I> wS;jr`WE0=/D2A(."8\9-!/UEXb&/(0\Ptm`Ϝg ",1SeΎ:=Cݷ(*I@/IzL1̋{TK2pģh!I`ԋ k#g$).yΒhpyrڮ`Xyv=wИW}LLȥDqPTq#٨AL 0кBd4 E$c?tӎxAwSU`cHVqY֟bd2.Jݰv`Qq" haidYHvՎQ( %f&h_dXWYXd3:=(veu|dC!ool&g]@/^>6BWw_ڡRVi׏H`{8E@;R{eL5Li.OnE,E .ʅRCt9H.@2"?J1QL <,d!|>3qyy(הB#݋nMl/=)s (h=Z*V` R}OrO*}b#g|F 2_͡X3(aS?`r ,,"Y1G`A@ɲY٨ ^oNv%kaar],Ҷ mM2Vw_Vxj~Ir<3VPE`waf`> j"L搟dA.y0s}M0˂/L&O8ѵ*PE`[P<; endstream endobj 2 0 obj << /Type /Page /Parent 8 0 R /MediaBox [0 0 595.276 841.89] /Contents 7 0 R /Resources << /ProcSet 1 0 R /XObject << /Im3 3 0 R >> /Font << /F4 4 0 R /F5 5 0 R /F6 6 0 R >> >> >> endobj 3 0 obj << /Type /XObject /Subtype /Image /BitsPerComponent 8 /Filter /DCTDecode /ColorSpace /DeviceRGB /Width 838 /Height 351 /Length 727730 >> stream JFIF,,JExifMM* C(12ևi"-'-'Adobe Photoshop 22.3 (Windows)2021:08:11 07:17:510231C^px(HHC    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222C! }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?(& rx5K@,Ωǰw푰&WKB8ET?J>$Oqx#OaY_6)Կ? [Cdgǘ=??qZy~!2&Wa~2ea_s'Ҫ~mylw2]ƛwlIAԫsc)-[tnta\ =xJw"_MG4Uܯ}rZ}14#kD 85d:Б '_Ekĥ.ײrZ<濕{p)2yQ5_K4M4p~UAK4LDGQʋDMtTf4i!4/d3[‘=_@ju KOgfˉB:};~rkc@ 5GǿI̓<OS%=˾9ů|>֗W?fHM@wy_* ?%+JkD~O?iQV>XaRA='u} 5($y Ӄ뢽Y}oڭ~ʥfi4ƍ6}Sfk+|v?O*5A{WN_ȷc7SאVD =;}qںҼLӹG1o>_$ݷqVqIt^2nVV:$'?e$N7c p>u%(EAr24/- 5aҵ{x#4L@<8=sT0²]ԓ ==q՟@j{}y{?N 8`*Tk"0s|1CG>LJͽٻiLMӶ8D&i:r4u U2pEx_A+Ӵ hаǽgH2\p%)lo"n#.F֫<I赭25]9&"*Pw5(`؈vVy$xu7Q#Ŏ?byK\/}9cdȵ[O"򣑝[_e|\sОNkj)ԩ &"0D>m4-VKȦ6䲞qkcK<Ԥgi,NI_SJ:W_@R"я)t:I; 3Tk6{bɿ 8=pslHmOd6+<ДbH|䌟JZI<9䃒0Ab#n7Wknr=SLx2{++뺄rI'NJڕ N:傱gy=՟Euמ֯5R[-2x~ d"qreg!B|v_ŭƳgwJkM.yϷjHbH]GZn7mo"QPwH}aGwoR9spssS 9RvW_#̢LĘ~vؑVAl?]M|ؚy]4)Va-cGa+L@=Myv-eXZL3,F4a!@8w3i΍R+^>>qy^G=9/Bw3[<jeA$ 2 ;V9mP-ګn  =piߑkВKkh1Ra%W#AԃPn'aWVEehAc=*.-zcU,d@"sGy#kduOSGbdaxiAϝ~>_QKFegqjE֮нu}fcdAe Wq"FVz~f jt[c-$ s#1d1#WE]T w1 *.QW03ƲFʰ8Vf)մ`I]9wJnxkyLl @ߧjΌa5dѤ:ԚZ`mD񷣩YލHT4V; ƶzOl a${psyBTQxNnV1ĈUT[Z:/l㎁4˙52XEՙ'u X#SGA9l0:Oamhm[\ !t~(NIn%Pެm{ 9,+(\rM.mE9nm[r ՛"ԑs4YE2qq r7`nc9?+g8Z/m5;]FLkfAHctb 8-'݃P4QƚL`-,'?>S`'d4'y vf :zWzd3E#Kq#dăW9Vm+SisSZ[c"Bw>M[$0mvSX7o$A YYbHTԚwF5߂.v+1 a?+Γm#5Q\.#pqw=1bxbyHf`(mS~uG3iV}OُwZ.Yv#!Ot?Qj8sE..̉[}2K,aD%TV?0W.)u)K{|6 r+j6L7je#|UθѲi  2eղkf _>;us{|՝(AҢ*KSeb룂X@#ɷvIEP(k;kaGk*šm"=EFN.ğeer\bKE(] G7EsU)>jLFjD6^ m-# R(ö>e su& .!v4:U*j=`m6eg(?P:ŶchCmck0Ue''v[DQ@Q@Q@`((Photoshop 3.08BIM!Z%G AVENO-Logo_4c8BIM%,7tzSҷ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTprintProofSetupObjcProof-Einstellung proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM 8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIM]^CAVENO-Logo_4c+RahmenC^nullboundsObjcRct1Top longLeftlongBtomlong^RghtlongCslicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong^RghtlongCurlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM ?C}# Adobe_CMAdobed            C" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?T/c][rqeUvnunncd㡁p;0Cx4{qɹjw:4IsnC >Gk]\Yy bә?,zMytONQ"+8O6a3&|F<_/qŌxB5uߏ?+(hOZcc&q i+?И=h-ֳp/?y!&> ڇ;7(?>>y_&XV'??>~0zc~OFXݵ9==WNֱj|f'9}8Q?[p-N00ZO>v֏}/l.!p?[?o~<?Z_~ tlx,|9ۆ[2]cfEFf5y8UiQ4K-^agt1c{Kàw~2ǐ㔸"wù@kwВ\O:Ak]:7FhFkVQEJ:G~-}z% p ?/2u޵7 1hQASmKҔrh\e 8e_TɿS:NٙW[V㽯f?Cv{{*}uzk|=/^²*X4 qEݿYf ' \cbŔfFQӤHje1$Om?K9OU*Wv8'" YΣِ?U+㫮:m>u얇h#mlߤnǽ,oY,5M{]{?5O)2%^8|21GB|q\&>Gݗeu^oNv;˿uJe&w5he>b,~3^1[8Kѯou\q0ie9V<1λ#eu? Oˏjs^TϧRҭhǽCXF[f=VUnO:Oq캍@5ÃzeY[|C.)O?6(G,c`qā # %oѴt˺~8kXNvKwouƮrh>zhkQmUc-fFC$/c>_]nYAyc[ '!N;?Nj3<%+5?vӈ j۴6ѳKf_ֆ%fgi~j"bӿ]²,ɸƍB?Λ?'k\ EˊU tfcc2cw"7?HǷ?\F,،6W{4~&ؽa hkD4pL)̓! Lc0.F pǰoUձdְGkecI&XjCr*u7Y[s$;r1# Dg(Ke] plb :\ߦϤ9qZN=HnΛlVznloCΧԱ܌lkC>g9xĈɔO)#ؐ')6bidiJn|I?\f.$J=t.H(m^M³OHypN,tW/GFeō2[WPeyN.dV7Oh`lsmkl;Cߤı(ޟMtPnshwM]c+ݑ=5_eϠ~&D(!~QrvdX3fܭֲ7ퟤ`߽Vm&y`cܠg֭}_?'װ6>k}MObf^Nn;v5PWs!1JcC# [0?75f=WzX=ҫ%B555uy,SN߶9tG~S}l9<_?Ied~G{/z_kKqm.sU]PVe]K˟,Gl:Ks멢{2*lُ3k/Zލ]uܶi~o8GU+8db2GT߼oxWY{}_LZ>^.-cbeёUN-WF30]C϶kHN5YYcp褘+77 Xdy|lFDDY4;.߮}< Ջz@'\ȻF]k[㾋+\g=c~^.57s[=оtc1ԇ9kϛ/\"$OQl@b]yָZk}= 27_[jdmh'p8aS9%2e)˩1N\R$ TI%)f}^y6:Kѹ]e$O;dnZI @:~j~YM3CC呙]ӫ ]IAc<j2EJ;Hq>][Ϥ@e"̿{gв I_2 (w< -j>R?5 /8xpߕA9XsNuHp#UWs v-Ň,?5?ꓬ$bӐ}zo؜ۊha?xKo3LWCD:"t'a>7;mM=zՏL]nwWQ>jiʰiδѭЗ=3#짃dx 149Z>KHEb+֞?ԞYk~CO^qz=Wpk/v7}5~ts]`]Ek1cCZ4pxh,&RI$Tʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$8BIM!WAdobe PhotoshopAdobe Photoshop 20218BIM1http://ns.adobe.com/xap/1.0/ AVENO-Logo_4c ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$C {/o.s^4?SL}_=/±Y>_q,|{3??Dߥ ?g~(Y>_pa?K׿H[ort?_zX?+9zXd?—ωhZ\Mgo++{'4vZ54Wrt? _˦ۯHbEzF)/a"/+'uC᤿vTC5f/N)s"}}ύয়?-ƧA" 2w1ۉ]~yt>ӗ?]F~5H6Pq۷هN_~>#u4qI56$&OڛA_-o |T2kG͘w/=O41YCw,_)I|471#c/M?L|M?|w~aG~?dFs~>p' e⩧׎O$Gώx?Tu㾞'_?nl4㧍_x߹h--G-7Lo'IAf!1'CftG͏Xo?WgWfk+sm{O[,?3k'Y ?\ГmWx}Gˏk35M>-[}͘w/<'V(cq1dx>ojMa4l~!bq1P~~kSO/i.ҟYg|4֩z ^o?_F#0nC [~yտ W >ZVꢚ֑7X/ ?x?7,WX_ơ 1>,SNh*|_tnvS[:suBϊa?JGk׫uMjZzˋ 6く_šY?Bn:m>5'/'5ij𿈴j-m $y}@Z~V蚿 zwY0JTQ_O(|t[Dg-[j?xvb%(_|/T!|Oŗ+I`]ş_c saWe}B ?>!|b|_'7)/!IU0xu+?@xG?7_&+5h#)1??{"L/϶źktv/?ξ&DR8SƵp? ?L'ϷX2ԩy O>O_" *_\/ϸQZC*dƾ_TC%*~"?//§!ge,z巑 /r)_ گ_wŗSG_|^|0/T2zN7??ԣӮWq5h~u'TpkQǎ5/?§!oɿȯ?|*MN Fu|Ÿ?Gƥ~(?o?zԿOC<38p90k??=?†>9('O!mɿ?3c'`()GSOO5O?y&!/gދ;ŭ0+>_(ǡ~!j/_~2~?w3ߍȻ}6W EA &|'R)WQ?MA_~2ޣ|SoΥ|W??FGĝk(S)~ĭo(kVe?f?N_ًºz>&k_4h)4ɿ?֜/H3~?ȫߪp>"zϟz$Tu??럴 mN_~/!Q?8~ȿdcW~j|G??4]jC"֊="3V?O?!~%??~z?U?&?Vim{!c?!ɟdck~?ȥe_ LL+70OM{oRj?Cg|'ߪo2º~v?#J|O^ ▽|oRl??emSO+9 IZQ?_?T5?_3?Y0?FKs?-_~r7Sn5?¢*kgT9?oɆY~~=>?c||WRh?kGQoGC~C&"<73?e p _-A/ZS*6ЇjV|Q3ɿ?,73 xGi/DkVO)zH? টm`S*7a_`4"*?F? य़[][O!iɿ? 73&&«U_g MFR?Y);?7Y~~Zc|9qWKG<ZM?QB? ?7`,?MZ>ڤzaWKE~9 [O|poXS(wdU$y~'RU¢ۋ|Q_~UF'p+mOZPgV @*Bޣ3 d*Vi+l?MŷP]|Nn*W({x?Կ~7t5b6ӭ".|Qy|T2~ۯO!3oSW|ԣU곈!CAK~_;_m6Ǟ1ԭuI'BmGjV+ "sVQ!Rj =O{:"COCf(!$yr t06s)`ij)kp% QkEJ 3j#$YC,ȮW UtZBуϰ_7j#ף+KVmeEhfQEQEQEQEQEQEQ\犾+kmkNq"D̾ӭLF*v*1rvGGEq?0C9xoU֨2~Ƨ'C9xoTHx/ /*Qe5?mEq?0C9xoT}j/;j+^_U0T}=OqQ\O4?r "^_UZAj+ڑW !7 9xoT}j/Ixb<}ڍ3~tR Pq# &>7g?ZS!cERG=/Q7~LTeaKRW9`}ac"N1Q`ioFOʚ|;ҷ5/cQMS$VZcgzcOh&)nʣu旱jl: u* G[mTn0*=Kf!З2M ?EQ43Q6smc"co?wj7{s3M =P=m0u Σľfd>hֻ ƢnTd̖jLnḑң:2 Ȩ.JfW:~4ZD`\T83)*?Jʵ.KMmiK֤/8\m)qңMRzsZp*&5>%ͦ/Q9@5Gq*kiK\?J i*}M TTm:~u'5OF}<~i;~ ~>˟L{ySOJ\Q6 L:z^#8-bbݫvJf)5W/f(5_ʘlqW{_Mf3֨o7jiSʆQk|E,~Z-ӏ^OڭvW+/k֜􏶨}e N?H_?OĿ:&ֽJݢ#Yz<^g<4Qש֦[.粧7'd{`Eq#?r "?<CaW?̾G;j+^_U0?̾Ƨ'C9xoTHx/ /*Qe5?mEq?0C9xoT}j/;j+^_U0T}=OqQ\O4?r "kŸ,͡nKFOL'GNNђoN֭3rD9VbȿV#$^ mK6? O_]V ohWmK5MX`0~=?]ѭ.4]KO@?,@lV\eI$rAJOQؾYOvk9zdF Vݷ#5y[߶Ե{_fNrdZ#k}94[$νoyX75@O?_?ΏIGG_~E~/?skIG$[#/}M o?S?Ək}95$A?k߂>G5@OgA VaoJMMĢ4ve魎_|9;E7ޖN୏KoX5A6NiuqخzHzGSB6j7j74F?S?Oơ} H߯Q??J5TFSTF?OʢT2)74ק74ר4ҡ0_L4}Ƥo(5 o֧c.߅J~Qv+24:iRY xm?*Oj6r7QJToҦEߥ4?JiRRiܨߥ">ҝ'A/pJR4"_\7jiNoyJq<_ Cj>IQi1?J?7G[B W\@տ?w?U[Gn?M-,cv7ݯpW鹲_\/!g|= O)_ʹeļϸ|Y_W[k|k{4,P. Y_j :,VHU|iWOծsW˄.k?<XN=;_O o?S?ƾY|~tH??:oW/}M o?S?Ək}95$AVaoS[E~| |~tx{07_ o?S?ƾY|~tH??:?ռ?mbG/?sh_,H??:Miij%j#P>_j[_>EM> c' 5  +rV/W׏)p6'ʸ5oV𬖫%\jZ ?S_,.pLE\U%h&]K98Q ɫEWڟ2QEy/ YTQVEYW.>*| Ő[$?>gce>@ |bތ^+ڧ_juQ=ƽgp矽GC<#ۃ/w}Qp{4no渿GCP;O|=ۿ@?GkhTn?5> jiɠ.~W7]7M:?S7_<4J<m Ѝ~wƎ!Si^"ĝ/ݳ㦿5*Y_Nͷ5kSJ׺׭dl_x/=r uv_՘Oៈb> [ }fD:Oԣe߉5[ RAfcd=X+"iؐ<֧?iGOqē:U0_n#'QWn앚ڿT~G0¼^1&4T_Q Q'? _af#F}G8zO~)|<־$jD2$Ո3X0η1V㨯jO楣G!_iru>>m>Z+G0pE~< /vZ+=MOTςY]dӖ]ξNZN M!ZN1 'U񧈴{;+[đ:)k?br>OqGCU0!Nw喱{??Z8G)0pBSZU|E>&}&ݣ`8+! #aNy3\h9.-QAIkL ,RȽ8' z0gJf`ɫ5{nگFyM԰8u6Ҿ^q0~%[#tvkzWS<7kl2Xai'\" |5Na {%q_Noivq61FT`W~!\T%U(kVLnf*uqPZ+iw=φ~$ O ZcIU$W"zѿ~ >Am ?O}+8 |vevlgxZRRU_vO.cQ٤lcmH88=м,⇅ִ]>Q!%NZχz|GHs5G q:i?wq./'(9(ɵfnSCt+7e}>eo_[֙ #4g"wGK_~7?+sZ4V-hY[T`ο/H?|?:W.gkONWEkVJS%?_?N}}_v:h6';7,9+*K^:tK-+=3)2L//c'44֌i,{w1kϷ}V*]O[WšyͲ}+~Ϋ]Ɵ?i#Qfo[r7K0$pz5 {qo }|@ԭ +BD~Z'Vb&ͱd=O8KMl /4 O2W|k8bhwW|mR|geCWIpO~&I&'Z[IZ5/ A9?Jusqs6ï5uĸ NEJϙ7ѣxʲK诧g7_\_'_׉UZX$rʗ#c{Wޡ_&a5C/?.K1x8j,䓲w}=pux]>G.JNn+KÞl:g[{xSJ<N0}q0$HR8г1s^*9'ugk0ܓ_F.J?bo ~|]4a ?d@M{-ަų*Ye5$ԯUo}yO;?$ bnnIB+vk Tb_"xx_IO aI|H#??W("~wU^w#'?šH@?_D?!`忉|=lGjJ;m/x~ᎦmKg̥Z9 W=S+XBicFQr8VM?ppj3޽fش^ =>h QC OS~U;R*\)uWK5iz>F8:Y/񧉼/kjjZIpcc|W=JVl WL[6=u$)5K9?j |F>&z~k޵1Bmx;M<+`k_tKǪI|!2` 8$WU*nrUbis])+9E)4HUBP3I;wJjSQjާe][-x"wk61^A?xSҽ1_;ş*/Io$ƾjb;ek]b1p:6 ;|I R/ί&R؏>q9e_k__ u#/m|/˨FjmlMz" i:\Gn5U2phQ]91Z> (P()ËAUɠE+y" _{V?a\C-6 ExZ~H|QiS[_ V~O%H [ }fD:Kku;դwƃ18װ 5Eumc 8yOVJ&ϩdm\}o]r\cH᷂,ǜ\?<+(;Ub';m=ҍ JъI/$b.7b?{-?Q[~l@~;Cn'bhۉ.r<}}2So?4Tmo~c"o~87hfs/徱z.(q0Km緑࠿$O^\>^I6^_ ԟ?Pk|hScᖫQ JW& G(~뗄xy6e Z]^tg\s }c&u+(VEM'S\~>գ0ZLm*N2=\Z#5B%Vj?Q*<;KxVs֟2ʄwQ>4?X#ɾ>J~?[׺~|Cq;Umu"g,~( Ů\ w_u>Q6Oot'ςWFon!겦N0s^)ӁUb!(4g츜<+ҕIYƺkyQцXpAʺۯuLzh۾k[uz_=R4񔶒OC6΄?nԍWal&i;[j}"Skc)a0Wvm#zI^Ri/w3+ȊvybSl#XB"PW^U11v[%V?2,,0WdEWR,6H ('+sO~˷igC~k*O>2rljnJPyn<}|WÂH<'Zo4Wzz/36:^lt.*;W]ц#j 夷Uцl 2<=e"g5W%kO:M\.:zKi8;s>(DE}ӥSiJ)6?UTp)t'pQB+xͧ??9_kATG Tе?j~d2Wve'ޖXq?r[f~~k?}~϶M1Tu_??/˲O8?嬼g|ro~ |m~mzxVG iA1{V7 ?d_/ ּDzs~ܾ S16\mZBaϚ!۷k6նzv4?Msy$2 tuè#ظ2zf8L5#{_WoVx8]LMWZ7 >#qS$-?F<[//ZWAfO1_}1/?DO2^JF 77ʫ{UǸ? {7G[S^AZuW qH?57)hOYG52z؜le U+s.wm~* 54潽WCTs'+n[跤m.q7C} \~jUXҋ/GZQh[е/xDlm.fvR)+ F]*aݫZDQ-uJyIEC8E=${?{f9}LgJ{t}+6<#kcju/+X 禋n?_ %EןYH _-ZkymRM|QcmBǸcFo>6 W>*dծUZ? Iu#?b#_3_0XZ[aZGa28*"qv|MG?;j2_{7ޠfցHqڟ|Cm?:Lc̓ʱFRx(ࠟk4fSM2P [SA^SG]or;J`+N' N:lwmυ8+ʎ vz4~> /t> /uZbu'ʿO?ȸ$~/g̎|e[ mCx'_Mu]}|cžc@%Ze7r a*ÑȮlOM^Ժ_I?֏bԿ{tR0|Uo_;9U[tW~Zxz[O;yFjAT_<+ 3Vu2?6>H/_o>|_Wg\᥄'5L">YC+iSM~2Jb:[QWGCtOC|7½~{W]&*b y'׭i>/_/^զ[gLvT^W@?b4}O+ :{_u>M"(o5\m!#8S]{h<3ϭM?e؃?WYO**8}oI:uEf~)f ( G?x_mS~6Z9%|?(|?+3G/ 5_s3/y_2'<  gl#y?¿x\ό?Ѡp# [ ]s2m@NkکkI?_fx/V𵞗j)oא~ȿ -lj a}?u+c.(`t~/9g_V ?W~?5-R_C6bəozѯn??i˦~VdeQ;6 袿?<S2q8ri'ms3MZ8I<<\VMt2_\ny$bf'$a 40\6/Xm>O O8-9heJf;jeU>Y?~:vk]]*]׺knCl`/\uWx캥y|ۼм+"+t+·2+j;uMt{=okJ5,vjy?4|q+(&|H’ZAE)Iv{jtr+g#ֿDo^Դ=N%TkyT0G>/ Lռ!gf)QDZ\~}c ާzzX_eYci-%tǖ4Z_h դ4.:/"N} %tSMn}oMŏ~ dɲ<p+ػ Bn#btP+kώ8rY.k<4WC/?8k7Y5Ĵ=9>Ʃ| 1}?4m:9nN?ղH?ࡿG+_i+O700Ȓ???igkYi{@EhX?w> xMKW6算5т?2Mj_Tʤ ۲]('/i!Z:kw=C(*4H_9ZV\n=4 sy20?_XlcW]P? !hZ}gGR <}e󝣧e_#E|M<ŏq#K1ym_#onߋvu#n\84уVhV??jH[|M NMwV_+_Le %8OuTm7 v? +3Tq^aQJ@|Ay'?LOxv0~:|.|-G!㑫wsXZm鸶R+5@x;Xqڿ$XF41#iQ~~_e9*,:Š8z qC^g5M㾻7|RU;6<$qk ǽkC5~"=Fc^?~__o-:kpltG]ﯵS>iG?v|1OJMon#ǥ~ƹi>2[Ey4H7,Ðǵ| |4Qn+iCGE`$zW~E~h:KXķҮx}z{?| E~vaGqXgxWO껟3”*QUUZIk`y৓._PUq5MZ?*,aY {Zz~=־=un?^oڏRT}cҽ.\bxCҽ(1_;ş*x]]BN¼gz,sԧ+ .0W}i~Xvki֨ȾS0_{|0!_Fx?WOs^(Eٍ{'5GlpF%<#sJ0M=~8SOx?)l E.10F^kt*@<}ioOioO_^hq>0FdOۯy#y?y#y?¿x\ό?ѣ}?LO?nl ?l Eq>0Fo>$>(Cg fYdRN?LOe8slxLR}V~|6_񕮃xjo* 08^I٭=6FH>a~?A_tGk|UlNWmvcƅ:5:}?1QEzǞQEQEQEfÖ+w&#ov~W AgQ۽U3b> Z) =gTY.7{3ʾ72kX>Âʹnc WOg\Q߭z?]gG-27M=Tג_FSaቤ٤ףW4ZY&i3놟~}Yk?M>iAYk?M>iZocUayg7kK~#_?-0UviV6Cʜ7N#GէOgK@5[J~~v>xҮ?_8?k? e/{5SoWP+_{'J Chx+:eoH>9h 'PݾG)y?#z8XyMLg~y=KVK, ?ZuoOU[F#A=jCXx̍Xw濵r–7 Mx&?19ʍEf,[3G,,$FSʰ_TPf_@>zeP2~>~?ůV#n' _gW*ui+գyG_i|֫#3974~O='AkỀKKGהaC]qF2kS BkvZiO+RX:sWMY/aW[|?{B&MofҞEiZig[fyl~*xCDcBVNGOtoj,V:=O!'8QN$u>+j&75ƫr'"$=p++ i [dG>b=Ҿp}ѥ+0zW_yG߿̸7mvij9J*66C_K;>t5Ӿhm{MM~U!_#H. vǿesk?nMa+dl.FXlѰ~lDRHHmduʑ 8{k;wL;iNPf{~Һs9q ϧ+D~iQIWj[tÏ _Sz1VOڟ.39mS w Fj}/MOPxFҴnF'OڐEJo̿ v 6OKo?¿JIK4޿X:cMq^ p$I%p*3"WOHt)--mmo[+T$}O^媳s_G9}mCV{d|iak;~omڕ%}kyWD߲|,Z%}}'?DOҸnKl_k's.Sw`^I񾭟 }~C_7묟}xG BjvhUmCO5 lFA^y֯ߵxS~"=.$o2ݽ }8=k7vO2elGc 2~8ߏuGp"c*O8IHGOxU֊]ᾦ)s%zŇtZ[xMZ?*ɢ_^ 8gq[/?1?k$&v^c=l ߭|ga^?GKa#iM(O=kSS䘊4- dU,]9kz~(IxsKwC(S=Ou׎'˫Xꈭ[[A0,zF_'7e8*l%h3JV?"tq=O%zvsWYˏ/k+@f19x\4=tm߭f}G53Ϯm߭f}G4{0߭mg4}G_mzCm-}œ+B vg>4wnQݪO ʄ|?jmcˏ6UoN"x_W~,_zg[|7ڪvP8yNki]qleRNRr(Ѐ(((wo5>ib&#+F5`ff8IN;? XcggxޏVOg?(Oҽk2/&dȿc_y/~}^  pߓG2d_1~MD<#~?Jdȿc?c4y/eGs׭ke f4u?[WFן(E i~ɞovo nX\3|$ּKF\v`o_*z?ik׍t{%\ײxY#7b^<uU7J+'#7>x){KM<7py_Z[jzfmwv0 DmP0Z3C"F1b+|!sK;&]qW~~Y[>=?ֵnxW+|g'$N_iik_u9ʯ9emuFE(}`} L~F޾ȟl~?PǪi8$ ρ??JRw :_O]_MѶd${%kb#7ڮV76n|]JjmGK-/h~tZ4wcTGNA {\U]h-K\Lx<56~5 <$HpLJ]BeSk]UO9)Yw0GPP3jO#sctJ !bڠf_\:MB*?~KIJɫnK}B溶GIa]?7Ol@_hk??4N5vKڟ-??5-q4OK?K`j?t6'Iƿ3ᛅL>?/?C}OIGm.c|QXi=?=CfAƗi5?yió|5uOI.4&~wy6{[{t>o5~_蕯}>!~xn.r[F꺞WV]Wuu?c4!B!?ƿr۾s[j3/W_ƿ3?Q_'l}?/?g?%!Bx'Yui ,r1Ɔu?u[j9`t"4<-.+ܒR-mw0qdНend$r11)ҿ[+f~_SK hv.+U[k#zx~#}ό`/}B&}Fs_}ڎ"֒y$2CFHLUIғդ;yMlM(M)G?n"g]Ѳ=UyM_|QG ^*ѪF ?m7 %"%/Qqz4yf/K1^I_W~J?_0Wgz~)д{ i?}9Y׼શWcb͇c}W~)ˏ/kдKܭW׼S}1գͺc2׮{XO$0^>?c^2ʰc l/ZdXhL8ɯ/C!%KiW&EC?  pߓF%,_(Oҽk613_ 'hC"K?Y_K.&K.$t^ >hϱ_^ t z78?AWGl>8 YG"Ä GWl`ھmZ( ʛeGc')6*zۗ[]}w*ZZ{5j-;|pޚ-5|U?k mV?ٟgG!w*Wfo/<^4w/Tv RJr RJUa?~+^ }{}j>R~u&b1?Rɍ*l\H~z3GCe$,E'AdSI}jYYGr3GRi4~)2To֤= 4D-Tr}ڑ OPh5M7iCP\v = Fr=*6CQH oRkЍC񩟧Pk>mJR*#1 }1 EDd?*ROʢTȤD|^x^#GJåBuj^#oԒTr}E~'o֧**S*YG,駭;YgIdr}QVߏ_Akr7QJToҦFr7MnM=*J[ 5*C*7H78xI}iK"40 j1ґdD~Cšzӛ4JqM~ 5%GƆ?+S5?J'!тw?U[Gn?Y,xh_4\l-FqV5}i5>?WXeSՇ>ҤxWm>x/ĺV=t^FtI?g»"3'tfb:gkdtφ˖%pOOjSCD43Qb_/_KF T佯 DR ''GU/P ?? zV97O2F ''GT ''GU>G/P ?? zQwS̼/'џ¿ IN?Iѿ|K?-†d/P ?o?y_򨝠M@OMvJ0+I5|$|PtR0;i{"v}]{uO٧IZ/Uem*;U7((((((+ /4|iCr1m}t+ ~W?ZL<"*%KUc>Kgg_ c/˪Gs"As8=k֮vs]#fݴ+U^!qdl%Px&h}(/2}˓*)ǹ~Wmgڸ(U?C㮏 {Bj祳m_ gYe+UVjIے{y(W]D7^:]k%\ײ=}s5f>*WAw_|?+`;O_u ҹ_u ҿ?|A/APߩ*̈u5{GSQI:TC j#U,娏TKbG/CQ|1Nk2OyyA@X/o#Nş_Mowg#WrxrQWXSZa>?G /Fog ?p,j~̷6?c?3> xU7︿?@*ch6{|fb?"t??AxQ7__-*+\Oʗf##E> ߲owN#__*kvSS?ȯQh ?g GG︿߲_q0j:Oʚ 1Uٵ)bh"?CN'_Mo'#WymBOʣmدͯ?kG% '/F OW?︿:EE~_)"?DAq54O7//FΗUh'S["?G~Ox;}q5~r6n[R~Tg?j??G?Cn;?_M7|q5~po1TҭOʧ>Eo 8q57 G!/F4䟕DU'S[K!j~ G!?/Fe?r3j:]oKSJKRo/j~ O︿߱K___GJKTO[RT[K"H)Pb'#S,x"ifDdկS_CVb'?憎?N7'O/E?VDt;էK5+C\߱7S_L?'xkDГ*q*_Q?e\~;?m}Eȵ1*R?eWG~Nli?"_ʘ֑S:_~ 91'//E[ Ǐ9Q-~_8g}N@ 8'1/ES G1/E׵5cTS~!qn?ދk_~~>"~^ 7V/.K `d$d3@W4T(iG8;z3i wƚ𮢐M=iZz`Fz_8J@}cC~?O㏉Cx3ҽ %/Pp_;ş*//dJb+-yG px["}_C)<{OZw-?jhe8A }?Ob=?J#ZA[xgñ&s| I&-DX2eJ)k> .kzŇ uvxVT35Υ6b(gS䖿žt=>`*Ҵ)ikf1IYIŠ(QEQEQEQEQEPFEPct xO2|Ta7ּkCڽ۫U-w:?/_+ǩDz㏤G)f47rO__g!Ԕ$>lUߝh>'>gkʲ}[:G{oۏ3Yrtu^y_gCjo bbdRg5kZ|;U@ޟ..N=Ӟ=5/WJe/:w?/q-%\ײ73^;O_u ҹ_kNY# z M/AP߮dCߝJ:OԚQd-D[9zGI/Cwj"¤¥Ȥ> MM'Adk3HF~Yvooo&Hwsc?~h?m牼=cE9c[t)Ӿ{ka;0Zȶ?/~{{' Hλ z5wkHh|l~  dg޿IO_5GǦƚ_M[;뻈I *̙#R+* _"~+U;V,5%NzKo1ƌPZW {h'OuT/֥y>_[vrsӥ{'_~+i;ltF᝹=k9feMVr^4g{OQ>5SVcSK\K=3&:><~Ⱦ.je`[ LRxu `)]RG7CQZzSKX_0́:g K<i)kK4uD>Pq!anOBM Z|v_<8¿U:o^a#`~P8\˿U%x hf7ZA{R߷qXoҺut29:4I}i'D*Cң4;MPc}֦M=k0#=iҜz_ Cj>IQi1?JJV\т^|I_0Wgz~Cu h6?0x_9Uٕ?)^_C?WT+;oE?ֿƏUn6Q+?,o9g?}f~v/V{Yawʗ_ʲqտ:>}[~>!VꮵGs]J,KOS[a׫&]*J1{ZG \5'_I[Bú (!^޾Wg}Nef~9xW4(/(s)ƺ܇QEEPEPEPEPEPEPEP}F=Bh&UxC ~S|n/e?XeVh&i V<?ҿXk |@\ދ]"yk5ݢJ}2GJ%9mgtMYsI`9魏n\pJ~Ѝo.8-+?>z+@? Aq__˿?F b ]pn ( Ϙ0^k5V/?֏?l8rvEn{Iy>_w?g _bjOt6<{(=o%_n_W#)Gi_kN7J+N[# z M/AP߮dCߝJ:OԚQd-D[9z3>^LQlE7}*3I7}*3K*;I}j:NPfܓI;|A?3"4" jCt_=6z_}x%յhجMzunҾ+im~Gd Gt[-bןjp:ю_Z^78|&º:ʸ a~RB=|Y 94X#m'FVf"+b N4{^`]GqC; f=5y/ 0JbxRCqlE(=-uoO"pg_ xj|AxoZV/l&0̪Ҁ˸sW̞/>94<-x᯵/x&9/w>䟭xXŏG?J$CrBK~fk}O?5ŏhwhDYU?//:7xA<7İio)@X/|8L:J[ ?b|#kڶi˨C5 $E@,9S+T̜9ݖ!E{?SZ/爯n kR[,ŽW$Bcz ƾ(+rGHAQ@koQ0G_?K{TOIW/pg )V)(zE_jo/SGOn&~ZE~&^ U8)Uxq|; \qw">ic;]?xVemZĭKy #ԃ۰[_]#X >W ȏ :5)Fg'BvWOKAo_6aÆu?'6s,?o_9[1_{~Hq[(,eT"Mt\@_Wzno?G'm.Zk{yVG WO3-x'_j~}]glA _jLda `uYRJ}kc l3n?~%gɬ kH l.* OK??MOu /n%'΅^W#o_ؓ=|7zVx.nH.A˱#J~?]x@ޚ7[D*aF{J Mlc{+kW߈0G4Y~oQ$F:riw4n,~FV"3_Z*¯(< gAY;wPBk%$!~%~Nk? /Q h']?ߍsWgߌ~֟h/[Ev:C"?PWY/eV;/\Uj>8!gz]0j+5Dϙmdǡ-~W ~ è8kګzefC}gTC| |G{)ojD..*$&} >'/m+qOO_9Zٛ~O[["5@ (s0}*`AVmj,ą5pr@#q_D7iiGK3J1zTRVm??:l|3f[8BO1צx3|u!/Eu5-х:öM O/_u\tY_х~R>(’?d5spLwPs ^iZ5/߲„5QK{xJMj؞F2 ʾue}Kkh:_[MG$w%Շ"N>%|[,WOFڗm&[I>~=l/CMڳK( =qXzqSwSjԋgs>|~]KVO>`\eW>T#DW:fa0*+JGR[QEtQ@Q@Q@Q@Q@Q@Q@Q@Q@#|xq҈gF~߰tg?*Lߢ8 :I <+ο8KH%e~:]7⁑Λ8 ~5|V~F}j6oFq_?~#ӵo$ #j^6E>0n5;&27 oҺgGry2hmՌB>xU濨~*qqQ^7ݟs BMԤ_zb^oQw`Cڃpө'<{1SQI:0?7A 娏T?Q-֙ޟ/Cwj"¤¥Ȥ> MM'Adk3HIs ?~cTƟѰᡙfhЃ^ axxWR{Ae G5[WVHZwexRRR~>O_e[+K{b~!D&U3xgKgA?d?5O ykQ70oek81ňMp_-w5|A*b MyC w(xVVjVש~Zw> څڼC,?]сkO &nIqIrѼۀ +o/?QCr#v~OU=W#w-wn&A#jdBբ{wR!?Q_w^ ?=ݹ<د?_ qV%m*M #ŌQ:iVj﵋tvYSFqVşύ>~ÝjR<Ѭ/\2/UUE|T6AlmmdX##'֫q# ̝)fNj/. a0݂z?* qn_k|PG c޼uUe67>f=*#e|N*2޸Lj<;Cat-/)RC"pĞkUX+Z qY"Epz"A]B}3_5#|&M+M֠qbH8|xx/M[7j,q̣<2Z _z7|3㯰Z8$ dߵy$4oEs[':o@Vh%sf\/~"|? m$=(x5叅?m^>4Y$Mt ka1 q"JAoeյ]}DF]۰Ee+nϊ߰3?ђc7g=k9+s~ I#ˋ:Z"4paqAj̷:/2:aOPi-ֹ(_;ҊJ+c (((((((((((((k_GQ/Y+y-n#=7R?#_kg~_ufWT3iO+PE~jt ?쭡zvb mExySm.O=LϘlu;8線;y7 =Aw{W3~(~ZxRMkEWȶ~Xt<WPXA_ ZJ=сVֿ/dx<(_|΅exߵ >)R,oכx77w5LǣZɅ?ߵS. XC?WK<+[ EyK:w>OWmY^DZ8(3-FѼWf;oz0Ͱ/woo?-~J׺|E<2~uFx.[ɌQ(|!MGMS̄1^}o3[CsO9[6gKLT#5g?q' 8+3`_VxTcc}c|B\FyccC,ϦvCr@2&2%?|_kE/<}V޺mSྱf̰ ) W:ƋZuk݂n_q_yFU ^2}g;?NOKNoTg ݫq*˚qtZNwϵFͺ;,j۫j棤ˉXFGݨ~?S$:j~jGQ?ZMDmXnQjK+fڣ}>5nL>\d+3E'bJU23sVJ+&F8ZG#t54 %cҢ=jjfZخIF)SVQ??J\HJtbSڂG2nSUw}ڳ'OʢTHJB:T5Yq *i `T/ZiGjJ}ƂZB)X= FjZ4D>H EFb_JYBЮ3izTΚzԖ@(n6HͽO(!Q14XԳWi٣^9 >X[ \'?a*[{='M@9[KU-}5zF+zYVկd^ txQVVI_qS_&5SSRb~h,k1W|3GZMuu1B42HRTp#n*Ѹ+q}bttOVI\DQir;,-FV2鍨ȿw!~}qһ9oUg~.|9jvks4|lv"&z0҂>a< +[5 JUpO^; ~ ^\jrᶈձږ_2cp$?JQb&OSѬd;kxWs#UNGō$AXyOߎ ǟA}pr-Gq׹|)R95y UlNt>o4 ՞#x>Kqmv_{8.Z<0n1ھt٪W>F;J0(B(((((((((((((NGUOZu"<]IeŴoҼ\u\}jb{kI$-&{7sV35M'OVpuށFiR׫GA|#'=9 Z4 7[L^XqF+~~nYoI6iƍ^ f] wqO9V}IUNCnNw˓#kͼO [:ݶszђ?&8Zc{?>L^ 䅊o*L}?Bk|gş\ZѤmx*b#'s>wpǤםև>zwv=7Z.pAQisck}ƛ'QNod+2\5}ʐ5}:CQH F&ߧPjg=ϡj'R_Ƣ~ccTO ~U¦E"&ƚƚ:T/V*S-"G%Fw$4#= FjCo֧c.߅J~Qv+24:iRY xm?*C_ӥF%ToҤ}$O]ÏCG obfϫkFP ?ѿ &m|&Rz/ :_qx{|KW[| ? ӧMZ /Dy7sɋmg4 WڽM] փL]:#Jv8ֺ`U1KM l(dQ@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@P0=RQ@\6JϽmT^}rRWKgxW/q^Fj9-Aҋ0eg u|k FAN· Y CY?/|k ZhX6S ͧ]&οX56w߹^}mt+ҼFQ|8M/oxm?"d&庵Ͼ+~ϻ5~-}-+nzћ^Q*$o󍯈 lǃS z}jNf0 N64G+% W ckqzI4c㚱:%9tT&{7h;Vh)W$5n{swu 2H3zՇKNS[0+5#+`<ꍹ7>|0>)G䲟QA/_(]/U,OdqeQ`tff+eG&V>]gΕKuͬ\=I|:h :dumF_id5~۲+}%-l+f  }]kKL](]U#q\d'^`sM8wŸ?{V7RuO%~U+Qxg.4[[߁*lƾ/k'%JW_|o|#qד 1o_I|CQ|\XM6M=k+?q_ n^?xsY37?Xr q+F~IqXw5nzhW5OơԮxQ_Ƣ~+j'H?AO?AH~D_Q?*dR"oiNoiPiBujaҡ2$rTmJ"CQZsȪw qo!ռϺ2l|E:1%ݻ/ڝ9M* MB_d/$|\G?.4?Yk{|rC˗^7N;?xʛBO')`͵yf8 ]Ïw7<9j@h_> dzF>yG>LWK|vծ6ojhasv3ZGwĚ;vK7&2$W'dG\ -y0W+\Ĭzc\}b_OfK/3wM_ F-pD&>1]UKڌ'`r9)=mdrkqjח''M8 I/- in[2Jg[3je5;ߘ[K!W°R@Mcw-bvw73Ad>u>U-GumS+O^M.OSέa)SMj_2H{GdDB=[5xǝq$jǔvlN42J|k0Q^^I_v"GjP3̮ln[eK9 &AzTψ%-]CHԾm zehm_澃 :?7+MlSgoC {u_9!h%#$F{v-2k~ζs ,~*ѥIZRV<ڕ*MmS ~*ч^fvn_澖5F}+VC aG^ٝmmrF=kd/^Rats j[B>oJEFʝO-D(((((((((((((((((((((( FEIERaWץf_"ƼJ(+cs \W?gkkBݣ)Z$QQ]$xU[oRZ6t&#i+k _ʲ mu5]ZKA>~ELt{Q,> ־݃|A:[]bڼO:i>O(昺_ ݼς|mO#8QT. :o^7>k~ʐAfƞ־t-ء"GzNMiV igZO+ǘV1ܭ1_G>/wyr}5貦^Fχc]1LμEƑ3tVbCY:Ūiz`fc ]EX)֧Q^g7L|>Gص+UO25ޡ=ִ3\VhFqJ|CĞ o4ōz?Ȯq6d4wٝNJ~ b'ùXܴx?y4rɒ=֟?V1V/+vo}ҹ2S^G7  XzomTMf>ӟa |Qzև(8HJ';o~} /HO2?+mJѭ1*$r^ȷfz%@$ǀX3iZv2)>p E f5aLuov ٦59]#ᖿ1ƍS~5I[DYxKXY'= `%]F!,Oֽ?ז(+.Ǘ[)/A]v[xy^u8A`Ӈ};dA^Sn~ݯR !w[9aOOY7Ec̭bZ_>J.c:hccۏl?ekNE{.Kfmjt+ǵvz'K=zq{p(+QHVUޤg~0^?V(vn-m@UmCWos;X6֡r=+ ٪}DK4H.oNc^m(r1Y]vB(((((((((((((((((((((((((((((Q@ hՇJTQ`FCa*U-AkWGGZR9־ޫ~*G:Z)½ƭQ?5 ?~ʐ܆G_Zo4iՁO־3'Q}kwƼT*KJ94c/cS>:~F4 f Wݚ[rW/x*?T}֟G4N_Qw2p~Q~Z׿bz8]Suhs+ WGV5j_~KlB~+ptwkJ)}"x<KC5T2Frt>VV^W{lZk3džoej"ωG۳Ipb8s0T_Ju4xѶܤngW>y9m=\ψ*uM'^%܏ǃWV;UV=*uQ^ ?MOvm[GW]2y]fo&1lWhO}bn $,1+uGO 5-b74PeoKI,> {kk"#~f >S:Ous,5?kxτxƻZ:K8cڽH/II/IeF~'}SO߈i[XB?* 7p4*eTѨhs:ok0?vl[hEh(bqRv:p((((((((((((((((((((((((((((((((((((((7NSQ@\θ3U~C6}b_SW1:kK߹_^xo |BKh.N72_k߀:τi4Bŗ!:W޷~6Q*Z~U2dfʋi, Zކʟ¸͖[y8VϺb;|qo}j[ a%9>kk ^R5Sq~z Qi+'{J;cj*J ֹbyo'D FVSo|iP7f;qG_S-m@}+fP(Һ9yOonWt wZ [@_ʽ>->8ԫj5 >Z*5mZxrp>EZ@`QG(sacB()h&EPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPAi[E%rSEvQD~Tش(VԫjuB1EP (((((((((((((((((((((((( endstream endobj 9 0 obj << /Filter /FlateDecode /Length 106909 /Length1 218908 >> stream X } |[EKYn[$Kd;kN$ $$1YHHX e_Rv` )] -Mi-BK$ܑlٱCJ:ܙsg9s̹soRZC!&!HMeuG*;*JxzD9UԾ'b#u~WQmF+;+/m8&S'UQܰ|S߽֏Pc>ZyV>PMk6_vC['NaJ+"?Ɖp< =xh;)!$Y !a!'w'/U 2hhfXٷ=AN"n"+B iQ<9 jM9HŃ݅+'Ǽ7wiE$S+`5̊ٯ5ֳ֡IW%2̏Ql0!\}AAyuHt6i~%xּJ:u0]h?{:{g u]#Чfh< y6i'oN5Qլ\ ]q=gIy(vTwZYҦݳ]tly(*HAQCi Pٴ #Pϒl>rӮi u4SieHoy̾.Iĩy_(sl̯3ke֖y6g_O=]Gw|z:y@Z/kp^i d|yy\ڻc>6ٖ9˃񡚹gQ)ZLW"bGz{>S;|s-fχ_@u\At1*Nu'Ikx(lL[7@uWNsǹ?}~ځvW߸esϹ}`d>&s0*ΕDusq}P%3roQ-s*M!bZP}qzdΧ;wQw!?P`2m=ʝVd8rq8wu0*cDh;?mpB$y']@8 #9Q'չq8w;sǹq8w;7p::+Xc~/_g[c;sǹq8w;&Q9K E"+# GŨգ6ԁuh@Nt?z=k]t5e|\STj*3ELVuuúzuR{N0@ըh9:m)d*<=NM|:3|%DjLz2;=r̿wV!>PһqlE zh;p,cv3|,B,R*ֈȃ2M Pg{hJN)tLePb:H PQkC,R>*g3@s: |+Azg=DW!G4~4CZ,NY3|Iϧ\9Y1݁g_):Rۻg] Z4756Gjk*+"eJKE~_Nvt-4B.)>eh e8jAFsc9$,OJBR2>uz\=dLRTmqXU;._Wqf.κ)lpF:HYkk/Z{Ul4$CT Ǧ!*"tFMRfֶjͥ*A~ՠ˺]c~ +YX|i .:8p;?:7y.zSw}8=ey\"G݉s&r&/s0j.Zܻš [wߊk1.?ਮ&tTC$<ך/Ndh;6 9*IHbk._6V5VƯTvYkUm]OCyVCݸ*`@תՃ>*.m0 vtwc.9olo3J' \).tcnA~vq.ʀ.868a\UQK[gh!&k0%.$LgΦҸA֚No`IcZo W`vFY F.P VkvaZsmlw4-ig$ "d'N*Z!V;<ȮOd[8 Ft_~MQj ZnLj,ػP$r`SMb\~G{Wk낮݆VjS9䠮jPW/zRa*JTO״NR'#rY.;_9J!.-%F4IS$hHcIZK0IH ƺ gW}xp! Q Ҏ!KEAr JCqN:=Յ EWi3u@ԖBX5(\}\7wrمWv&*"BAJr`qVo{dpo`ߴk]7'ΊAuI<7@#ȍM "ו6ER p 7&DH+ fvuKE*usAdg"-%>؇$%&ή{+"w)u ] MEiE AFs5 {P_ʟ\/GQ#:Tθ:F'aK:rxr O`3xsSfJR_@"DHDCBfbl6{>6g|FS GF௤I_|@}&?#wBw~ؔ Iְ&-ߐ"o FW WH#xK~JnR~DE?$p 'x ħ !' xa8H`а10Hac{#(G|wؘ M[I!  KR"I[L&_#p#\O\~-k p5WO`+\NaCC "p1vN` J` .$| l p>'Zk&O`VXN@/ez,%bB.,$I@;O@3&#PK@5**D(#0@)ú0@B %u>8Dd !&֖8 8XbI0000H''#%!&wH#wPTJ r2Rb"BRg I` 0h5A F`)' -#S  |DoJ`B34q0Ú*5okj~3x~MHe$' \ c^&1iHaM%Qr FϓVTg 7 VG E'E#ENK!%&gww\p;ۆխo!p3HFJHJ@auu!p`8 nӖ\98`p+Heȥ?X&ZޖXAxV2 a !|cB!|· |CA@}.Zk p; 7C (\kp- !}>" }p-P{Ux8^2Ek+-J,Z \H`. #@)abaE 'G D 8,rK @ t2JI   K1%0CoAx o u`˯! 3iG <^`=F;Xwl'ET$t !PN)O 1CxŸ »ށ2 O  Bx('!0 1qBvX7SZK` !jVXI`XFRK,&M" t '#!MK @& n.'C&@"N@A35p/  ~~>eY.|ˢ{;/}doK)]q7#mx#+Gvv;vҢm)FI.tv ;61j`-!AftH@QIށ4ȧ%ɶvktsG6w6%lLсT4:ٙQKo֤*66G63F7vnzdc7xg7la#8Fη6Piz) k\H[|_Kg 7;ilE;vF:_mg S`&^GfVgd76}db6?2{ <}O ~hoߧ\ϓsF)uo*IWI+ʷ,Rޯ7?.g{Oge?1e2F.""ʥi/eJr|)sH}ڈ-̗J$TDάhBDGD7ᄐR(yD- 5bmL,hLi]2H]5jǿŃQ%]Cu}EWu a1wPq5xqp/D"82dҠn-[lne[ e。_8gEs \-Pd@.-U'߼߇wB#9!wzBO_P"ԇg;1: T@)#yƿ]ۀs86qbw&G'KJδ{*e"ublfZhg|1Rp* #jl]' 9}%sW|$z}Ӛ mFh;ځvnt ڃ.Gѕ*t5bįAעt# ݌nAt' t}_۸\ z!Mm0(r܏oA*.A4A4<#牳Q:|y=>>}K)KQC"1 HKet +p2 v~^GAo uk(]Pr Jro?s5kFR)SF'0n8t'G=̝8:c~<Cߞc@ǀ s{Pv(TY;OCL s,N9yfڗa'k(/$ ɝ..TuLZB}|-NOv(/'ޛCECr>?ԙ)?pO:3bcDQM1(6J &tZ %DR2nǓ`Fx2GyZd4pWC*y”{3jgq^T. t E)eEߙҊDZWхrE'xiȎz9'<"SMщ?G8H:)P2[,rE:(%]# H$0N+//OՆ!%PwYO(y,HzuǂW=J.!8#r^oK!|06qB0K+p06vHf (򽾼4pJj=J,5*;.SY6R #֨^:L3"t_CbZ3lw?{`a{07Ww Pіgyxt@C1/to,Lǂ10a+Vf6;_WIX %sT-pWl{ؖcj}R[S{Tpu\8z3ꊚM 2Tlvm'mW:O! _O) /r9Ux)!y* E*n0u雐ԍRPfi^/ Xg{ =&$ E-BC\G'>%\oeTZ29mS2̑,;)KɔJ ZB@n:L[$2Kq*9S'=$eYޚ변ZwP(G#?B߉MAJ9##VQ\>Dг0ܞGF 1=>-!cpjwn'O43LJtQY5QRo_ײ;/.Y셮OSӰpRzH]ѷf]ݟ~wqwvXSm5,ș\FeZXcI7D]-Yv̭~qGqEqD# ޵u`f-prqV8m&?/G9|, > W+8Mab!-eHA'dƌ3c9])qRH!/&b1DPFY "Cbi,fL$LkpiԭD,AܠfL:y2_H>dC"fh~`vZ8JEڳ&R((ԇ&aUq"يMP5nh2 "vF܋i֠'#"I.=b/ZW51^_RTǟ4g}:jLP[ jWjN~A\Aq]IdRh뀉A4-')u;$.0g$0Eܞɿ7 aV(EE@@|:](ję+ r%b*7шA7>XqLRr}|KFsr`lLdD)C Bt.DAaW1mW*Ń%B)r:v5j K*n< X%RKfk'wAw&/ S U奢ya\/0E 21!Rn)3g(pL"GO'N~5)-6c~%! ia94Vmȝ$Rmr3b-Ͳb 3se:U4 w*0iEKue S$zC"_j<֌;j^BI@Ѩu}B*&4y+B)Sn)v,->+R3'2ow7>6[~Yڴw9FbC=<Ƚ'_\=RޑM2iqe] c&/ ˾#͠r}[ud͙.*,026<4rrt] e{VTwecy5T[s"[j0I9f`f.W!NiǏq|8aL2}!yL Y uiք|;k#e}(y\ UՖO>vǗ<Ë̂"TmѝX|w} Qqzt$1kUзrAćUt!Q9)MtʉH* v G ~4 *J1[g14sl/ﭬU.fai% n4+֮h [Z&ь@*jz#^ZZs}t-æ*sgz:\i2#ݔ.1 jWK%JFu(*NOM![#U?}g,5>bYpʧm"17&)S/9969T}ɜE^:[`8Q;i0҃|8[%z-^o#Re-SuľKW.zČ2x&o0ISvP %O, f3J!#K |yF1*|Vb*B*ćL"QJًO3W% 8!H~=qHIPi uJ:G[#pAւC'uNS:q.&#">$LޫB-tWgU5Gyb8p_h1PRKAN l0"c?;Wt&9'7阼S/kM .ήsfjxX:ec~IyTv*B+4^hYl}j=z$n(En+$`E>x],(?u-o-"#2娅M,p3W))-2يy# }CHZ8}J۹\*7W;BTʐ` *+뙞 zX#7ًEd>r/\6gf*Pg{Twa<2Vs_JE6v+WG=5,I|!ugUR;֐S8՞ #b_k  $A*jLvnjzJ=-ϥsGP1-3 <DS3M6_Vo{]QKH 03<<0u^Wiܠɭŗ4-ݣ7S4.E`_78_ òUQ*wG,n78P|b٢[;kse%ؑKv{wp|y@W,O9Вl4`yBhUYUH>J+bU0hCIɹvl;9SQ=өI8 {dWRCuq"O(Sbl|$=|QՓ>3O(+C-46nT lSkr֎_״cq!RZ9E:-<ɞS?U:La N|2u83[agYyvfbUUKoȖ_g2cA8K&Y`#`WIF $_I@l3EӔPe>+t*+M%g^33۝EX sm;#TbKu.huR%) ZshM%`ȷ9?*Rځ冷 v_݁.kwpU4iuPaMH⦦K_Zs/պwIwWMK{asmlr !:68~VYƮ7z)aڔ$.Uu3B53XR kBTSy/ZvF YqcI9ͤHD]_8KQQQVڠBcX(ΚUݝTIE~ޔ*W[4 h7(,F{ǖ[Yٰ5K+dZ>ݖM*={uˁ">+ ! 9 V_`0iΉ>bO\t"E9"Ma L?(9$>xh ^|Y]24C"w0g*y0>zqFٶ7oxl<)ϋ>_sQl3&1uVu)>1K`*lil}V{/rkvQ0L>k"z~ /n%(>\'_eyn/C1O](0/Y)/;'J{i"4WG~CFPY:3)BKi>>{#J?9LI\Γ;B.a<3_Rb ⼜ARҲP?|A3QHA5 BdԯGb r?_%Rtċ6R<$MI۠Vg~ Baej?x563 0vEz<Џ?-]7>s+̸N%dy7NA#%3iJ=XeCh2MQBW(2`ŕYJ+R^h7V?Ha)}V+5C?ݒNx`v^[C+t}{G+,$J!ph–H7l}tB?4h5}& O>ɥnΫO\[Vgh5Z *j7+xMxRy|2YdlC37ĦPFF-{m )6-_/ lF,vI$6XFz-1UYWaթSJI*WXnW~I3^].AFжuQzHp ވ84/4[#mM/Xqî̧U=9+Aټ>\5JRj}y':n׎EPGxM 8ͱIb0ӧ˳-uJ[{ךU7tMS+IR|Q +VZ}asQ*U&J+ryZG)@u }"s W,li3L؅=@vJD}5u_hЊrj5O-sʵXNhB[\3˼ [3>B/7GD*[81D M}Dk܅^?5 ?%(YcIUH5lɱyY4[3ۗ;#Ɲbn:6JN,ȭS3sCV{b]ٰfەxJWB󪣹 ַ LaX(rTl%o,.r6&[M_`qR͈UtS+,ͲF(W1b2w ϐL!LPB~1&&Xq0aυzczwޜw6p)$`g:o(驨\Urch6EZxk嶃K.M|, 4u—*AMh2VY۞W[9p2y~D0-qhȀ'@KtwB a d9 DM(۞񣡣*Y^4ss$LLM-k t7Bt:sMM*6:yj3ccC%} NJA㒫rx hҏ#YYj$,Z pM[¢ 7-ey灭|X釿(Ĉ~YWG=,Tj;%&I=M IIڎuIM7۫kYe_abไw\n{b|e)_#N;3Ut~^qV|mg^I2g)+>K1vI>|ޒJ>z*9#+X] ZB;P idsy58U[bJD+\Q)19t>a͵E+Iũp Tد8*r>#y0LNA*% X$b۬J4y6/>ćC$1*mDJ`Q+&dށ$7֪-sL(/]'A-C3YLřc`J-<~m肈=XĄ&}~ FVFHSmQٵт$MI;Lh E  ,V;º{z" :;(_RBXiQ."mDCbM挱I__78?dIM>#k :i޴<Y o|ަ/R $IsJ~}O دO2 я)~\w߾ #f,,y./vZcكr[Ɣka:TX{ANܨ)J`ː E[hdm(ef-7fcѿ9Ӻ=>>̨D]TZf@ 4F@l"u%WLǙGM󚌚$^5/ziT&e(BU9 b732@eRt)r4^h`, T"tJvNکSSZ5 5-W/JYʧ+iTIU+j/̒#d{CﲞXrH8yn׃!ҙ|gq7wi˕4[IxeS-րľ UhUz?+(LXjfS9 TMDh}rhO*'c 2J޾mfEh(=[Ŏ_=_%Ivન$eF3 %S':w=}4BkQjA6Ul /-}N,M ؛umַkB5*o `Ob8h+mc."48k97.8?Bpvd{grPļa*4OL3В%b4:ou $#EFnU(BC5hNϛ**l|rUYGgɼΎɶ3;܅B/MEM%a%j'bmwߦ9NS7ؕŹ7E\IW99nm% ]˨7*'ɭ.Eي%l/s`}[.K,X|.mZKptQy|KՔXLEQbL>AZҕu݄=?37FjE B9H6e/Ik!vڜ&}2ݓ>u^N߷*;׀VǷ&zĈ_1|W tR \ifiE 7v͍Izʜ)_ڪeU͓ZxDyD7sc]bSnrr;'iJ(Fʕg_'Ivghidr,xe32?40*ak)ݠs|_WUXt">5eᎂtO_PyEeC%Vn\˜0'e#EE]Qb3Ww~YɻhgvтS1:) L)=?̬ s.ھܚl55Qg-ϛ X1/3yr`j2n#ܾMqI.YD~#eDxэj"\mW7AŻoG*2ç)RQJޜʁ2c8ʊRU'4zY=~!1X3H&|z_ޟo*GY{{VB>"/J' GQDi(xI_#_E'*𳗞i\X/+|8h@#aS$B7Y`55s]ّ5?JaF IÍ{Ъpo_M[[gP1'JiI&rti|tDMDWj#|BAe9_2ߟL :3=3xC-&ۙW |*xVv -;"*č;vv.[[pϺг&cT2-~2 ѸX| ~6ݻ_$:>BWE u%E825 4iK 獏mH"d9v &;&@nNЗna-A;)@ Zzfo`QKVI~4 },'U=@1}gO?f&$JuI ó!G=7e>aoK4Rj?@-ъh4Z%}ΏAj^:Xs~m-y`5_^奈U_c& v섢LPEk|g/M&*FF.E_|' F[0}]BU9PHDŽֺ/sU5w~e]v\o򍈮45ZI_ 6Z l;Tm%#x_Y#LsIT~vz܅=ص15 I\qURR7czB'l9ˑ3'&Dt)܄NFzfR6{>^g1`ϟ]vI9T͍y#f+ᦎ7dq]g5yBGSlƃ(g9'M](^" +#b&U91O_4F7 X>s{oVq-ϽWVk,ɒ,ɖ-˛,ʾI}! v$&N'Np^C@Ҵ,,,$ YLIi@ B3sd9qx}̝;sΙsΜrOKƟ Ì,l}VAK#r[CIiW ZdAL2L&J@ C;4/i@-]QgӢtuD0ee!:UD9s!jvṔmTejƘ9X+Ma/L|?y<:9kTۜhr҉ĉxr<6K'߈$ Un{4}@/R!H5_`3iaFa Z~Ƨ22fi?&~oիiT9Ɨ!ۜeNog52U * 菘a@?fTZ4"'9~@IħͳU/ k LxpkTl5EΞ]rX#lv_=cMg*;f]JB,>EKr,ԓԦ[mZ*m|fSĀGfjX_6D=⇨ETNU;/OfYrFS""ŝڿ㫰gfo ם28,ÿ`˂b)uȴ8~Qw(.g>T*oR\U˴zM(hŋ"%6nwgE,Tt@=Kçg)spu7) { ;a:?)7fDWۋB9OGf3 쥅SV_3mBn4ə^#7M`Qd"{ϝZq=0;x<"s"*>`BCR5UCU#rn{ ;rzBča0BkEwuLKekV$ g~zRbf\o-TrQT"v^]]1CatKe0ɑRs1 rjcY7tMѱ.=PL8bRKF:X_5HVI.5lֈ'pn(a[I #ҋz^muVh j4VxԈJTp>ﰗzMYuvJ3Nb¿/0A?aƟsoZc?U#YYS 3d s7Nwe ~f>ws*)+3=J;[j(5F*l 蒍%uRdAaVXd{]62G*r;:bVJd閛[{nY3f{%酆rszN;t2׽΢)*pe[d֪ .0K$\)“58]-ȜfamJ27*9utꭱ&mjQ5eKz/xb3!9 4~rӵ-1^A^th?`)vH@]l^lܝ/*4JjG^$qISZZvh||< ߀tD{ZYAH~%+Ixm9[Tͫ;N #Ig +B報c ErSG`&Qw3M$yA?IX2~Xf0wH!uBQ"<~MA4A=+̱DGla,y㉲Oyp2&B77()ۅtKm/^Z ڙ(?pJ7z2)Ot/gtduSſ/C:ר߅ydmp 'MbvA&EvRn+? mSMqmZ(e Ba5metY2`+HC ]h33ǙÚGBlm{T)$d%/T$LՅ`Is> hF}*Ԟ]v*f=ѕaG$'D,EVa7#rvesuެYT4R(M6Eo̚Ιkr#ͨj֦3YIN  PAvTrG!bN_!wR quR0iJRY N%d,fP(RH†8^EhlD{:_sK\(-e:@eїj:7:)WrcPGj)êe EiQ >,KmDSDLwC 5vr Ѿ\yܮr?$SԄsiEBք")IGKJ Dkd^? dzFb8iZR3!/Nyا" G*ȈL8cE"0KUi6~|F_TSܚB⚹E8^̒iml?SeD‡SIl>[õ%5õ5yEB_gfSOq>3q>oHy&ʴU7̛/E+ƹo c3#Jgx 8E:|wsO ~ W`,[\ƺ#p;/utv.++ ̝ π?0OnzZfwk*Wyy2#`Yn0#yjOWKqAivv9ޖc?y_RH^\d)KD,]\^6Z*n#BH,@ߵ̿5;-כ 3հB`^i$$r-}H. mL[VK(2h,;K= WRatrTXŘXkәcڤ:K(# 3%NS%NǦL,끺? V *ߛ7{jɧ^ޛj-_v }^6Z:m-YtK[vw_nr\+9+v¨,mhBAÅY ,Yj҈եC55xY!o̾eGbGDr+&,i-Фe( XȈiks|UlJ[Sylh5=߭:tZ0t շtM7|pA1/p QU 9/𓻫@s8.+mrVI! r6pqUቨ*sg'mD :/Ι.dX ʽWN-s rf^$*ͲϱXw&Cqk!*^ɟ[h.YKQ^+&qEOGʟ\b`@j5e!q @k"%OaLZC+jJ2D)cJR ?\PS?;dșH5ܹ9j zǙmjԕnp+=mڪenwPxAٍO?3oړ֞$ږohkEvkv [yE5!6X |ml徾W6wVd-Xۀ)`kG24ڹynT bk^فȾÆ!g2B~OтE,Cc a>ӫ2 E v./N 7S6$-)>R;9^0N02Diy^ Pt^7OlX8̙X[zNH)ElfLۭYZɯY-aj]ke=4zl4*Mm.wϚ% ,/}+CQ=3avX`!zSHF8[ʞJJ)y<`eR/}.= ϲq3Tg`ci* p-=rA~*'V\1չ;˲7޷j!Pt5s ,.aZVf8zBȞau*i ZΨ^ycUQ%S[+f5K ?}}i:XtX!`r;\rېty[WVy5yM?l_[ˊTie %mZ]rݫ|݋2+[\}"8^Krx((|!]\tk/l-ʰ``jNg]n`%2YEiY(4!0`qe G#2:u*io]$TFyJ\Jw bY(!+5qR8x/M26W|5>NJ*hECbCdO R\yu7<ђUylLȉj ys|41_[{c`ϗd[7hKƀJ {JP%-<:3Jvpl2b1F?I<@J6T \fM5kѴ U*g~m7ul=N[質˯Tl*dD2u[رjo麇}ct4t /8{^I?- %UR"KAvi(%a(Qx&)]GNȝ ;Pms?!O 2/p 9WnQ&lWnWzOST<OaW)5k*Rzwu+lג/m*JA:PnFn{UT+u?a6mlѓvv[\kzBhLJVj׻fi((rHE21#Lo[Y3fn1eLkݑ]5=Cg6uyO/ft5Ϡ *CʲaD ۨFg}s[Oǃ>\@aV\]VS4-@l*vgi<_fMJ3Swk*eOi9gz32% 5j,i:FĪ5f_5R V$a+8bQϭQOU}u(Egfwqd3%5qIS>Yzђ ,&WmYe=tU遺YkN7H)>gfrVNÂH.SA9 gx%jV +ҪY曳g4v)˼{m)bCOqwt^{w ]k5{o5{ͬ5{2j΂ VX]^}nɼAWZ1j@B@4*r ycFTJw*~ <+o`9ll֤S^3s<&JE*|^NJ:{vBJR: +VەUjUbh5i5fb(|4&A˞A`9O _rľ^DݵNىh2n5m/x'؎7iu=59 ER/ԔOɪT:#uBP +{^/\\ȕrJL4b1h> IVwY6@ CSO!EChfeT^l߆!:]thݝ ^`^Sψ'.lFk8JUR'.TSYeawv봚Γ9tr6]/ oȤ欈Cf- .vGjcx2%JyFf%&( 7H/ɇ:ӄv3_byN:_bG/"A>uy;?3:Sq}kB;Ȋ!ɨB'"1P#xt! )*0MySF#WZ4Q*@].{MR(_Z.LR8~)F8z6"$4 E$\bE8N=C\3 I&|ø̪>L!aU<c\ S a|x'̋D} .1s@"fոl+ sjMCĪeRit&]n+-]:tiMDƬij̺nOx1FN2ʧv(Ѫ"d~A=MkH=|ry$wY7yԝ?cLgW$@nryV0&]~avuBRLbEz)#KvA~hgn̻LO4|^'3cez*|9Ӏ|B|BH[ZaUWXhyєP~7?P>_CZH菓b\Hpwwr1iIo%'Q*b~ eڃzmY-$C&AV1D>F2}L:3Sl;="Ց{򸗋$'CB9{pZ"A?45e:~EEJNe^n-Z5k>Q;STx, ƃ g'8ҙRQzT65Jh0S>m(ig1I/^uWaQ!rZby*hٴg].GM~~ gc)_M<9ȅ*CԙNlRTH;:`v 8* A* ohpO&dS5cii؇kSzfp:rw9rvh9ӣrTsj3OrEygQmƢ_0"Ljڛ<_8m}U& %bbr'j ύ_r7^VѻޙܡJKSQbB#iW :5^zDr3'aƎi^=mevTeprs+ɐ7J*Low!dliNYpvZsx+ y&u\ oHs_/@4?Pi4**+xKN(cR 3*R #L$B2 Pz{]#\rP~ YSiL-Ӏy"8o^y O'Y&6 byCb:<~LyB$7AC,aT4ZQo{GK@R-q~?T0%.1Q?3r]9b:薚~ 4꧇̪,CA:[2$6T>:$d|"! {2e,yFWEuL$*6(O_kX {XPTfqQ8ɥtjCJ*#D4Z:!s1 l: `r^zT8NFncj X{W> /cAo,=Z}K;=SVw{^A iœB`z LFT"~TnYj[*LfOd/_+]$|AwIxqwI$$v |-,w}-ܒ'aR7]%@9@П1*3$O##,hR8=0)@~> 8o5 p.)%qA{|orD(\GJBME `5OYp}?"A#"rԱ(w  :WzB/{BCk^h b ]|g C>/z&0:WF׻  `?Ȥ88HpY܂z B"A>DJ|, j1\GJWͩoCU@; <|, kT Ѩh=TCj@DuNSGԑ:uNnK{9Ho`u-prASGEp ;HArj.쀻(`LJcCZ_kZ8j:W5!M UWo0&`u|>`K =p]|&eEһ >DG>?x$~7jb"pWuQu$xm| p7nvb(Av(Io!xGǀwnn<?W+wNm{c?a\GJzÀ(`{iuS[@=@[VTnQH@ PEp g\C(1/&ŤbR_LI}"UW*R_~xOc$=RXL(Ck$8B,k1R$v~XL:;gVAR>cAVw{i'@ vi'@ vi'@ vꠝ렝?f:h{`*"UD W"2\Ed|y`1j 5`{;'xH tjmG^W/髗K%}zI_-R Bo![HEEEEEEEtcэ]dLw <`uO- c>dcv(8@p!x6H~?@`1+'.l <`z3@ YɜqZ P/x3Ky8ʡ& P'mq!N $-b>`h_ C} Xq}m87v!a5̐WIr y2Fdi@iBHii1¬ ri)r2|ZFM%G˘s|Eق|ZA+J&V |Bb|FO3(ibR>-O Ũ\˧%H/OKZO˨d_riiU+J J ̥99siN\3̥99siN\3̥99siN\3̥99siNΏ '*@! 5Fԅ!iG-584HuRQLAmN֣ G8 fpԜǵAuP 5ZIm5! e>V PZꁾp^hʛ!i`fη56}Nౝ{&!@ ʛ]P{rH˛HIidĕ'zuTnMWMgO  '9qO 'IS 6@=$9I'3'}3W;:RsTq!$:>&6"^~SG㿙Џƥhr=vBIn8u!oFhKr4@ |%(i 7'tVh5~C `A&_Z{MD;1M㒐ddm͜lDjF#9gA&,rl;i8J HlbAɸ#&5-vldNM/ua{ zDc8HZt3m\[c빐oR?G kúdOQ/_F'bBS$9xA=] M͛6b^0]ށA[,gSsVW{{φ[7% Bm:6lkiiW~# AxƢkSkOOss6B֌S`oH5rcuCk㆔caۺ 5vwAXj]Pj5o :}o!f9779QyRHu0@=]${ ho^@yutaojߺ!STDoOGo}Kkc3.g,H554;5Ѝh5 *G*$Jk_|,KAZw \vYU*R˭V˭[?- Q"\F '>_A^X`A^*V_F5AThfWZx0RbEx}x} x}xxQh9j^kZ ^x^w&*,I|x-^ 5Fuzz78zx}x}x}h|U^Zux^ x}x}x} x}x}xB˨.EAC^kzzz/ x=~ȫ0W3^KיR x^^^Я׿ kx.^77w?^?^_^^ 6RK׹2u ^w_^Gw׿_212c3CfD^[RxIu~x8zx^u-Qk:xov?^g׏eUQut. l =x] O'M}1FH0ZLY1]f6xm^;w?ȫ*-t x]n^^'? x^m~Iux%qSfJM( ] +׍1kߩ] MfҨA&Qj3x] ~x}x^xxJ"K&S嚖FFoD$s#'! 0'O GIaGDHDvlO^z7xՓ\'ɯ_&F2%hst ڒJR*2dW c}{;p!32222$ oP0H$3fPJ=P3AM T"wx$D?V$KmiTJ#) vqš Edh?a:RA"Y@ԳbA\,( #I 6 G #BcöWD#iDC C޽{9vF9tk2fd2%AFq`8K:ikk}HFH#Z߉3##$.G*Eqs)%_D:GJ&MGsDS*~>f\G"IؓVQ*BR1H%E!e~hopT "F&TXD} !lCV'IrB$>>ileDR0a`c`+,Q &SQiS>.eAGϓ KVgAEH&8 j<&"A86 QR_*R{pDEOa%ʪ_;~w2B4v}##c##'BJPsR9%UgUKƏ߼k\Eqk`%+kiAɂ$DyR\fIhYAZ |#L&!",F",#,+S66tBbcლDH&nkC,%$XH Av%{_,'dB$&ջjDa'9") x/+{?Z>2L:J1u(ǒ (1$-":m 4BxA|V,Gb W _=??@: ID@MhV{J <+_d#;xJu_.$/!EvO-dNeσqBHh#Xr Va.h ,v5|8r[Tہ|k$O)_;f?z.vƆCcvD<}i* ϊY$vLKͼa}9ۘvh b!g?G0doaH6nLω .R$%0> ؀\Be΃ c('l8k_,&A &Vg`kcFdW8xx܄) mܙWO^=\u6r627FbW}=e:e"܋)&'Qr0iS(%= BW 8nv FgQ= }6lzr I.4 `X$W7bki#Y$2q10o#]iϳbM1bO#{6c$ ]׀֥4.QD8+[""KSl)KXJq*m&H"z.L$Gϝbz& 6Ʌ̼aK%\5sA.i9V8Gsv SbBb"0Ybar"499OLx}8Qp)iwz<4HQ"Æ5aeY}S:w mxSmvB\)*:ԫ~p?DI j8Xc8 Xh;{YӁI!JŇХ8[Vjp1PH+$ ;&I< X,:uFu9XkzAz8YP gxo~/vDˑw|'ٿ yx|;XR-Ł2x.[5W(?8?ICU+HB RLЄa)KIU!-rP *ʒL6p0a583؝b#Mw*~ub,H.߻ަ{ALz\z:% ?DŽ K 9@zHOR8㤀 sx!0F(_0 GL㶮6[ռok #dGHxT'!HgH|BF&>+erNJh_,Ȁ9uugтyNZ q%Wnjs < !R =Js"PkPh@G ~~6w O>Gp cJ@`5J&Eɦ6R ' ~7~w (y09!V cJ ZD݉~ѯ';DtW% ʸͧeBL̋NK:1φ&wMg\ߵob>$)[RU=2?~p̵ ]v2?d~N z?F!f-5PnS AOc`立)W?WTO(isN7}Ko;<4 |%PPD A'ԃgѹ-}uo\g̓]?aنvãm mmގ:QgUg}U=v|Ώ:ut]]E]S>Vw{;>}gIρӽ_l miҷeϖZ.zoC-}Owvlmm^>s۷_j3WMsGO8{kkة۹jOw;`%־ =D38`8p7Bh)O>(&zߙ:gT.ȧFoLy5sީzPR{jnS֌Wcw{QNJ৫'jٔ?HHI}^>G& 4y 懪a|Ny _8ZY;xw<q>ڊL(x9\\|3P^g#/S$>6է^Oy}A ߉}:B~._Df2YU1 ?$fA}8}p%d.OkPS $Gg9D Cad'3h|)a%x_ptJkM , -7!q"l9qcbEFxR;h~BkHεV8}LsKf79_25, 72^6$gK/d6l e…!qI \,?tn\O'g(P\Y8!ЏK*> Uϕḇۇ)qd. $"h MU$&q(OQ2nS'ZNc#.q\B8o1pVO`l~j(ñDHY$Y{"~v8"#Mb3\x|V X ?P謭-xmqNË3U |/q9$23KHe!LS0K! ? 7rX3t"UTZJm#SMNmDv!L*ޛ4MİDAť8:":3RqJQ6AeTB@v+$JCJ IkӤMSiw~.sޚϻPBa:DžƱ^ʱ^uY׋r!RlN|ޗG|ޗkepޜ5T^}x/u|^VU1W=.2Uɠ#_G[.4^u3hrg5L^qhEw1g7< O3!  w.`2L"]̄eakx"&+lwp mT[ c8u*N=ܮU_kpJ != $md^&۫fjv..Dt/c;V'`< dHFG}BFq\qLxg t@#|X*ۑ˶bP A#!!E+R|1eюE"zmCDHvFxVX\g>m>C,R+¥J ,QaqکYqr{ ~gXpS,ZwHU\\r2 *[2•J OO,zՑk|5m#euFs!\g׹6ZZmKFzm^6#3щes7ri0mj%3uz~3crՌo 1ʷԓo_*2*fK2̂0^W5%nBP -028 P!18u򠨗GE ,'M ?/XجVGZ26S&2( Tf ~jB `@C9V9͎0nGwF}p)Lx糧>yLl޿v2g~pc;x a,%\]^c^>r#>r#q9𑣌1rG*y#TcKjd#q]˵ ;GG·`<1WTP\Yzzyw+&Au8K؛"3@d 2Df "3чf"Hk&Қf"(1I"&I$$?1q!y 5&@Q jDM 5&@dO&d/b%ZVO%TF՛Q՛Q՛Q5QMhE@$*P1kS{ߦ.UDwuhRm,}#û+ywN6:N>ꤏ:N>ꤏ:NS_je'je'aaal9m`60g S/s9[ʜ-eΖ2g7^ћyZ<2OkQAqZh7ꨏv>jv>jv>jX\,e.23sss85G}Q|5s棶ubR|a0?L@7P?/_J&Rj><5L֘Qmd{]d|>l5|J:f G8*H+.sK9;ܾΑk8r2GscuYf䬳ts?1r-W2+J۸Q[yGXxix+Bqkk0 dJ(ϭ7+z>ztmՏ쫦3SͧpF{:tsX1:6>qzՃQYoF֛fdYoF֛fdYoFFqg;Rq3}Lg8Ǚ>q338sgfp L/gz9˙^r3L/gz[z٣܇F2LN }P;.[P-1c㦏޲΅| p\ p K2+? pk`\ {Íp C m,- +a!އ5|kaGgX')|(QV Co`+lʀm'. Ӭ2oGbmv a`{e~,de>r wdT_#CX `y]$z1ӷIY8C;B78zYzЋq&os9<2x d{w*©vNH<^hA[8|C :C`NdNgA gC/ƔAp \Iw a${#|(=a La Li;9Pky +Rl<[SNHi')gCm ѢvNHȈ4h A{!:a]e ,=l@orM8΃/\Ep1d%.r0U;3] {Íp C mpw]p7܃}` 24/ /0 f|d[obXo3 xޅ ރՐ>@5GgX')|\^V[ v ~1H,#ҳORdٝ52FxO#id<42FxO[/k>al&ȃ|+|a |  lmGx5?^ie4{;h#45YNż^*#2,3l3Ƭ3f1dicYWgdɾM|Wg:'/1l7ᅢ=P$z1f;(Ȕ1{ƪNpn58r zH@$QV9d m4( :C8C] ρ.f_Kr cTDS 젃.H7x Np:C :C`NdNgA gyyOF "2żΐ12qُחp?p8o9=grc0+]'}9}TssLs.fk-`9|>|rٗmM)BV؄+IFc)T&t14gwk/5|Π՗m9&gXߠ=!ʍ^u͔?0?;_H~p(WQPnە!0Tq E"&F,^φ9 0|XobXKaa V{rd} &a` ƟP O(ױ#*ȣ3Ygrv]2?Ck qY2m lK`[ؖ%-m lK`[ؖ%-m lK`[ؖ%-m lK`[ؖHYMPnyryˏ2.bwrWF0GA\l\lBl/Bl/Bl/tMlxK2q2BUȸ W!*d\P Yx @k" "`3rFRx.2]9+gt匮ѕ3rt4}>E")B/hb)aaa(bEq1"Q8Gse4Jm};a1a,%7䌩r{2L)0txfLx ^rc*1ܘJnL%7SɍTrc*1J^L%/SɋTb*y1-\JγY~cO0KRtKETkLRn)s[================͜5LB YEDq>oIIc/؁f7qP%2+s2+s2+s2+s2+s2+s2+s2+s2+s2+s2+s2+s2+s2+s2+s2+s2G\%f٣,xeT`XKŒ.Xr.ŒO|w{ƪlƪlƪlƪlƪlƪlƪlƪlƪlƪlƪlƪlƪlƪlƪlƪlfX+6XX#R{ aS;S=S=S(te>"UL~'2)lQFe"{E2Ţ΀ ΄px0')xgahtthhhhS@ ~W50z=F Fa< hXx< 0&@<!&ɝB#rb*V)e34SH4B/$~I%T'1TN(fQabT&FQab@'P? O~@'P? O~@'P? O~|3Pn5GQx Fx0i@Mnu@&P7 D#Dx*S‡]چx иHshV&1S')9UD~-_Ut?qe.s`T0*̥B|TJn|Gn||T Q>*G|T Q>*G|T Q>*G0> 0> 0> 0> 3Cj!̐ZfH-3R e2Cj!̐ZfH-3R ex7>ލwx7>ލw|\Kq >.%|\Kq >.%|\Kq >.%DƃQ<Ń x9xs;Mx/ʫ{Oϓ` 5xz/VJŋQŋQŋQŋQŋQŋQŋQŋQŋQŋQŋQŋQŋQŋQŋQK^2𒁗 d%/xK^2𒁗 d%/xKQKQKQKQKx/UJT*R%^Kx/UJT*R%^Kx/UJT*R/%RҚ3/x/$0M[[[IMnuD$&Q7IMnuD$&Q7IMnuD$&Q7IԩGzԩGzԩGzԩGzq.D>F=w)bkV0z^/|L61㚘qM̸&f\3Čkb5uZ7uZ7uZ7uZ7uZ7uZ7uZ7uZ7uZ7uZ7uZ7ux кG"̂ ,X:Ɇ xe 2Q?G(e 2Q?G(e 2Q?G(e(E( FQ0Q`a6D fCa6D fCa6D fCa6D fCb6PPPPPPPPPPP+=*.;q%>o2(xG1 (6F1Qlbcf,L,x7lbc7 2[s'ɩ5Gݳg/5zyV\'vy`4Y}v:#Dwq;NtQ>1| c(CP>1| c(CP>1| c(CP>Fʼn8'D_}q/gL3ux:cE A#zhG<>Yi =?Fzqyf*ڳj:[U=Q P5!TATCՃz5cE(JFUQ T4P@8 E(xA``dlDh ݬ @PrōD~%J4''TRSrǽy_WzL0M̹0@̹0 p?%|N &d9%\]PM-%_ 8ozQn=ml=RB|vQ(3as緹 l70v۴5Syj0os'/wǓUuxm^[GNS/ z%0@^s#kx=HNcf=J>52{:BtUr{O4fI3d3$(@L J&0+h~<_ľŰKaYwؾ+Wjȑߗ+b9uυrj-\G/ ?wo/8nP_ylf6#;.طPĵ~(R>~`!qò;`1&a ݕP%Kġ8tGtǡ 쮃$'׿1& =ĝGckgp>b% m*| tz9&:Aggpl7>?sG%L'+I!#|E&?,3;Yz`~Ɍ=Ƭ_Kxq\r-q8_KL'!I SSBjz%.k0vX;F#V:F\[O:ɓZCIJ|%>11**xB,qb6y1Q5Qu?1Qe b$9A-%˖kEd|2k>5K6GI<@FAF܁qTv edddddRX)Yl'Y,,OIGGG*%;JNd|S>)촏TJV*%+哕FddxRLf)KExrr rlQL03C1Pxj?YOSxlg2K|f{)ݜbfy1up%SMRfYɌZČZČ?0kaDk \|ˌH0 "_0N9O勈ED"|C'rS^D/"+rFEZňFɍ}͍֠Ds#A5K&EDn#6ƭe" >]=coA +Ų#XvX<]Xљ]n3]*Έ#:ˆ083#(ƝuI5B]/^ VjU̘)nͬJhQ]Ѣ;sR\ʝKѢsz^K{1wXrg;eqq&:G%[OFo,U7<,p8#`IKrS7? 0"X?$$If@aDf@oV8 O4G.!#DshXdλ:;D&F2z 6De E5r1r1rkȋ5c\7+56&[͵8.hRQ=Z2/WO5TjƻՌ!1ld F<]7t}UߓؾZߙD сUֹC9sS9?θW9(g匡{Wsjm=}qC*>=\sǝbVwY?fk:gȏ?̋fqfgosF%#8l}۠[;;{[Oh`A܊ZŒ'*mAdFH> ~[?mvÏP ~lcNR1L0<$9_</d}q CǜD4g-m}\8·p\Ő@?. Wjp\`070np+EWײV پ ÷ a۴w|m%=^Vgo#>Ylott(QZ9_XF0A~gd^$IY%9΁2#~9ϱrGJ~|}Rs*ةi_N귓L7x @MwRӝtp#yil?`!4r&$qA{@oy0np+p'p%?"r?"r?"r_Y#L,x&$h^O4'W_{^f6|Xo1bxV*d?(vf=Gay ԲuS!Ά^::~l/c;`#!ʏWWtձZ|F,zބ0a-]=P`?( Tȍ䄍䄍bG$ bW!Ol!Ol!Ol!Ol!Ol*eV?B5D5P>TԸ55絀[os\w0sq7#8>_nq<0 @#9ȁF̧-m>@FFFFZ1s؁MlbmamtnэA8!\jA3bˉrb|91_I$W+EhK$g3YR"*b<.ƣxt3݌G7xtIWչxu.^Wx"\,*^ 7Mr2r2F<cllqHYLN Ob(DWBnQ譆:Pd[-xUYLl 0T9Z333hsD\rrw䘙jі2,*[z[8z@9S?pKN_r9c9c9c9c9c9c%cN,铀X:Ų޾̴̴̴3go-aoe0Z*P3'9b̠scg}wߣw ],_tM捋yb޸7.捋yz<zބX -X+mxǵV{rDzc 0TE3%xflsȧ7MX`1,Ltt'RD4t{SLZO>htt!:@׃׃N B' D"t:@N B'%Ǔ%Ǔ%NjXi18'`HOAz =}>HOAz =}>HOAz =}>HOAz =}>HOAzvnnxKD~*JD~*JD~*JD~*JD~*JD~*JD~y%Zb k-%c-Z"DkMCY$t~?'_ζHeu|ɺ7Oa ;tM5}F״i tKf-XYYYYYYYYYYYYYYYYYt]~.?]Out]~.?]Out]~gcy0k?Q0<¾G>a <)#th~:4?9sPnq:h!)ؖrKi'\du^&Gٍreԕ ït^Kyt|^:>/Kyt|^:>/Kyt|^:>/Ky;>t|\y~1– QbrV-{a5O橛(\c3^WүVVLnbnKȕ6y_D۹ >IIY%Ue0wURҥ~Ͷ@Vp];7ǭWpww݋SsDcb%gŲP= Gnƶ#3~^ѳ9Gr-13f%JTP*h2N]*'(Ua1@i`=P~Y\;SQZ^ތEeT٭պ&uaVaAAhrpB 7x @`#fK2̂0^W5+'74pB <p:KlF.KlF;lF;l[/8nŶ;N`nۘ۶04/ /0 f|Yh[obX" \ w9үg6;J8Kcg>>(}O-!DKԲNmn ?lRj eKT|ҧ9ZBXKiYZZj&-S58n\M,x&B6L S`*jFojFojFojFoj"MW 6  `( cokt_.slOp.\ \5Y/N}^c=:أ̾O3Mσ|+0vx^AYgؑ^hAGYHN@?i9 LޅUr#m|}z=e=YTYO;hLO7kjD[DOk }Sԭ/k]_ bmU tb申B_b}m>C]3S{~gSz5{k 3Xg`zXcͣGQu kYnc>^GLƧ mmE >qvϥ=ਓOj>|R:jbG]y OE'v8W/FDgq xYlxN rY3 fGlo+ᓬᓬ}lU9?gW317#τ'ͺ^/b>:Hoj}˹+b9WrE+߾٭ц:Gqg,`|rɱ$934sB1B\.q8!z&hы+gZ?2$Q3> V2p,U}O.&җ0czШ3nA朏UH1qmeo+.w~˱rG#ξ$cKadIFԗV_w3Ҷ0-(hD88kP'SW,XM= drdNF{ZUr|L8ŞZ:F}y_I hh}J]Jt{jdD O8x&@Mk8C\9>EUIKe#n.ڻ3SdWelK9gV0vs}riZWf $g0>`|3tLL)\_MCJk}qFTF\uk9#6k4ԩ>!brbr*}J7F@1'7O8x9[}dƌ5f얯VDַ{MQG3n#3ձ-?8kqr!wNLrfV#jtE\#hJm9Ʋ=yUZ1[>yvg7sv5c91hGjyP9"s\E:W+jI-*R)G'fl)犦h^:c#MQ'bezf?'Z?ֱ_8_CA]?,4pjjG:AggnUgg'gs|z&۳M 4X3h8a]+;{ZGunѺkuY]D[eӨ֞=]ׅn?ϻY1gi\%XM Z:w$֫gGi]g=vц18Ʋ#QQ Oj,;{߼7Vpv|^jL[8k =}]9cczq9d:O^K׎fciki{O1CK={Yi3F..݄ߍ ,'8?#\{qnq4VJ{ӢLˏ,q=M#%hdզd-[>W--d6e/H#]l&uR[<-d5`K)tBx-;Q֩%̨z*֕qܙד^wQJ+B[Gە"ޞn/KFy[x ۇ8C膆_8juԯqiũwz< !ŹqX+mc5q+։'E̻w% dؼ϶ζ"`j+n emEm"ni)lFzX8h`[*looW f{ϴu}mk\d.Q).S+m)W()ۮRnPn]ܨ ] UڮWP^WfQO6DݢR UUݦVnWQl*Y9ǕybSRem|j|lVUJP*JK%:rBimU*l;TEUm;URj[>էl%j{-vWϲT϶s>#j_[zzza;S/EۏUlQ[LVWWժClz:̖PGNc'3s]}A}AIUSX]xzūnP7(m//MVW*gjrTrfҔO^JJf)ih'hm_;UjRdw]>V*b{)!{B)a^iR٫J^gS{Rc?a?ڛ͊aE+uCOS6zUTMwUzwի___V{?/Uu>O>/P1}R_>Wx d}:SߡPgz:G/KA=.Կ׿W#=. gmp(ZqqZqZ1XqV1ݎ{PÎj!(5:wLT $U:9keǫXo9;V8Vh8::V;rN\GűQusi ܽ^^ڃs8/qss^쯍vt^=y-S[iO;rޣ=e9r>=|ss699Y|Q圣t|M眧q|C{Źع\{Cm3י\\-t9Eg'mi L[hGC[?)ޔ6;)VkS:trRtָr>pe2]\O\Fkw=}z5Nz+˕}䚤k5kNU:E]]ǵDj']SH]e-{SByps?fOw?;ϸw{==I?%힫wuwv^r/vss?/uޠ;_+&fw{>{~>p߻kQzOxwg}#ţQ/tzzyz=S=S鞗==yx?,,s=7)iiiiпKkLk %E*HkWq&#J}f9WߤȻaȫrrG[MO#r߼rv?.dNCPyU?>yHV[.kt++WȨ,2_T? :Xs䭟6uR?tƬ6=W%k{RV S$ D?;rikt9WGN}^[+f>̽ v7bmࣨ;3dB!cSĀH)R!}c߲mbJRRRDH)E!bJ)"E#"= D[ysΝ;wgﹳs5w~5haQK 'q#Wbs7Qo}A^OOA{?5;m$:.ZY*m߸F߾쯙[] tFܱ7&7S?rY]^u=~g!(;~Хm?OI;;}!GcE/&}2r_ßK\g_U1 y@]jx6D~= S[M<ün<Н=#J:_|F/_{M\O'\I(ޗÛ[u?3;T'2JvÛyk=ǢuBl\] sΈl _넭a [^d9w.KDP(d1{+E+mb?#R<&BOoV˽aV/I f DZ*ɪ'BUj[ިÏ _i55[zY.S:G Ka:>?7a?b'ZľSJH%(܋%%$p/JH^Л{QB.ZV#LjZEh;kӴ]݄bm6M0hӵY[{`+897<'/E?E@\Y|{%AI6)k5«{Ya;>񅃜 _896Qq/_s|,g 8>]ʼn*]W]7Qҝӝc`7od7"f!l1ͯ If+jeê$* VŰa[d[P`qhM{)v{ >}29s%ba..Ud ٥ T:aodl l&KAJڍ,+Yjw.bX .*{MZyv'‚'UOaDžO5g5f_LTP$IHz?UNXK}}}}}}~$8G`$h0F!!G3Y~X~i1!!cq'14N0N&x-:YzJ~ u~./D"yJ02Y,̥8?'?vV+Pyy?uX'oyA~ ,o5g/_۝kheؤ kߒﰛ{&8)K|WC -$35??Vɟ'yTNnrJ3Hu*gQ[OYwUiEϔss^9_(XrQ n G.huZ/DW,:J|<,낒d֝#KBOCXR|F|Z|ި<;:~)&~z6Y\ ߲! KR"|$U;.BW>aȷlKl3!6T>M`AMH2a/+a_ a_2a_7¾¾}qB'SI$h%s}2Q d,KȨ%d'4"ؙ0QR:*5 "e IIq'^^jj ʧ#`!`H5#Lka2P!Nxוb|1 D{cLCXM~D~%TACMb] bź 1"tԜ!π6hh2!ZL\ %n L-d Z, ɳ&b\SyJ8ɄnqQtk0N&N覒 \SEqm gg$/&G:!]H"t&[W t;<ǵ$µk1kɄkR׺ɟȟ(n] ݺuP,N+hQ/ϴee,6 [[Z%$~D”.ʇ@N aG`gȟS>g:Ed x/dOxљ "y⻡Lj.={&`D"0Zљ0aDaDg`į3C@΄"oW3\dx͟ps|M{vZm##me{/ Ydk[? ?^BoUXx/:59}y5;~_[.ݽ5]s u⵩쪵'6ړgĆP+~] Fl?}{QK>a'm^| u^~}!k 6i)DIsg#W$I۬oqs+v|޷ZU.u#oy}l"׶U׮3BxGx)#+oD(?hu]GQ;EO>"k#`7._~q|kV@7R^"Ov^ wt|yz}߿óÅW^:,l D3WP `s5Nö́48k}qe<|k[|Foa{vk3,q̬_q6^е!<Na7GWI+mqpsV,o) >% #|>2ˣU}t+5O'JO'}؊}?! ?yRxq6@F\>> c>Si%dm_+=/οy}Y/#Oۣȹ0 7_XAddtD<NJ!OlUw@?%Eq!, 8?h{ (>EL@'=OF;?ˡ|ˊ/T~?~BVd;2Gosɏcs+t\C>WssMz]Kc'O? ~^u^pMx^CcFWs:|?n,Kc? kot%x`xOߐzYak}sol/BGgm1kf ^ e:zc6}Xӆ_h忺e1g}nt?5@6Wba/'8Cg˝Om<›gHgkffxZCk_ᶱ{QF78Am~/kѵoq~O9Q;,=Sk7X 77 }b\W۵wgFF#6{y7*j׭w :wp=-zYx] 3]֟_j-*+#C o^:ǭ)Gkߛߡ?SGMo89o/J҉ouQD;=Am7P>M+_yԡDj3,tkv|'m[Yl\﯒nÁpatҘy<_\xC|EHYU8Nߌ'6|%hx;D-sxыaGt]gZ4X#]p'L]f~GtgqEo;4)w(~(BWVL1|Sb & OI0M[ sZSm1؟yL!b/ W~bW}<{CW1؛Ň[S,eDgq+eٿŗė؇q+;#>__c#e->Y;'U*W%).@U*K).bũ HG(P"Eꢚz\HRMQMB #X=B_$G(y<>$h: M`Qz;#xxGyGxV G~# yda)#<#)KGlt_X:BKG\c鈿q #.պ.YQG\#: llڹڹ*ϴ:lTh6fFբuZէ:ES]%TaF->}tbDU Hԉ%0skg )7݌l$ncZ#a:)n@ 8HqO)l:()Eua~$`+& Mt,.$S$Ga (M >n}@zl݄'wAZ 93'~a%K{;wȯ+.v g=@޻ yE o>ᯎW$&!CO;.W4y,C\ DE܋& 藁= {.z/&>F$I VX*H}3!-@v;URٽj-9[qƱG a={p80z~zn[w?Ow0z&xSՋXg/K3gYWrY7Z ,"kc99:Ak:k:|&`w`&8T75o45Y-[Lii0CFۚQrDsɚw40(gg99:i>|0 Ӛq3XgYY֕(8קOYU| :9|h|/J",$5+4 d,NbY'1H Kxvtu\&I]qlS,AJzt)zAgJh,ԿYA[[YW)WEmmL-0E]~hu<{t'"utJ9HKCFOz5GH#,=(=>?"=5Nz ?!Ӥ"eG;i&$Y$;,9$<+7$`IRTޖK.URTKh!$BTkZ쭓>f֝vORu 4.ƾ+WlDZLZ#>fq< )?HPzOػQڈc_^D&i3jYڂH۰Ui;s?_^Cn.uH>izzu@z<(d[[NIjQ D:ޑAI[7,}:R+gg9>Nˉr]N<9ENcw= l6PΑoe\6vG;r?Z/G<9u|9r2H(Gg ;8kkkkkkkka)@TZka9ka8kA}ZqkѣAk`wY֡-A0 r0 jhZ[|HB9 z6?Q48B~::vuX14FX7xPcLBL$$~1]cy"<&-=#XP.p6,v6O O>?} W(Pڏv"ss!">څ2D"(.2$R\ۇ%<0K7m?[M`L\\9%M0^롇mpwwy܇\#y,"SP<< %~,6#cCd_"ŋb8*A%"ϣEd4* J8?J8qEĀ ~b$}e)q'v+w)e'+M&{?{Ol5NʗQs459gjGe}!q$]&M!"͕悹T)'9ePZr/S_JK0br0b݉YVJٽkQ9#&I 8s|┏Sn±/Yv'f9 /W鯨7oϙewbY"fy_ڏ8B2 F2Uz[z{9l㔧(r1ˁ,.JYq┃)!=&Ƚٽ)#N#CA!#b.%0bMoEx+Ph:ĎEV4oE#<ꊆ(ueE]I+)J7ҍh(ꊆh(BQW:D]Q(ꊖ(uE]Ph:D]Ph(JE]FQW4uE+:D]P+uECQWb)BQW4uet+P E]Q(ꊆh(BQW4ue8E]AQW(H2so>~v5> ﵿG?hAs^m-pa !a1-'a`LlL, b:tF}EG^P"$$K /{LFL^x։lD˖CVAB6@6CAvB@C G ! g!L -"aHR Ʀ-DIB2 ِ>sO˃ QѶB&@&C:l=o 2ؾCIȯk/FȖh~d{4+*{rrrrr:ZiӖBx_ r zcERG%e[99]X%@!iLHoC ۡmGDlo~mGCA&B@!K[~Om9$a׾g%D ݊CAV^ߖe[wњH?_mWzȦv}t|\q[!;"h7d_Aau6GiZG6>uI!ЩQَUKQ8&TgM5Wٮ/TKVn:W[_uZ-I()N暗T[ ҮQtʆQ5>ŲKBfWCg@ǖ' eCBɞXuhfrYaաH>{Jp̴2=i2'tNoY%t~YMp?Ha==80Ş7lв#ę˖@+[^0/8eIJUג=l3tq6hsNhGhO~TٙeMJan3X<3Tv$X\> h溾p}p18SA/)aAO0`eg`9/oz}L04sYr-r$M[3wg7hg.Ӡ+cl B>x'ϔOn)/>_n .rTV؆B\Vh;+-vB:.և+WXnl/ %G[/mW6|9E%+IiχJC7lWzA%Qs쫞_XiTXc_Z Io*9V/,c_Q8<_d`|-E;Jΐn"<>'>蔠;-% s&Bt@qC8 7z:sV//\e<<]r#=Ua+ΑЉ1)ܾzt$d9 o CsZ 7wON`Ya`3xp}sG:+JW[;?xp }ispeP^m$ꝑ|`BBKڵ޹\t97@W:7C8U>ǹz?9RWUsqjiD!mqFiJul[KHWܧtn081K(x`"m(xHҪ-KW@*]Pⱥ-{J7B:O(¯IvhœKwA 3NCep`>G>a#,#7B)rEFiהPU rFQ+>2/.<}U A'B3]Bft-ZZ=keh݌|ך( wMvZ}P׎Cdۧ5v5c`hq8D9ubЁf3jsfsOB;݅ܖP󌓜a8vhqBq] >+tk" |V24ҙsYfhSEWm'VҧקD5k>_I·g&=Y&R~ b}?`ų g$&z`b;6k>Ll'gmWO35sܭ|pKܗY[I/􈡁{%ݬ垤YPTԯdk=ٳ7x: o uL3dIuF3jV~g,P[0g2EPc<EIԷz5) Ly[ C5Q]SCzN/OxNyjV^kX܍FOVp6bXmcXl 58l3l+ vQB-މ/OzawJaɰkPk<}<Ȍ֠kyCYᨷNxA% "|Yҭ/yVyٻs7fY 0Sc.zWV'5ՉEgaǽS5M"J1ֻZ2&xwT+dnBi})gQ_lKeysXKMf˜ ,+U, +byYR ޻"aeUEfCemENѲoͲ"-l(hpYvV mXT-+F7-M,G*&b<^1aTEq0r,rӰZ>U(oXjVZа"íy@'U,nXmMXְΚQa5bMk ۭyvYVlm@gN+OaR@˳= <>p!Kc Gc+N,*4lY@5'WUo8̇*ZΕVGXm+'VX]mg*\xLU[9ѕ*G 4.*G+*ǣՕk* .Z7Vg#uKevu{sv9*}YN#i[Ygp=kc/?l:ˀJ~TCG+F#H|ivە:{")W'*.zrycm\>l\ڈ:;CWVnXMs3y6u嶈_9{-rgp-r4Q\?c\I9|HU6s8{-Dxr*Ͷ+ςl'2{魅fTAmh66J\c]7fz7xsQzOH| czq|r|v-fG>ЉSk}YSᵑOEž~Cf߀Fop(~\,߰ڱr >xpߘ"K0Ӹ~θ笝k6*kwjjw@ͯ]a[X:AߒڍˡVA XZx̷vos.߶ڽ=851&\lR|GjO}ǃjSTbp6}"3itzPan3Zb])˯K6uuiS7Mu<`v]iO(hϫkXoRW`^7 F@m'ԍ3Y&)&XWl̦ayLrB]]ȴ?niQ*ҺŦM떙6խ4mo[;[Gez{&u;LMuMG4;vNcV ugb@]߬ ֵs . H;oN dcs3}9;_/ s^`h}y``D}yH`t}yx`\}yT`bpyl`J}yB'u梀mѳ@~pae`^9``qmec wV֏^:G "+[[W~-7Dl2:&fU&A-SDWoh]׾~;#^@YbBLd݄nj L _0&Qb1b81AŮb2$=Xg1Sͺ9⭬k׬j,E3B K85,MUCb72t Xd6F7UW={ttugt z(S:։Űl@XHL3Yk6a[*I#e [[VtT |TpQ-%iIbb*ۥ<.iDGzFZ)㤵I{bOjaX&)^J>Z:U(6L3r7-@\''[mr(!BD/?/UuNM~QޤJ7˯uTr*_>$P ??S=֮W~K jƗVX.u F Jcbcw77f56k8hcs7.l\Ҹq8q4oXبoAa1ImOv0AlZl.'ŞhOSʲK= 9pq2;bkb,QLowkbiHjnaIfw iYR ˆ űz!`RŸI^WԅX)sBf!b=H=ٯo`7zH%HYe_o7Rw[YFH}{Hf ~}Hw |!X@dL`WCtW-fÁc_FOAH(b/Gۋ v܂*dcO'qa0=Ao/NnbSf6]&ʊߘ^xMx {w&0"Y\f9y~OW-0vvs4W[ k%X!!HddATGed%%di̳,,,llD: 9f9i9ci2dUk5˚kg`lficod-$gXX[ZX[WZf6(N~kz&"im:[-)Ömc˳ Gk`kHcn ,V}aNd dʻ'w%+O&+O!+O%+AVFVNV~YyYy&Yyo,ʳo!+A%[lz_;'[lu n=,!ýdCɚ#kF|?cJ2`>DCP{ #GCݣƸOXGǶhvC&OSlӻYǹ'S}E$6Gmyb/kcxmWғ`$[nm'=_՟kz]g ^% Ǝb[i˰8mg[ێA=qN:׶vVy گZЎ}XRL=ei~t qU(^:2:oq3¶3ڶ3ζ3Ѷ3/b^N scsa;Nymg=![v3c;vѳ,lyٓ<+5q-;ٞM]{V{g}g}g}}}͑|>>sc"?l7z6m3 4͵Q[ntNi xhz+z{oo&ySK,*[<΅|޾LtyپΕN16- 쇾s,rotǶyM[\ϑ|Ό΍<&1܇о5 -Fľכ~~;G'fޑfw;jo!X' ^#ty}4.A9:29qpǷaUcqՎ/ѱLqx>c9z;Fx:F{8y;&zWѽḄ](FoŸhaDL Z:ѭ]ɎX #;b"^5p{K',N 8,-J́RGsr $zsx|BKE9AU|/]XKX,•\-]V>tS`ҭ;MɀG}휉s6ۊA\`sKL0m܃Em-mcڎG}o>k۱@+q&Qx|.:v|Mum+YɈ|#7ܫ#+ʻ.YX^'zMƖ#L66J$ߐNŅؒtf&\_QI?d>0J\?%|Y%#}A> %c|u%}sw.k,)-D[甶%ߊouϷҷc]% }{Kp^Pw+Y;Zw1%|K6Ikί]NŒ=~u~lI?cw2?O+9,9߷ K.%/pjC?L>3?љ/v::sso9?9ٿY_49mN i_9vuιFn">~ϝK+rstnЎIvy>W:wso@r(G)tnzt 3gs y.Џ_G&2AW|CWNKxxxxl|?#WöY}cδH]h+&3#3n̂J=h5'DڋVC{jhLjhJzHi54VCj>T@khMZDҚ}&z.&5iMt$DGњC&:ZZfҚ8Z>F0_d?^^bhMqZ}D稟dIHI+Ƹג? dJg4"-1,725l0l6l3t(F1 )՘a61dcoh2>e8 'n7mۣvH#ᶢσp[VdX!fG:ytX`ckK8g.d53 4 iK~4d`F}a %W$0HdC'x[6Ԏ&$Cʄ+lWH${Pg=d8o۞ m -F^dzEac%8 U8Q_cXݞxa8RlHia-w=nΓ2: { ^No̓qqq^o\c\ot-ndOCd8IܾvƎ͜a}ҷJߟ~8myԽhmJ0ʇ3y3 fKL>>mVFgѧNXAn={ UF#J3Bm>333d H1$ݗ12clƄzS2fy >>|+3dlZ7glMGȇ3+Tƅ+Mh` f,Y<3:36rfL䏻o2vG>?mr3')ͣנht}"E]:uI9]'Znu(мN}i.#I=CB^Iԩ[H$[;zxJ"ШOk}oʕǏ<գ %juZZlQEK Ύ]>jZZݯeçŹnnK/؃ejDfىi!:]v.i_"Ǯ3gfKnIF(3590mVj̡CS3Gg㘔1sb׽Sfe̜~"s~ڂEK3WeM[1s Kf<36R,z,e鬨Y%dVLVYe5蒞ՔRbVvYdu:1WVY1i9ԽTNFɜ4߭gsgmJkOxugsuwɺV脺ɪ׭͵N]S:_tCqǧVɝZtֿېS;:i̚=3d'r3vc7U'N]D6j(H(Rㅑ:UD6Objb֦Lۥkߴ}NnE=u#38upiϘT~o:ȋF,5qpupK' {<ř%N+w #oЧ|"H$st3fe3_.)'Jjnӵ^ wSnj:/!wStRtY^릔y+Jm^@iߧt]S^brwHrB:L9J·f_KItSRA7%qSb1TtR"N8/R}7% q4>I#nDߧDfR@t/u9WJCΕ m13)'|&]P5Ci'7/y)w)Υt]RUt]tו9Mu D^S󃔎ұ9WJMqg{m!ܞP:rt҅;+;g/8B_ZD?nIq9.Z-Jj͘/osuy>ӧ)E Rr"~hOFh%)c[ԎR'JݼE7>-L1n,FLg;weɮP~ Z?ZPLiAZ՞}osNarؙuwup^ -Nx=Nzrs&kc -hZs_}'Sy_Г#Cʽ.CcH؛Nε˱X~O?Gŷ|-by|g//ݻR|~S?֛79O?H 7~q[105non{?~[7-s=/v#.QI_6??dnVZ#ID%,?׳H^bʟ{[Q{_wsܾ+ZV+;$M?$?<޼J Hz!l@@%){B]/JqNq"'йNcc3lIֹ-_z^hJĔ[s0a*%w 75 ,rcVRwxO@^iߖō]?vkMگ%>,a g\LF{wO%'Q(W/$%-"!{ks]"GM؝"=`"7csb?ץDO$w#3E"F&Ҿ!qkĹyŮ8'vU"!i=L/uZx]ߑws4%ݶ'yDzn8|K*ń1bXRV&qS#/q,k.ۋ?/$]];#/+3c5 >)A)RyJU)բT/ǵwmJ)RkJ(uԅR7J(4pJc(44J4J)-zJ(mEi?9'r|?G2>?5/|TREJq֧ԈRsJ!Jm<:SJMPIi, PAi6yRZBi%56PLi/nJכ\+%GJW׈^>)qZR?戺ԘRv1J~ʭ)_8WjK)"Rk4T|x!JHI9 'ONMT#n#I̤VImIJMLA~I&N41ij̤9I%-EZ7&mIڑ`ұ3IH5;3$CF  ńʇj$5 %Zڅ:zƄ' MM ---m m eN΅.-͖y[lY T˲-+"ŵTe#-C-Zv>oQLwn}'ԩ7>CZ4XLϔ3ZΦyH [.5 1>?4ǐcȏ1D} >BxC]BWwjuϊ~N4 a~M/zb0F~#ϫ, Qh> ^;%NrAKD:i6G,FHkZ娳=qb6}$H8>c'3%qFy $gM͉w' SD]Gh2ʠu5`5kJ5 R2LWSQj-${AL3@o=rnC>3ա-5ƮXцυ!3,jPwXS8ə˄K28ȴqS!3@(dJ3& [O5Ƴv@) zd2Y,o3+E!e0ŒnD֏l  L"YeUkq4!TCO` f'KZ!#[Q^ x8lc5VpS]0:#B.T!*R ppaO01M(YVpʀ !?e#@ 9e3,ȥEh"gMD}~|u < TN6ڦBTy A^RQQh;~AK"uriƩ"ː<lmo\baͣ׀[x!:.eDUWYYx Vgfye{NIYf«WW]^"4O({sht`y lb2Rã6A ,bGxnN8f{y1 qSQ=ӚS)U_EtE?#r~(a}}Þvf[ǴϴZo1s?5vW+E`J"E0, -QnG#,-12m|yzJ wcZ>g8W ¼0|Hvss#2`M1r(G'!4 d%`s'<Ns1_ٴʯO3wD~F29[1/[NS1gZC_Ѥt~~34fibjbne%H8œB_rUa>f_MAn9&wO ^<܂0Nv~xcv "w%Z/!Tǜe|)zb>XVjcuE-O!y7XDJM Ϙ;QouuwPZG>+;.%jZ~n9Q{""Q=נy,@kZ 9" l8Ӂa CgNs.{8zZCOkX5kS YR%DCa@CK?.=ZAe2yNR ᣈr%do2@w`v3g$ Q5 R*#>\6?JdLZa8]{ja4RC3mŮ&l;0kg[U2 +%JdXўWKYd=x^ʧxoS[3F'c]~>aLO03yy)ʣFPsEk༆;T| ǫVIa\\zӺ`=CLaZ} |9V,i@VB^mhg@KSaj?4G&sNr o lcE|G[SېQ-}e|8;V;YC0ZExfRv=R:?!@'ns1rlŹSk V27KFL˟q69u e;*5Q|Xyt9UK% |$Y X3ƫ˾ks؏6N.k:s!|7ӷA sk@_C/~OcoXag%3~}xҩ+ s,=ʹB'"gm1>wQXû.&y qZ_2گv}ķp9磯:͒拈CyL|h7hQSOpONgtS}MȽX z1fH[bfsBk+̺8m4>Jzk(r_Mڭ]b'0.8t >tnu 1a%kGX'A&䶴F""#w ()"}Q&7#10jL_o0:!ӽz 8 ~krO&]?AXć)|Vg0>\:X`/?:+z Yc, 昃))pG9$p3h|'pOg4ר 3s&5>X-9ہ,Y}VAg,|5B(}H3g*Տp6i =d+-l s,*^'P/c T ӻAGhѶIk k "^FE`:8/Zf0j~  z&03۠3j4@|e."l k,a `U7cƴk| M[;"{6=w@2,TF>F*P0AgKtWD٫LGQ9 40u='଀hpYmB{>X !sA_m.<xXGfqz| !ĕNf&ke!;AwvmZgy.ڜ9UNEn@ X h 4z_~# OCC*Ajq:[hak1 ?@dz[CskXu5= ,~UGWô?16W~ tŒF;`m7}L%ׄg/gw_ G})\yxg|xw,ǥo#wx%0K2?(%@ gTKpZ28_Y`t{U3 sCV =Ν09[2++_%/MxM4Óׁ}_62P5 2L2 1slGf}AEOƺ8%{=^CjQ@7_ktmxbbU2(&d0$≺Xg`GHAm2p^^~M<:63m~zJ= LwW7x +Q mȭcJw.>|Fσڛ54Fh\~+} ts0b!kD>wyuAgCrp?" ׏`i |QF? bă~}?cCVJ+<ׂJMY62ymd3 жC.(^UY3 fXȨΙ|ʒ03Z+MX{n-=sp\cʆz.`(e<*t0lL-Fyb 38OB(i/6k[#p/p0p{rV[2m\uVAeb7\|F([|Scbj&\Z~?!њV]f=f7LFs 硅J|DHRJ+Sq$ r4G9%iL%?M1r p9w5,oLN*F5fQ$]R=(Q1Bf*jlR3@-)-yQL#+LO, 8U44$3-dqc|UvgZ{xf!Yeϑvw&F qxc':)2ZH}W(^8װe %ʖx46Fq&+CWؐ#x\9͓ 0S\J-;_Ta3YAwyN{`]F+H'}ye)l?Nv2 ]@KSt`Y1`-pWmZUY܅RA;yp_:ʎm";yp~F2v@;z-o`XC}R;L Vx;:Ga#U'>6)*HAr=\ѶjG_W\@#hڄ9'S -wsJ+AgC&Jm;ŁZ+Y-g᳐쉶-TohIԥL;` 8AkF^'P6 $s wLQ4hhS'@7= QgF!~=\ɧQj1hx }wA;tOBp-Q5^o];EY1^ֳNǍ`! ĜAc\`Mhxt`SlGnD &%=d (u >| D_̏Ð\ 8*V ڐ jڠQj^bӠ#/8&$,,h2S1mnqTU_AOFU@^0/Z:Q}"9A ڜ 腉5aU_6"ʚ ʭk p "7¸]^F۰P 1Sl72?}~~ szLJ vV!޼Vў~?OP ?Ct'(1m.W(بsQX!8al.`TSd! d:1a4vE#_"$/_eN}]e!#ǀk_g*ړkV5gpJ]XA(;iIhڵvh 赠` !p"!y,8[+@z{A˿l+AgC&p]{BZX @%?#s)4q O@tH.=p5dS9Z30>x]e 2N"8' e_4ʪY bwC/\?#@$$/9ZA Yamo89d <Њ (8 ܏ ˿'&%=d z(u8l(fc <|?C[! D$6fL4j @x: =hcBR~\>FƥρjZu81$`Z$! ޫBXjF)w;8#VcGhs&b&FքU w|Km%/51[Enp_FMwWH\yגu@GcgWDe1ʪ?]~:}l>0k7k~N{'C-?_O7Tſ)}&ȝfY sq'M2G,M%i -fE/@C6r0=@C)W4WAc&3̻U$YSI1g?>`ݪ8q3.2󍻼d|O =!j;WuceN|E4`p |g 6ʃnWLahAW( t~W83Ვq7!"Xڠ@dԾǐۏpc6w{!iL<l;l.FhLa>ACLA AO=3qw0TAٶ\Z쵙sލh+nNe|bK6Ήlx/ 8H&76|GZn*4tM^ Q!s۔vx1 b, K={ w#_Arkg  Yu YqaS#w5 ʘZ{g Vey^zw̅Lc>`eFk9Uk:!j*xprw&aS1AZ ևwY^8oЙeoeFv-[]EH#v εsW0a&rٻݖ0Ma[]q *cg GӇN怮 B&CыipW-6`,ǿ`S g0! [e*ME1#Fh@ wg +)|5-`.pNjk7Œ6|z +;0q7xR؆8מϵ[9Z̏13NmŁs Uf/q-@6QhIQ|x; Of=χ_EYy (eϋMaܧAo1&l2!?Ed 76z4 uXY>Mh6#2l!I^ć fdco\C̩zhmVƍ?Ŗfb":=dm' 0mm3GI-Y? n)9"p]ؖkYz|̧s <qx~Wy8עQAlxZ4zï? jEaª'&P_B4UƠLO( __ɋ DOX#z v8wy`-h^V5ӭ7`-F[1Zgbhl8\v> ~^̻L߱mgz3z,7Wn;Xg0; #fX:XSVoͅT%>bX[s Umz޾c1b@/HqdV4aę9.@~lxV4x&L7B/}wDޮݹ~EqWK}*%~a'yۓ a'Z OYg[U8 *]g+Ԩ=Vב{*G~mg/se󛬢.2[tg+Ȝ˲Sx>]A=c݅Hf7}/?ӎj2E79cecD+ uQ{:~ ZB%hVڊ%j3UvO6|yh3kN'͗=UО0j2OA~Z@9x㙍: '߬m! hMFS 4:JjoH;76/E1vx6O]?&5rV1;ۂs%/b {@Y.\z ~Xԯׁ\>[0^Af/J(/>#~ Sc6誀O74_Uױ&!yM'q[faHƻ/8}mlړxÀqi-cPĪ/J])zdE{uGD}!IhYBmzs%DYh/h"ZdNij$<<'Jr.qYwbxCωb SxT4ERt/^#p2hU/-i~H4"Ud %$KN}lf|9ny{y}vQmo^@ܮ@T1.\){_l,{Woʹ໤}s ٻ;Iyz޵wmu{+bGkbvJmn^%(T{\s}ߒ\OZ^FD\k._VBl5z^M8i$3:M3 i\4.  S?AKqn=*JVDՃ|k~qň6UQ$!!&ܻYNud^jQ\ct-@ߏVo \w&<(S[WQ/躚=CaO7Of{h͜x$ '1gހnD 77s6#g r"G G҇Y@_yɪȪ*(Y}^%ljj0~)T^ y1Yśny"K-YNSee(ޖdoR}*ŗ9PCPF#r IrX'gb$TGTqC5QM VoecVlTRfqVWQi4jXFMרeh4j[;# 6 NEvL#EW>%uIG֥U^]FQ}>_]~}tU@WҕTA]EWQtSu ]Cѵt-UTuݺzGUq~DݫnJκ*Su]tUFg,>~VսuoUN}U~N?׃ U^_T0=LU#HUI֣Ue~EUѯWUU=^W=Az'ɪzjizgg,=Kճlzz zJ_ҿv"a\1PaܠaI:`Yg6#ʢ'KR"BePNV':[Ej muJz(*zꡢGjz%=FTcXQC_5uQK$=Io7-A=]O;{=~_/DP4 H/ cz^$zh%^fz^!#@عF$P\+zIzEېHѶDѶLQqlkzmZ3Իhh)/i}ZgYA(NiC-GeN1Ra~f~&}ݾ.zbyet|̰i?(%T#(&H{Y1S RZl[.q@hg/ F*gDp>7"j ";b0}"^ĵoKtMrCq1 q1׾ڇF+e\{GO+x}In"^õwx\Dk߈BR# D%X gD2,г'EyԳgExgeyYYfgE,g՞E,ƳמEyYY"<|Yd, YZ;"<|YdgKC;~j%RoRYw Yܼ,a4Khc=]xwR̻7q?Qn2oI$)I9Œ2eͲ"[oY,h2 E̢f1^)E3yi>33hFc5~I}D2|Ь'BS^ QXVsP+d-T-S R}V/j՝g٤}Gy#EљZi~"Zg3. M./b.Fbொq5寋 1QLś4Sb.fw1K+f>Ń >ħbL,SX&bB_RJ_bX/8(bʏbIlbb#}b"ί8$qqqBiqFht^\%,WUqM\aqؐI2$[VqZ>!'e[l'i(;dYT&Ȯ2]fL%2[>+gr%W/Ua<"c<<<#s /KwyY!ȫ. +Le)[9ʧ"T jګgTGUC05\P7T@}>QڤWjQmU?mjڡv]g[Q{>_b>`wjdn3;̝.gsk3_̓!yt;9 '"Sg1RgYtpV9_:5Zg|lts69;-ΏV'gtv9?;=^g9t9ߜ#Qs9tN93Ysù\u9םs'|3yϙu;%w?s/_x>0 B```P`pKQсc^ L x;0-0=0#N`foYw |00?Q`A'EO_V |X:6!ḿ[?~ l 5p([hxtl|BbR+kpFP vo#cS3s K߃"҈*Ҍ"H' D###udȼ"GY `d‘E"FY,F,Y*tdtdȘȷ"F9-rzw"gF-rV仑#ߋ_qo"(jAvV=%vi3V=*[e(jUMVA쇰nƺ֭#X3q + Y/-7*[yFcjb688%]eYw;~lZωQX5?v@ShXIљ Rj(&((;xKv;Q_ ' u= d~go{ #>pKQdkz7Ӂr '/rݖS9ES9RDШU%/ )FB&0eLuL833OZsKk+3+,u\3;T<@r659V$ZblCk$ژWd=MZ\s.V;Z'sU|vpwH޾*:49ӎ ymkԧ/o2u37/?xW0*X X0X(X8X$X4xwX`R``L```Waw^ou_Zu:߭` xUx;;?\uA]k*_uYEtkumm^?:(@G٢FYe$Di^`4#MT3]EadFwe 0 )ۢ${^G AE1R$G('_M9QR bRQb*b{$*X+Vpzf4Ǭ|V>uɺd.[qM2٣W{W׍Rd>{q=ݞkTًZl ŕ𾭠o{OoO^S]Qt>fUΊ[V%UŪjU3~4?یcm1/Wq8lf1nj S~Wꊺ*n'!{RM; 1>8'EANnQؿ+z Ѽ2r2#8.*Q&P#S'jP UԤ8~HԢo6'}vKEKR[&Yt1# =iV8藏voϊˏ~E_ѯ(|Bbq7X},TOS*i =:e<^7DuhFu:pt4?;GF^˔F-4Z[-9wE]Yl11b.]"h^aF=E?)4׀k5\>טk5q͹ø\KpHwך;;kõ\B  GH=#!O(&01 sp>-^;Ft\|DDQT&Ӫi՘ 1k yU0*VCE,dB={1[m&sFnWݐvGnO份|7ݓB:yySRSv&gGMClԛMaԏQ?j{!2?c"hǨ6`يm^AY ,4D$>E>Ő>ő>%>yHHRHH2HHC>d00A' :b1Cv Ni_2D+ Y |9(@@,,ł= Ҹ<AF#1ĘMPB!ˆ9aA 'Fф 1p D(Nq "M 4bI,!+l"%XOb+ATD %#D=H'N3yqB\#nDAt][޹;O\  |N9 yk,]owdޣ1{'XQo5Dc N*?&?&jkp~lJ M`[$ACm1*ACcRL8?&~LC~Jj?/Mɳ ݁s$e{a O͇l V?c ]Į#\ᅴ[Gl q(z1T$=4t`C_OK `9P뚮qW ^h PnyOrNөu2q&, _n0EpQ$q ZP eZkNeZI qk6˺Wp=Xa7eCZ#/"bX^Opvh R.!Gİgh F,2"`91Z?1 ayc,g0Qk3aqgi Ga@8Z<m.c^ zXn9' Od4%P|1Yi~@b `1@  @b 1@  _Cx@< C!x@< C!x@< C!x@< C!x@< C!x@< C!x@< C!x@< C!x@< C!x@< |[wd`EjEKIS%La n 8|)d4\LЁ`%;?hFT43sX,Q;HAKJmoiKg#+7(zz)m/y&G6;UF#Q" X٨t&Ǟ03<"6,1./FN!GHpL\l0_TyRA q3BUl#2uƓ~+"&31 &^v $#7'-aafŠM2m?R3.ɦsx1|-rhRmD|xHXO;;O&c LٛISPRA lgH¬Rw0``4) V[:ްvS_ s}^gPΧhwN\-MJ?/kg7vzÃ9a+%Um7.Ց !.8)(qр)-"%B4B0Yp\2B'Io$1 fϞ$+'_IAsB3%tb,V.)xFfDWjJ<ˠgs'j}eT)ٰ7nU_cµRŞ BgY=sܞ!kkb&5!*a|>aoLdf7~__QB+ RS>kNvS^f}3~YFM V'msF0?bK¬k>V~GԲ^x;I#+u3Nu\+=C9'YT:p7sZrW{iUw@20ի*V]dvُgDYxWka&!G"_~+j~*w$Yb'O-h]ԼLܸ{ s:"c#>˝\jr0nC.zszBWj$p'65>m/Úˍn ]j5tjë^5]7(+>mN@:WN n_g-K? Ak!e~)<` qS;nzA2&)1<.!"1wriJLHѦ Im(_Vlߢ ܫ:wun˺hP~aDRER96ٕSI͛XӹuYB=3]o?}˦zu?ڝn^ղˆÖ5a״o{hymo#u!MSUd7dWj{êcj6~\Nּi7~XX.>NRXaa^PZw5xmRJß}mD|HWFc W)'EAҠd|+2H1W =ߏiȴ婒hoGCyu=>\97OXN%e;'y+3 !# Pmɘ ϋ';RP @ړc9Sð4N5l٭RܝAa)1\^Ź#sW7,qYLIۺsFߟtʧ@"q(kiKlFrR]+>Yy%qNhj] O??L^g(-t?K(vEa݉SX3p?~J/<ުoXym Mty=T_%LdؒśF10zaQYw9;,'\~rt@W uLOY)( :9'y}&w9>C]BsgDzm%rk`ӗ^ }j#1]yj3g:տ|8uޯYW|zx\]V"S,գz-}ՑVYĖ>S"ݽmO+.ƭ |WhA{U\QS$w#{1/Ix++dʲGK^-\5 x^K54U/s^j626x"ѝCy{ۯ貜Ň&wVKbhxUgW*o mPXyKN=mDU3+˛pռns(fR]_2)|l%_vyςOJ7o˪oh Kmv 7\[k,;9?ac+n8Rv>3T깣?\%"oVxl\ymbhs %9r8rB7RDW#'^`-oq9D:Bħ+˾}zYdS|oҫD7UsF+1j&' 4jЅjjJ KOQ7grsŗ2jϒZcKWor+QMHicfF6JؤfS5fU[]n*\ro&m=lкXUN' UZ{͸sLzr7_^Qe !ʼn*W3}jO / aQlȫ,M]=_8ZУ ǵX:o|eL/ߵ<~BƌrV雕k?eCZ߆Bq=#'L/ڐh|/.qd+k'4RvIrOx# (zplJ͌`>$!~N*SDJӶ][/d*Zmer` ћیWs杚qJEd廥8[>mkoc*IiSg4fղmb_[HȘ/[eTnb 7/ %dHٿ ’SWgK.= ͛ mzR UJ>[-bKZ˦*hs8A&WH\p\^sSgb^ ]N E GO):tiWOZL:f̢O%\az# endstream endobj 10 0 obj << /Filter /FlateDecode /Length 122218 /Length1 245376 >> stream X |U?>sιoޛfI.$!BeEQQ\*ںkkՊ$-ںZۺP[VH3g$jχs;s̙yfgFK@3ZOî9E+fz9o!CohGHUX[U]?9!Cx0SVqMqO?/|uoᮋWuy[TBىPc}5B݋-Ytg5iυv_P_ܲ'R@h6rdYoWϿ>χ Bc-\A8q٪ rF+D(? f\5wn)E(~kyp \?kU㡵tekV0AngDD\WJ?E.%""y|*Շ|Gw}y]Ŝ&H!ݍdh3CFEB ^HfYdO% !% 2Ah =8JPSߏb2(~$GezRS]?^Kh]!E Uks'NiѼ;1~='|N>^wN~uodč+a<=Nv 2zLv=(A|Sf)ЪIBΓg,Ltp ZyZ~ǯ=/8ob+}^ý3r9 %_'3Ca65`'y='Fy*8-E]¿AOK3IIeE7)V7NKyE!-( *R:/zX~$\<04HB!(;-S*8~ ]U4bz!]:pR>7Ov<~6,nsϟ/@͓]#{x!8)P@xrܤ42 (I(IpdQl67dNpZ|28ӽQg.:nQ"]ݨ -Wh0Ҿ'\GA8UwQ\]|Q%q+@_'J]~w8w;g;[au0 ui(B |^b@1`) LҜV]~Y|>M~BܽGFQ6w ?~~-kQ!eq-ҹzdjfnyt }濝q8}55!\y|/FLCXX6܈r݊p;Q 5foq8w;sǹq8w;t֙"uf#}J֛ZSZgN\c;sǹq8w;sG#!ŰG@D1$M9*Z֠h ݏ~t>C'pWMfxyboo'k[{|)!?JBSQjsB&80IoX6v/G?Pn{'_×nEAt5zwn%e4Bm7K 2}:D|=]~0oJC~;1 OyXe"2#'BEPRTP5hAzs؀؍qNīF|ގW->^;L A)N 3p-. H?K٩P0'Cg?b#&k4Q#m++t)N\yi{_QKcڴ,NL}Eg=Ck~LXmho?D՜ϿHL?9e R.9%eF)*MOW}/Uxns;UߐțD.ŀ\v.E꾚 ^Tkԕ^uzWkj%2,.CJm^] :8T)'Sy2iG\=hDj{=].h_g}Ծ`U_?9ʽ}i d2v' ="(|pÓcy)"TqLMpqeBRch1v6Ӱ- X4[DaglmNvfEiEҿ 9v.!}|xeDv VUQjUuIuόBEPD }>k&?i%e}>[/Z]E޳ln?rF{\AgF WiY[ :@}JAc_;pxG*)YbRsEHo<|i-WN iъR; " | *)\ZY tq"y2B} y!bL>g,MM P2IrхtcBIC0r!l(ҊNo;Їb3I݈mh 64m[[%N 4ԇpJ5֬bV N9=QZ̃R#*-O뺪М C[+M͞ѝb{T/ZVLNlm/emiJneF aVEz؞ ?h~\58U.OsXĒHɩJ1p YA݃qJQ G,88r@#9V{HlXgQ\M p>.X֏9O+H|9/rClҞEASСڑӮȓ,/y:RB`D"@mZEhZwt[!$֧TRFtGP~'vvu/i0Qc9-M Dlx 7JRhA8սPw+tujK &QP{Tit>Udd!) )::hRO% OPthNM#eCQIҧI6̓%, )NBӺ5,d+Hy Rs-/%0HO ɁtL9 u95o^jzXgR7T_Jݘ$j5PA҃*'K\F3 F63 F35f|FV1rF1%2H7#bd# YH'#\F:igd#icd#0LFf02&Fi`i1RH #ՌT1RH#S1RH#S)ebF)d|Fe$lFd$H#錤1H #Ɍ$1a$HDF$0`ψxF1a͈'#F2bä##F2aD͈%# F QFFf#_2r/3#2/F?;#12ȇ2F>`}Fcόw##yy7#gwoy #2?_1 #deF^bEF^`yFcgy24#Gy' #O08#1rAFeF1r 0H#3#?fAF3#?b~Fc^F~=3r7#w1r'#w0r;#1r+#0r3#c仌ȍcF\ȵ\^Ff*F0r%#W0r9#`````````````````u033333333333333333333333333333333333o3o3o3o3o3o3o3o3oW 26 vETׂNCۨTlNy[ bP@CXG#x+@b5$XIŊjQeT,b@\^ꡢTtQT,u|*Q1*کCl*ڨEE+-T4S1TLF*L1O=Z*j< < JQQN+b 4e "* (",p' O; }Ds4/T|@TGDC8F;TE#ߤT$oox}1k ~Cū45TL#_E*^y9*~A#NųTFwLxS_9 .fOϑQ=gt>GFu=cD;sVApm.)i3k#l+I)W0ZSSO9s^/JcsW1s䉭l^Tmh $F(7OMݰߐ*HB$[Q Գ4"7~D^2:]z]Kv.ll\  p>``%`  d( HRɀ$@ >@< xn 8v `Xf `zhj (r Lo0 qx0 8ps> O?>`!o>= #ۀo=w7x ++_^xys_~x (g<x }~ xGppvm[n|]M7pZ5W\pꙺ01 01 01 01 0: 6 `0 6 `0 6 `0 6 `0 6 `0 6 `0 6 `0 6 `0 01} c01} c01m;.ùpB;Wgz>^tz -F݌B>4zcdl"9 4z|th^L?!Yx̨qS>a82(7#x5£$] ^⎑G;Eh.NuAɛA3+J /·sK{ /?|C1w}=Qݠ5%׀A wM(1ߦ1m퀺j/pI]BہM\u|F4tX؉Z9[,m4s"30oU¾;E>1w{-4^al?3'2*B?[t|=,?0s=$:a1?أb  $ =~yz=_@k?u+Fh*B@ϷUZ5hHӽClUUtœ0s΀a\3Q᷆E!}[njl*{XV&6L"zNʃ \^$]冃 zN/(s9b8Og ˹9x˸894dl**x)I +~0ymvY4{6I1{?d/+_%突 ;])%i Mvl&Um#yl4&PKpCfE (n?G?85Dƒ0s2ocI8DNipSb0Vu&xj Z5jOڠm1Pyy(49L@M9ơlSh7/PW8-m6MIFi$qI CQ84}RA:Q~v@+h1]#N++K(J7bMb**mvj*%ZD9(ժp)7?'ڳ .4l^;m!Gr7ζNMɛ_42.[?p%5=T%a~Җ/"\ڔ1Ьk9Ƽ`Ɍ7K}#q-я,Fq$UJh%UJꓰ#' K8NAy(gfÐ~uGi Y Rn)6k{u_7i}sAf59u'}6GoqqU$ rp4,7$ZefCbc!=b:[Pajky䦺qKqK=-Wnf h/axNbN ?ޑ͇rW?m+nІn^~OeBmP4tA;"hD*uD*uD*uD*ud3T*»2G0.F/kA1J_lg N6AS@j-Q2|L>JZ5{JZ[c5{LʑT8mTd)MޣYP߯HHHHH@(ޫX\At E 4#EjO mXuYP1hOyLi V%TF=jZ)cR YSd%EzҚtJIܠ}rZ%W6Sƅ16|3./;f8vHR!T$"IHR!z lzȣ E.TsN ngVҎϡT9hq̔EC&i(aT>T>T>T>T>5ib-P=-q靖m>|r<%f+0O0ͮI< r#v- ylR(7ˇx+Wi "tn-ndnTwhemRemRemRemRemwHeh TɘK1&XﱎEZXdQGX%^!.\cQm~˻U8e`Kу1㢲5e.33NלLI'fij2dSѧ&-&} tfӡ:2侤f_\fprs;O8LES99I6^t}qioQ?Tr,Jn$ؼV[UÍbi.'4rg?3ѩ›dx V<x^>Z {S$ω9).Il̄D LQ$DVIVQꌌll|Al0HMQ|a:\d$=DTQiH]j FnMxޑЫ:[Weq)->gV[ׄYN nZ+4NOslA oo־k_[}(2{k|oarxw׭eAw'ιn>?Ug]uGjuv.ԈN?qDTATA4PK0yڼDm^Vdm%/"S|r9`kNph1EOu 0ئoAe Iqc[JUɇJty5 ]_:16^ (̙q^~nƂjxc@ . (kQ@jU@ZZdL.7U3I1I1I1I1|25?&c1@C2>L#.3TbwBaqn8%FnMwa-lVz,X2XO+sӓʑ᪙Q؀;<8Ƙ٫+.QlէNy7_ָܡ4Jfazw?gGcSK(8ʫUd{y%,7Ťu"ʸ&Zk<*k `͗ %j2A4T+}0ғ?4< l7'cOv8``>~^mqmj=)^ͽ j~!n\g`HgwlJL3?bt'$OBzgj8tDa c*Gq0J )z׼LLZ-:_=6\6I Tel_:P/-1J~HEP[A=3 :%{/-˵g4zyXr)w_".䜪WM sxA>~lHrS~wYY{ƞOK'z 13on?˩n:3kb'-1;͒Lm*J-G&J<UOW9OP=5RUWT[I<# Α{eгV~2Q*p WSk_F^Λ00.>gefqYi8_lw_J7O9/KΝYr࢚ڝVFԗU0Rh坱iٛM3%I'Wy@.kqw0`v7u.''>/'kRNlVd7 d.gT/=/dK.>z I7hbM{U՗v[#]T՗>'>. z(C"pso[o'|ڜ~Uȇ' Bbd^Аg-o!T lv#/*neTPat>QFDJlh<(#dr_{N.JY~R;0kI 2Z/ JbvCf)iMorGGB6'J2 r1u^S >jÃ%V%Ҿ Lۗd+T0L Yg-農9+!7^hMf'_f\܅ jjǨ􆼥رyvU+nWav[4W?a,>CQ䧆D ȑқHF4*.ڳ;=_WڠVH ;WoU?*~+`S:ƪH1?:[7qDˎ6d9 #zPmK m0hc *rC )M6AeM~Ha)G?wݒ?wꃽNbd~WXOKppa;3 \PZ=$t@68cFkt&֠3%ĸ7X{4(vE9OrS/pVdGj;C)4~tI(#&,ϺIfr ^%Ktd#;Nkrt'XTP܇7ɕrީȓMaߕi|$?z"ڃi4hLr$dB y=v x%ceW02LWdOr,ζgz7+`-άGnf3+ΕSu㖸jЩW9:ݑq{/l iFc+LqvTgc5)GRgCns8&yE4 4&7' ?92J8|wKR[$$-HM"O!+.,of0, b4^O϶uV5'n}ҊOlxh[l P}KCrkcO;^nzgmaeil nZURFe=Ž3H[ ^ZX8^T&ӆ>hMb]dsG1qG?/}lXϋ%(E߹dZs%#OT\͙[_$4́qa02YTS.~D qJJE^DKeϴ赉f'2՘pR{]~> єXЛE^XT*^Eo97^ĭa3m]U iVO}i^ʝrz%8j ̘Zeb+PT\i@9_P;¾VU.VL*k xV^?cķNWM FPR4;43S=?K. j9{fɶǸsH=X]Qv)7эi$[ "1R5=ANOHujwWa󧺡U`s(qJs`VwyTYɥ*apJ'[5:SO^7.rМ'P"W(C1u+' 'é7LHakl9QQlɢ(&7p4(S/6d/lWYXn_㴑w2sRЛ`S0h_prf2S'a]Js:q|nRnHԞKX@: D'"6^:^9O~CjHޭqY]*KlVa'ćl*/^7 AwRį(5rA0HoUolQ2;\#~+|P_4JuX K + w /o]H);}Ҩ Vj-Z94hGͰ v½ (.`,Y 0{ٳ/7T*FjqS.q%͹F;ӣHĀ=iT,=(Kl׵xSƬ&3(ט˕(fLMĞ xQ?&E[W8ktGStIo`e] tѼ<;w9y$AUINV|1Ko]ߜ^YӋtM**Aᩘ$Y{VT:fN]=ũZP͒kC53<0a^KZێYG5U`yE0ux,7CodkQ y}:/KIXb <汥~"iTl (ȩc*dSGcc~Y8bEcϷ59>7Q |Pnݞt_י:&4{l8V 1+_5'![옿,VVY^o|S8|% Q < q՗L1Td:BWsAc~9qޑ y-b?:ѿ9MLc}_L%b[ynՑ->yJC+aG^4gW{jbjPi^俗mFіK6GefA3_DZ_ %x{a\fc+n,n- SmBq|BEj׋LC9agB!^}ԉ.Q pXrɕd;IvG8,) km{aC VNUȬ*Z).K-JM0eN'1]Ԩ.T\$iA%lFY ʼnmvO6)qifeNjCNfOuvc OrԋJv[;|^dAjd+Ԗ'H2Kb%\rIrI~:0 CӚLFqQ3HI%N/O15d{,ߢN}1L~Ha xr)om +Boy ֪Bѝ`mN/PT<Шl$dV=%[vѦ3xҌu3:LəM\b`[fp=g-$M)9RT8T97'6u+6y),,ȠS=8ɒ>iGr"ůݾ\ݚ1-yd|ƑgSʔr^d{jc fASlrW$'Ud3U2άՅ F#o!4 [*SZ%#cm &%?vJN5_a /SˮI)l֛]ZFD [('"CnBaTKSD"DQDf"2ÉP0QibJKTy%/85GЧ?gI8oG8v8Mtb`pdžPm SyWI^|b ̿{+Wl XM&MMv/ՕS6\ mKzaޭ"m ~a*ERy <,~%F_I#ڢ?B=D78TzO*G~^qx&4Q |,5.@|p+ο.үsz_㚤wf*_ ,ث!ok4zEX9V߷t]ݸ(^~˦)86ΰm ˬRupWWrɾ27Fs既8+<<<:̔+13y:ʯu2:g8h'9zʣ&alw;n )5*`p*. ֭V$ET3x1'ƌ.oós峓uCQfbB/ڌVLI%FoRfh TUV^f ['f]?T_QSt$;ӅZ&&N⛕`N0 ֺC5A{t.1Q+1%;s4|HGJV-%@Sco}!Mˌ8%QĮ8Ir9XUhHs+ɰX^⑦^HH۲5ڂʡ)u.i0nW S BJk@Ѫ-D6\gY֐$+cГoD}=im-kCsEW-ϚTmݰf_uC;kzZw^cgcS]j̄z]o1G6%dN7vڶ^d׌\Ħ^[߱!4Mgƴ̲ oBĉ/[ٵ}s2;5`Ԫoixzj8w>R#f?i[~fZs]Pi?m( ˯ 7K!֪Dzc/Mq.?GZx#v,z]^eOK5CqŜ^ qq!J }u6 ERkN?NT8?w\mh37LL[ Gi)m~8TN)\g*7 uίkV/id  @-^GI?Q9&!\#+WXNv3F 4IzDƩu +.&q&9S֝6FnR4ԯ-MHXڝMYWQi]Mn첡FtBk`Rrrh  gl1uؾuw-aMNxN*Wϛ5|qp pJc4BOƗ~Q1r4*E[^rɂk" j .q9_Sgš-+6dz@ȨK% CDꒇ 5MF2N):i.Q:{pnЂeu)Dm|vaOdǖcN|}li'J+o& '{3NV5Z"#f Mf^֒dOU57w$.FM2nk.,YQJƔE2?YiǶ}ˎ jOq{$5twAq?VO`jks_vv:1¦X]N]q=}(iur1C6ulq4T Tym׮ks˓ߪJ MG +19<٫Ujoڜcrw!3t3n |BAXg4Gb: 9 G.:\`ܢoSB1 Ȑ!SNͶKi]yogH?)p5 #5%@}ƗR_*{A#r/ χ Sb=8]F({DJFZlYe5v\c9I,YپS.8?N9_.r%Ns\~3 R}QKy3o{{t`6 BzFܡeymr%۶ɑXzS;]_͹dv#-ߛ7ϼQ|la )q*&)|$)x~$ 4gАf3#r 4c}>U6wFk{$ת.BbAV,t9{)+NBHAC]X#nюP;kёHS=E|˯qYio+}9#sAK%lB_F1pS؃4h%OQ2)-+,_OIF*,zgMKGY!>2g!|%N~`ˇAHaT 9yW.2!Ӏsͧ{K)dF^4,#/,>K7VQZUfWn7kik nk~b{}Z ^{ץ<{x]z33%وg.nOɱS$ހ2C.SE2KZi2c}xB*艋n'..v"s._jo)*&No({Z_# _ּ2gq tq\֑(o jqhc -^ѸIO6̀+hRW+ɐE*0 XGߏIJM4k=CeŖ(  ӛzo>JFb+J.֟;̅l{%4Ԉ73`/}doHĕԂhoୂ&r!#Nρt42| W%G+*x@:D5f{US7a fB.OUi,ȝn~Z k&O"p[Ϛٝ-Z,m$8 vY;:ۑu##Dl$6;=gIeIgU&sS'_?#0B):.ң.Z/8Dq Uΐug%w9%,^['[9fsD0,aI/3]#+x0l{Wz zm.EC_?(Swu| :;|X=6z"ިJJ+1*ٶܨv9'HHygϤ* = |sc΍8XB!(\g)H%9Ybeb'GZZRkP̋l/E׬jέΡP=Po6$ {{FA*Q yXre]"s$eQ=6".z# 5e5]TҒ$Ne`Dy_R@#|U~ oւ5ph/q8",.*"i"2hy?,8 u J{!+ـ\r_ug+#[zMcJj`_E3ԭj2%آWw^t `b19vf8K'Dq̋p.8q1Q3[z|)Bw[*$rKxzI*5qZmwsZWyV/%Gʤř (c:?<~oCAnYíȴ5wߵ>w{סmA˚s[љLٱ(d칏S%+9Z%+UjG,[1`):z16dgORBrx*8G&xE-GIeS9ܢVCQXIPErQHQ&cAQL&4ccº[qo]4q@wsw;q&jAz-CM/AiK6 iqᎋaݏ?hWʑ᝗Is#ٍb Ѫ+F{nKi/'Kq?,_pӀ "D;WYPa_vvΣM|V.F;O <,:njc;ѼCs"'ropE[X{f\_7̇ $w`.ʭi;M9gN(=pt9ī0>B B$&y=̻ \]@W|Sn ܈W A:DPP0eQXdL;DJT Fke*B|evN8ϊT/Y#+~_F"~ݫUʊ2ֺF/' S*_C.2&%/([T*W0HڙPNc]pVZCW  '8@60@C=hj`WZ4\8VڠlKwHynɸ`jz=Ujj崆-T_D?o IBI=G\"M.+ sPDsW<$⻄r8*E?B-a3߃&¡qSP?R붘hX:vnP{{憈ɕ !R G62$3\!2n;%`xt$ 1`YĒbFIgʷ @fkz4b `\9Fap=HeF4#~LsQ 66tx?1z*6{ud4,WѪHl*~]*OjjAQ0H:-".OA1j3r¾fʷD׻ 4Y T ru[ =fZC>X#E(u5EiY)m)\'k)ǩQ|INI@=.'9T4N&Ĩޤ! >2$%'+1 q ` 1Āb8}Zٮĕ~~lPt}Ct&D)4oh>{7qZI^%GpcNu"ۣ1>#1Jc]XΉgmoҊEι\_? P4XY\.SH 1<r{=u8/rͥGHK̹/*9vPߎ%jgMu(ԂacSX嶑PC@HUW}/T*F XGVԂڴ:ɞT\`D}9J>F;σ,IkLwj%]uuUaݼ qi%ᄒ?x lXdp Iq‘5UO)3 {SNxsj(BF6Dv{ξ:m; D:fӰ',4;EYu% up.]ov7Z#!9+ʟ=݆ʑ zbO5v F*dTdqq,Jy}w$fR.jX k='(cr!JS~ה!2ol9W z}7Ds.)!ܚ SnVh/i,>&ВbKB/{nwh~H?DօJϹ N* ;)nX>2vn4p3uͱsuo!e"G&e/ȷ (JzoR+yYY+X׽QӼ?0/a>mXձL^S_{lFLE`)\vC 8qhĻkiB"ۃD. ^kr!qUԬ ,~4$ 0N%!hdʳӸSNOZR'~izdIRe[N-]hJeZ5/C+y@O1TmxrMYgW{Ar-&Y*%՞D%sMqTr• TQBp?~z,4bl>{-g*XAe⇋zb錂RzV-jNbQA*-g3$4pXC %]}" L#n2iɗ]kw1%.2湹l``J ,bLSʫbDt)uJ)V`K}$-?As;vp6cc>o G^hy46 92:Z7՘ &{Ғ8o]* A/%fOTtXVoe婌uv-^cjMgZ%u^O &Zm3k~j,zi f<].'^|g:~4Zؓl+T64$i/hVVZh=/`:Oav*2,U݃=`EzXUSHMD;vWv2[3m_#"VWsE94^D:L*;eu7 ZQ򹋀lV&KuUXy,5s; jh(v]<ة)hϡeEL5~1C4'k#pcXTLp=swu΄RiP9MUV6!!oIdL!{B3dT[ي ̣ u`IWZeK vLU'ēux7OYvEX7 D5 Wf\ 1"HhsUsO>N9j!)/LE"|qM5jbXVeԫᮜXO6CL1bP4 "՜:lqxM3/X >yA4*eG#Kxl;zb?̓hc#mpuK1 $<~|媲(Eg0A;%]H*H QL2FgҷQ#{Dx8zfv;1KmxDW0ϩ0{LliN(@tfչe3{HSe@';ϑ ^aAvNOh 7 v-=dI!sbB?&{>1ܩ BA<6WOϓ 6"ljqg%u1.jĕQ?xfj ƿG=lo˝4(ltqBԤ#O/e'M:)TTbJ[.siU-QҝxHFNȾB(nխWP3M|IFyhu8~5sfެ8~P%0BTg$YTaTP1FzmX;{ Ljge0#w00q vy!EI@$jys`@QIr9>De19  %DKG}`]W{ ֪8Y[T4KWSPÛ|oeh+W+?@s6>f=PipI4]mM*jɘ's~ nEDhgl-98,&do7, qVj(n`u*.W1}8GNIh9Lۯ?1Y~aitwȫ~pZTTaBowps`4"X4 V&e9[\06]Yڷb)qҁ1ߛP ޏ it%LXg)ͷg]jY9p+ ֗_'{% fjCt->W_!oqsKۂ>w~nk8 r)ˆ<υCP0']g ss$\XgUpmm|.\ WB{U\m8ş!e,a0CՎNPJ1,/fGdgţ}d.G:>׈W]W[OBYD¨QP8g"@4w9K%=41]H r(^իWh6)2+r&JPԹ#VFaQأs3Z%0sazYچFqg TIQ>գ+0*ƀ3(Aq>hdXՇ.{02Ӵ9oUg`s̊ ^?[:#崳B5R5ky# d2&32:ӱH/ ^ͅ3{LhQL7?E;~sl0 }+r!/|N\H.O]C 8E؞]pmEg_~UjJR +C;EUH m%qI';_uv-(|L:f #Q \USլJKا3i˽e=Ծ6*qP`59<'<ơS9y{2j0kxyFSXy֦cxb9'z/$+1b_R$x/p_;| "00^6c{!C.|c xA^ _+h ^K}Y(5$mmٷ,\^-g>k۳<\ۭ'ɻ0/) :$P20!Rf n>lA!x߭[YhUDv6'W#rk?~-2"(Z ȍ՜ƄRL_-$j flR #JѳUIB&Ϣ~e*EՀ]f lFW[kI .xGo'h:Jv8wx ;%~ 1 1(0 @fH]T``2Duk`VEaL/zhC4`Ӓo9>:v♯/55`{= ԍ,<.@G'ýe sj:@/#Xa^3Gx(!تeG_Vjh%_uFgկq8߄6,ZSA9q("AP)%`Pk@)S\Y e%'rYr9ѣծzFb1a{]0w4ht^/Ce7q;ē7)rpSQ >!1@r_W>5]f1r_Z]\g+yي1[((&2:)A%mebr=!|L! lt Ɵu7b,A?>o[,/m2Um1G\m)qqIMfaIhŞhu9'ju:rc(܍k?V}L|:w=!_5poz޷]M,4n 1>NBP8irU4h=n[ S>Xǯ|2 J/9;!4׻y;JJv r M|A7*%'%Ԍh۳5~MO0.Wub\4?J!})#,&.(6CI tU iVyNm(dJV ]jd_MC1pgF*W.=:ni߳xRd`raһZo utQPk yLݝۮ|IYb.`oWaNc5xOA=44 BܶSFۤm2NS[xȾQ40%KGKґUJ6K\L,zA\pS;,U*q1=Ջ^*ee&[-L 7j2\7,ݙ_uyu}~Ỷ6NFwfr\e5yfWf=Y7%95k-ٴmV]h5yfhYJVw,qDP&â8yܫc40u1L?BDp Y.I9N\!?/pRZ{ɭf5_I;&ﱆVotyor9$Lo`9m6hQ"X`%ų3XUĆ B)u:\;^_OfAñUAXvp/~ne6c,"Wr7~sKጎ&exЧvܡ0N[ltwvi[_]M3sJj֓kv9Ki}C2";~;3爟.,ubGMx Ţ;NaLm-郝=]: e 8xeR&Չǩ#_p|L]ON0uO yTJ:Pfm"uъϘjWwame]8@J4&~}!%$u;7Ţ,ZrKkmBO 6h7q!'u`=/`1 -c7h5ty^P5 dye!R3[FJPnVJt1EL6YMW=1 SMၝcwrӣ;si t=ֺMvE[:Ozm-k6/8;Fm׬lή].]/_4T9xBS=>1!VSÈi}X+V{ԞDc4YlPxY4)W<)ߪ셟rhi]r&CI--T eyqfUQҿ,U'\OxeM\ݛiN[Qr}eu滇}U_ރGv m~w#J!"yK1o8o8MgLMۆ{MՁ ;$+ٝx`tEVih C-8qK<0VÕ+[ |Pjq_T/PZ~~Tb( *aN`r o%َN¡jWa7 r|xvÝ+Y(zaƽ Lם` q Q.SRt9B, WF US$7iC_JM2J6Wɯue}sxZ$?>X Mkq|^soGkn2o+2IŁEEi"7dEdҳz"{F dOmoZQ*(BVfno,n`?7*aIz8S?ޟQ,A5K}5%vEoKNp]:NOҚ9P)̅N%΁yzx;\g.IjK(agIh5 %P! t [,$t{pcNL: '{?g(>[ èsXLj_SQ$p7AI:0 B'!՚σIFW-\ _M.΃Gw4XPTR骮mmñ ˚VDh҄N(ڽ=O;I-`fٺymީMH<3~'Bۡf|b4֍=zy`du /6A[iSl3`"2>"W|۳@N(ϖSN*y@'D N@'2z$26/bQ X/>ԕ@a k/Tk 0rF5p ,Knoeic~k5v_n>aFj5"5&;կm!sm&46pDM>l9IY"qD?15,S7j!%O>#pO7Ʋuudw;o@wA64]z@7;"Pb"-.$C& 64 àDY7訍jJ7 k0lhM+']K>/Z9GkikѭFJnEӞY:DF!SSTMd,"(XNǸ5>8U8 Q5V}kgv솸qӎ*Oǖ&筇ܲ*V5r퀄G׬qWf͒V'969)v6i!c;29# xAYU6Q^U +!deCvzB5![:1 *?kE5ypݎVS_jB?i]om&%ӹu(8oF-w,՝N"m~=W[82'Ȝ#5GjW#ߪ;#S?$>Z_߾Z߀o9݇ouG5006[K{-zZJuR3`[4zſqzIh{hLN^n\wv#oUȕtԊQl"ֈ*`\`1P}9JJKB.]}eP+߮ѫ)?l_Q3Fb5K%:|vxfٍ#aKOJ BlT־{UPmz,pZǫ9]_ݷ.q˿D'o,p a`( 4 eq!Bskz,4u*jk_po A|VH/{UQDt]3vdZ}(g z %ꈙ)Y'5%v&BjZVϩYMm[ߜZ T3|8%c 7; fNIOXCКxWusDʢ 6B|44t"6U`?'9 onHwwP:g9ԟӘ*~/~Lrmɨ ]:fw3CG|w ZVŇ%|X; Wo4U\.Z #L{[XUS2quݷYB^'gY,?KLRF]oC,[~hu4[Q# v0nA&'8m*ĽVYO@ck濈pMo:j^W_ ZLe,%΂]_$'Q|V`ۚphz/G:ݻR8E+hwj./ϵW4|j|!wE)XxmΝ_5y[o'o\3,g6d:ZE׏hWx:>wht7h6:4,y̡ 5!㦍ˠ|At#}2kvywy^Pԓ`3U~CCl | [6(E/` Vxߪy\Q+nh)Qd 7ٽ;Ϋ!lnO8 k[ 0GGZ)g6zF]bar9uieMm+3zLcCW]7o6lzHUW\6sU2ڪ3""/J(ub GpG=qG3T?Zc-ȅX;5mlZP.Ӥ2P7 =[׹{qn(Hor45'nٷ"8fޢyun.57s6.=#^oâf5 :=OS J]~"KB':v-i nUoZP\fs { #]s`]߽sb;ZѦsİ*N9x31Z)<,Y~W;#*KI%Cd?C/xJ4Ppo&E0r9k3'rN#o`˄@LŦᖍHCYRzhcSkJ$zv̏o++/Xsc=Ժ&V^3: v"~Cj}q/> V*5yd5tvAg 8ͅClA-[hUidjK֫^^_x({ڦvH=Pu5DWs*E0nοI\zQ5^/ʻץc١5UG;^fl>֗]e]֐O&voqnlK w5YMu- e&lGMxkJ[嘸U^ʡԒʭe#)+H@r+x4l>SJ~ٮ5 ]w(+شJ90FУ_>xnok,;o7ĒI\+ETWUDT1Gm^lOx|]קZ& PkЮruDsfnY}\sKҨu\=9 i$Q`_ip%R2qGc w˸1&AzeG%S=d: WQlwI;&j(c5x 9Zg7j6+n@K?qoأ bι5aajn,|'( "juP/FF830L5MN]JA<dߎpS˘ĨDRR>g}8z2,̊V8 JMP Oʊ;{zt?iRQ^ FT]NՋ(Is[N/-z+GIOr6p׈_R@x/`ϴXM_!">)?jDA8b!v6 :LxmJԮ.)(]Ee-(in#wA _iX_ d,F0֒WMĸ$FX%j ®ʈow>s'7G;9^X#MG˦ڥM!_w]Ǯ^3ŽOz׶[ кư/| xg>3@KFe/ VX ;0$Z,,q%%λ$аD[[0 ^THx<ڔ{G4,ڗJDlg#g"5bQȷ w$ ѥ$ A ]( ! pD lG.,Ymu-3nI'JgÒG!8}^K{*s4 ̆D $P(IܒHnI 4.LZ0P@|'DC7e\9]|*MYt'Ej5L׷Fiki0hPHĩ+MRc%Md{}6F)'TCOa31 )કnNbs!Zʭ(TJ ),Z8α%$% eZPzDZj _m `^QAMoA@EC#O"V j+|`pqR]R=Bl7=aC%?!2":R=Xt d"9"L_I{+x[ ])$ %Jl7$:w ~Hjw_,Iw2'aҢx!$Ds4cf" -)r({J*EwCh]4ݩRDʎkGⵋ Ύ9HXH;JrbP"9VB7)3cOIHƠۓe?Nnx|vfF[%--=s೔wR>y4CEns%kIK\+rWq\S|'J5WqhP =mI"Ф=Ѹ0jH) n6 "kنΆ 4L㑂&\.yOU+$.yĔ*T32&eU*8?^Fn)Qj| wmm`8ApZ  ,Ju&6߽Lv3O_r Qg/*GCIw-ȥ;-U+; ?I+tYBޡ;W1ҝ|:oTu7jN;sX >]+Y $#HwV;-#TO~1Dd:.2C@^{ʸB?s48r㲥at >`W:D{$^}p.塵nyhm`xf A&17x6k)uF^.dB"CFQ sάM˕$J9wH&w9BԊ,&Uɨ;j48t*t㲇Ll 䒙|JSbP\VM5yB!RȔA U ݡf:g,R2 Zy85u9U05EQoҭD&8+a (aAuvj y`4U?wx:IC/HGgglE,xC |edpOg?B~-ZERmS;ѭw,^'p;lt@"ZL.6fIַy~ ;9+hXO6J85 :ƨNٰjط།a,4ϜM&:> 44H?]UEz^k|cS1 ua.EcjcKv*GzprH[(̾v\:6ZոҁC˭ 6>4O*T*׫IBoY}MWku pk 2g:8N,8]PBGkW"!|A(dşb +ޣVMAB2^(TjiQA? ĪFl,q |@[_(49p`SDR ul ШMikq526/ lZŸ <[7=KǞjYwʿ׬ 63D]|8^8,Ɏ/<bՉrpAGut2.GCY@ ™2>!| OcL/W_gzI>"|gs>r^ƈJ~*gzhw#sCЈ3* DkV.4Q-:xY;$yӴe<FE RJ^,ɭ neU^Tel{QlRPT6‘xgk$IhJuϼjw2[^~bؿqoGxl@<jp;XLH7[jVճJܛ/ *?u7uhHYC>tSn`kV֌!N"\qBH ʸh*^%x%kL PW׀*7h(~ˡͰ%8^߿Vt03K8 0͙{#pE+ѩ&ONwݜ;ݜ5TT+S7ܰ*]}}OzvqmѰJ)9>4;iG >DDiE[4fyRfs!HN(u|z`3Ctp߶BUKIQJc>L =:#ju` Vi\Xze*K=w@{a_!ń$@K!`@62GDžqF\FqGQ  **` *_$Dsow:ߟ3>}xN[Ntv%ŷTq}6Dᡮ;!&k2}Wcėؖ( :t-D(T.ZljK ^K{] SV΍HKDO c.$9sPsć$OȈsw)oAZC("L0SG3_ CЃ ,>Worm, žsr׃]{No"&Yn)ʂsn /\a txp6&$$k$_98v9:zwx|Ux Jx67oKIc1Ouk5ߔwxcKǏ-uGe&fō7n9x(3g!9=㜡ΔA)Ic<>a`|TFn>iΐ^ )\S'$>SX"c: Ou\qIaю `*p>/Ed}ll$,R7pWܒF!t˅. f."ٝ4vN>6< ] bPtʘљ'!8N7u]pj:1~+,"a>k^6ljPwFl\{lV,3$6 on6 %ROoc)OD7# Hq)'Oc,RzJ JP8=' "**uGd\ddM2fE2&QR+SYߟEl#q`f3ZŠn(J/-SSh|dDB(vh)ЄVf9E),.< i8 W}oDi;w{Ň _E\P|S|Aۘ+>cu> ;1lxލ&|F1*|*m"Ma> |m]oa5Zc_0<,aX6gjt'ؔA\7嗥:R"H8='_?[vbEQ>VCqV dq,c޵EYn];[ҎuA;2OxKhwnw#PaKB䄔fGxCܕ)O ݾW^ .:M?#0HL t;5dޒ |]q & :o"~& N /r9/c=vp[C lkN7wh}/c0g2O~ㄞ?$Jx;9GqR6"xGYڬIFLNc=j1E٢ k`|{J/zdR%*t\8C,#J :`h)$b0XŦ%Щ l$6v)>Gok$s,e[N#U1So/R?;:1*5m)WYz{F%X x"?I b"$\"rWm>>2r페0K4%8` F*Y6ڑ1'6c/u; :_"gέµavɑI7 Rܱ1dWea)'KxGcjn=%b1)Xo.W(<#"2\IV XD3C- N(|Cj?U̲(F{,e`U<~{,K0Y(E_>Ʀ5( hhȚb}j)C…MP|8.$6G9GJhKX0;OlvE1cEoи$Y?C_'k̩wl7E8}tًo0VI{殈9#óf\>0R.뇿ƵA OeF. hU*gY=܃CYh4m|e ^L2,OhkzN?JXt\֘IcL?-mPJ|~TɄ^^!;Ҳ9ȥt9P6Mݞ9 dwP>߹3G7P:CݡC[C ѣSۤ(N=`|QS":>g}iBE9Ʃ>lhJeK43y;D\moqI)e޽Fgzd%5* tJҾPkg>/Ba ]݄g.THLw{PtB Ͼ1 bOڸ|M;0.nbڮ so2XIb{ȣ?^ࣂ7VN쓿lҘi}0iF6ƆGcqzN]:Y8W98mvXwR_e`VƬTt8:`ao+~eP C* QV^-a I8+ !11 y7IwF+(>$'Bxl-b1 Xl+kQ6+w|o9$Ӂp&B_c @)<7 ?s1LEy1.fI]bezK-JU9k6H֥bqLp旐X$.aH],HvEL [$*% .]J1|uZMܗ''f'%uXK/~Ts'=\IZvq.>M/ >/ܜ1( 5C ɡ.nr( _K$d%t9> eТCB]$^]2_! /]M>=gFU90z䧣̣6|t{ s:3DZǾ1.?!?&f3'|˯xW>}YY箚rգW=}նّc?']}*۹W}kIk'^{~ޟbkqxWW_5wοO6ߛ_ *Y^\ZVT6ٲX~$ޅ-RMYg룯_x?[?_-M/$eI%T-Yn/ٴ%O/ٶc*T\^qoC$_&o&d _ _UB/\6eVW^zru{7M~7M~7M~a" acld~݋t tRzzZ}ګ>daA=[,=٠PO(ՓХ^j+h5Z. I:$y7n Ľp,R71{B. ],, W2~p_C{ת' yކtģNx<1Y A+!^]D:]m I:$yWS:қ: :wcwA]i4ji4 V}Vmcimh4* VNmi#O#]~s?Y/]M z/w^`{ݨ-lȁ=Cr'_@{і*ʁUбМptL٤'#5^MeHoA) w@Va936 8K:Otz="utګFo3Hg&=ti~Q6V6 "7.EXC'עT>wBTJP*U@ T*RTj6JyKяOg#l6zdBک#@c2Hg&=tՔt=-l\zNU.VH>\OAq]?/Y!'9Z=]GA=SVg,lZt)sjSim,9 #žн7&U)$+W\;бR6 ?o!jZGzl$].~_!ݠ>S}I}zLJ9rUgZ1[D1pbH yFh'3FVH;cէMC kH/'vV]\oay5ŏ_!xUB+Z2utztF6?G6sG4 /;Bډ兵; w5zZ/)I/ǯn{a kӡ-l-,lki^X . Udkaa;B o#Ы1kkw#]>DĖ33IgD:&4ީ~D)ՃB5(TB5(TB5(TB5(TB5(TB53IgD:tI= @;I7@=ꗂVH&]| A:t6IHoR۠yT"?[zzRHG i'8LB'AS ҙIO"G@m^#]n`vY:9j-t6Z%dIYAd%dIYAd%dIYAd%dIYAd%dIYAd%dIYRKB+бXrCF.\o5X4t9"ÆONu/tt:jU:(Uڡ_T hvl!jȆl!jȆl!jȆTra9հjXN5,S ˩Tra9հgwMHoރ~Y [:SGy(O婣SOЈc{0r7¯Nұ( ^ ۸ޤ~!lw (uZ!K5+t"tXހ5 יIO"G#]>2@70NһI5b9*Ca',Z!wHH:#q',:t6IHPNnNd'_Bo3Nd',1A=#;a |`I Bک~NT߁^Q߄?7~#􋰹 5!F GNw7j: F[,3IgD:tZMH1XMmMmM~ڲmvRJ,Zp_:t6IH=#]ڃ `xNޭ~&C oVk,x~efSB"UtRu!"3e=^R;3Hg&=tIݠnީ04܅h+xlxI:tģ%uIR{gձcY:QJY5B :jT.xY OMlee /+[yYv@*>kCg$Mz< gBր ڥ])a6$-yt\ݮY>>/u.[y:tu#>~(tU''fY> \X6tɏm<jXpŽxEzθ5(]ײTՋK{nq)ݓߥ2ں)5H/URNV{vJ_y SHKe )'*u++ ߱ڢg[i)pܪ%[{錷3.nBoRv>8EZ*z13{նjXA<=71ed?o/U ]#k7 Fqg+ڽhCTL>R%XRL/I_x W}l=K,%OwY?7{ u 枫xLCNFRo]J{!hG $4/S?W.$+Q rPv՟GŁ6h^z,WӸJ | Qzeԇ󩬟 l=F/[tE?IטUBcRy` qXR^I"ȯ*giu#vڈLG)St)*.sU?*%Kŗ&5"-ZU]J1bW/T㹸ڈ_kUq y^ ,[S,Qk\td ZϤdOf )ZZt=niUҪbgiE{Ly{g"o{fYuYqU]^]]\Qu% H2; c̅ue ^wq?,,Å1EX.Vct:^^:Z^Oחu?xvidfKi+K`hT%MVJLit x>z;x>^;kx^V)mR?;:ҏrx^5>^ux=^6JP/9MRGxE&4Hҕ^_[=ux}Vw׷k x= ^ owl1ytR* oJz;x^wAzK?Dy94;xM5.+I^, D5.&Nʿ3[+YǁWWq!x?'x=^JP#E ˥jiP'M6Hu1x]^o׿חxA#;EEN=Yj2Z\Tޗv dpk/uZӝNSs^qhʞMNw VStk1XnM< 2Q>_If&9+5h/Uj䣦E4FERMh|H6奷7EWnzĨh$Z-hא-nؼYY.]"pR:Cb84lYYp*=pJv.9vANݧ2p՚e܆\YӀAv0Nˣ#:Kf`= ݡV9{|^-`13i@oj4QtdwK le0宑m3gmh`a 6E_16v n/*}mQxcXӹ|k 85q5k'II-0SYh$f~Q L1iff6XS?%2߱aVp35>mwuP-<'/wg]^䪻i:^K:lkGrOb6 fG{Æ[nr_cs&jT=5%p3:[E& Yafө&S!xcgfbf`hpxb Xxg|YPl !z~x$bK)nqG=X1|ENa dQuT~3b}|\Bz.bAzKPV[Vq3wf-EjE4g72Q‡C ʆxT: vIA1M)@{ᒁsOabNjx=S$tw~:|)ɓן3CĤׂhyW-Xe-j8GEXik'83 tŔ-4'),&q3f?{r>$EqG]7ݤT*}SUuYPPnŷhJy|,X_cHh7 vk߹e;o{$ [WG⣽{Ǣ0)}viQ8ocۿ"AZ}<iAH* 'V:+aH]/H5|l\սc$mh*֠wbQW7/#o9͛ 3XIEA\! ֠x%u$~+6 I IVHRH"GeΪA܁_%ܹG\Dʠ9hȔomWRGfln,mJPO3:חkU>>)J9X,8Vjqrp@uNg5 Vk+2,KWKbtԠɪ%Y5ڜ9~rd>cbTg46C!} u4YI5azPt'Z,Z\# ChkwUa֠漠]b;/ϗL-Auh&\ 7PSxpnSE|i׸#-]>_8\xW p쮈]V]Py]6(K%8lFFQ6AdL74 =oz#ڕ=ϧ?9)3&$cnnִlUZtgbyCg?`:DI*7hƂBI,8:fSD yd $ʠh" 6 s\8rS!C[W<)xh(X">^N:]_瀮sDQİcu* ]ׂH[&?^S]Lt 2ڻ"`7"v|adY`G27W԰#B\SSS㹦]v5*}E!Hlfd|;} A]NFcήN-OUju֋5T6$bWj l"|[{WӞ=ͭ{v񛙂2ty8p|k޾oM۳qllt {!{ M7v5lY=-)KQò$bBC~))ѩ9=ǚ.&Ə>b)gACxѸfb6z]L׫7Qj--D44dc{֭mkXƮfSTHO&%PH0VWOgfӮ r\9 ]:gs3Dtg]A $A4M8|Yh"gmpF}KU0Nw7מëVN{0H dBե 0شx覈MN,ٵRª&#LFû9F61`, dl"F(Ͻw*=7OH$vNHdKFs+:u*F"v;ykZ`ఙ?Z:@d7y,%Y&*g bon"θ͜Wf}W4*,Eg.Ldf}KK8,DHS &3gLw+g湱 #3,_10;d k(XTRY]^#HOz郤/.`I$=ҝ\ 2i i'*EQg^@z%;I?dK_'D}HF8oߞuZ Kē?uJѷ'=~:{(`{#_Ԙ8}I, ߪ# G s㻟fu?<-ydw?bF&L*~>m -!鬀ԁ,?a?Ibdoظ^,WX[n[6m86gq~ZF!:LG⿘k_$'t{ 9H H:d8dqlF{<O*8zn{bFve3̹6k 6//d["he/[reݷe/-k\QUe﫶T}_ͪê'Wϯ~wwj׼^sfqy? o6vbmQmUC6HYq͊V4imecW|be}nؾ*wU6]]Mϭ]hkNvs_U/]G.q>E 0^8⺏/u'H_S%Z\1)^უZ5);mhGb&򆶧tN%D\)GT)A~ ޗ_"?>$N\0+fGE/=N<ՃҎ8~ [Bl~DLDVEsM%8u(jZAԙྠz8W/zn"oҢ4q)dt ~c9+0UHJ>Qn@7sx^b1XKGgRn ͚4s {͎{1o=ݝ? k<>gs ~<%|OəpDl&hTymϰZ}']>IM{L+H4;3@ c JAg8mv?S4>|_-B_jWʅ%H..A^O.lݯgvq<:85e9A!#_YүA&-~~ąVGshePZi}YO_`C3||CgO uFKW:9~-ѺVJI.:+?~ [j|JGZUzyiXs˽#XYt+Evh:1#YwF"]0wrK򣓴@|_bڕʞQϱFP…b6Sb,Pa1)mp 'q| hU?2TcobC^~h\TK+rW76<2pP$%V2 Xpw3x?| gph*J2%a`Ii^~  oKۮ͇MoU|[-ߖn+>!}?;$8|6K640*AOFQ?;;}g|Y껊9Pir8QK/RZ%?{¢&@mP?Q?QGp zC=QgQ?@](*QrXuòQQ {GO:PzP0:@|7YFtr<" ,Փlp p+plQ;ػ=}`/!14* 8 _/cj  gDq'gp-zR`@Q vzZ"zR@ pZ퐿NNV;{ [N@U5*j2 Wʕx\`pzR)qmޫ/oj8_wonmA xG#Q?gp7 >RGJ*>RGa9G7jr$pJݫ| ƵV=p;gq>2@Kdw$v'|w|^gSq6^(}2v6lg3[-xf <lAixZ<OǴc1v܏"] R10T~i״kZ5-xM ^i״kZ5-vd;z؂^lAϵZk-vT;z҂h`wVOՓ`vb Xl-4b2\H6ak?,ن=~!~WA}G0f0f0f0f0f0aØ=1{ c,aqzs#KYT]}s0%cK-Z21mɘz` ??oa ?o/_2d{ToALFJj)gZ r5cƼS](~\ewT݇rW3>f#~܇Si}}I G~G vZ#{@ˁ̂k7 n,f2ߩ4}BzT 2@? d `00 ˀ  F`,0L&`*L `G!fQ1q/)iYs߀灭6`;"Vk xߩv@www{XAieW~+&`76.xO/|7G @$D. F=j x?ǍOO[ Xm^ucoqzTI$ $ J/ ]= |AA+q>FǕTODId0fX`@^S&ۄvnmBM@~7~7%)@* q 2ui80iD`p\[|p=Pk5Z܅ǐIߢ4=֦5 jWszH;`G;8PB; H @ Dр |$ $)@*  )7;|@0 C0~0#Qh  D>LӀ@>0_fjsX :V6`= ڙn=?GGǀǁO-S3_ZV l/}.xi  \Ef|x!9B/ }(#Ɉx2"'#Ɉx2"'#Ɉx2"'?g[mvE`zJ; *u@x41>BH \@ 7SO}8~@ $E͸kو(my`mx{ _FqUN#ڻx߃fƳvHD=K l+3$6bum< ňg#Y?g6m;~8SJBzVb8 H`%H@)t70i>,`vբ.Df5I #IϿn,vN f1EQ@4bX ` v` v zLxF 2qix0Àl2c80 E`l"Q6F(E`l"Q6F(E`l"Q6F(E`l"Q6F>`#l䃍|6FS gbZ|7Z-C נ7p~ps<0\oDF?@hqv`qv` '^7 ](P7,>u3֪ZoTOXW5Z7[[F+bъhEl"6ZVF+bqъhE\".ZVE+ X+b'6c>:Lٙ,5ޤzSOQ)w$x9uzOv l-v {sbU̽W1*^ܫ{sbU̽W1*^ܫ{sbU̽W1*^ܫ{sbU̽W1*^ܫnagvrV#dE\z ҨGH9֏XX՞GB2UTV*SYe*Le2UTV*SYe*Le2UTV*SYe*Le2UTV*SYe*Le2UJRJdR': ^,`PJd%OfZ;OfX$i[V"n%[ɪRXU JaU)*UVªRXU JaU)*UVªRXU JaU)*UVªRXU JaU)*UVªR];X2f/7tՊ5't֓z҅C.uܮ>^$m I;gk'ePx%NE(1<)ԧW}_ED:uoA't]qm` x< 0 p0< FQ]O-3We!k٦.KU*=q> 죬r$+38xRRs sW50Y.d} ٯxL 4@sHA 6phá 6phϗ " \ .27p9;:` x< 0 p0< FQrќ-e9@Oj?B )Đ@-p4l+SMjXrSM&Ta0Dj؏~ c`?1؏~ c`?1؏~ c`?1؏~-~-~-~-媉rDj\5Q(WM&Un vc`71؍n vc`71؍n vc`71ln8b2AM`;`T 48NCӋh:_q, 4?G(ECrHCr ؀l6`K?~@FY( !4dҐQ2JCFi( !4dҐQ2JCFi( !4dҐQ2JCFi( !4dҐQ2JCFi(#|dQ>2GFXH b!Q,$D(BXH b!Q,$D(B8 !4dӐq2NCi8 g!,dq2BY8 g!,dq2BY8 g!,dq2`,@;wHɅ$g#9HFH/x),BEH !$X,E9H1)Fb)Fb)Fb) X bR,@H) X bR,@H) X bR,@H) %)HFJ6Rld#%)HFJ6Rld#(R"(R"(R"(R"rRRAJ9H)) rRRAJ9H)) rRRAJ9H)GRkRD H T#n*r-r-rحjحjحjحjحjحjحjحjحjحjحjحjحr)r)r)r)' XxS_`/ wOS: 8Ї6A_ \u32(V "XA+x?@UƯk{(BEȣy!"Qn=llk0'X&ȡ@Ĵ^X5qgMx2F.C ɝg`>R9^Ȗ5YkC M v%2 jdn QځV P9_+ $wSLi+⬆S V7j j=nn՝V7f5lVfLVdLV.X*X a! `C`0 %0X%00 aK`p^ U^̕XUXLUTLTLUTLUTLUTLUTLm3* q.`* aeEEφr}ZIK^irfȗ5K>giYܯCS奰6 ]$h%n~r%V-Q{Bnfc #0B1c=bK`KR~ľϮNܽ;m̭!Y2ȝk;w}-c+KUpgO[+Y.ѬЬ`%wFdYlmh6c ؊flE+;ъhN4"FЈM 14aۆv"5&`#.+e-nQYM_AߒS!tdpGdKegLL@͌:֏cS|%=;a&j!&$LT&*ՐChRE{| Qާ%!֠ &hAC;9NAz%w`6g`{[ ^> W°aB2LKab<۵] ۵-|/kaaƒODsb9ZgV 6s-VȓCB9+=A<89G2/0 Lorhc#g7g7g7R?KߍwcջEȲྌ |T9>U+Y{%kdeu2Z)ǿ[-rR\+g_Q(W|8 A"WեH4 |+Wˈ 9-Sr>n0u\A66-5mȧml @!(ЖT5EJڠTQ@9`os!,&|jk`\6Da_:aO㚟}KtYS@s$ ˉOk=:+@7|^wCޮxI")R!qh˗shs.|B;9V3 Erb/`7ſ1)2BU'V?adVRԡ%Вqh8kןςEd^i&IOSg*o!Z`|zO >c T^U]FCǑ@]%>s#wn<_'(cw` ڹX*,k,6WaKuX_;XKXr,+y+Yעߠo*Ư_}L>!bUBq{-\J\ %̶赀5/O3e:1Buⳃ d_)SfY,?>K`k')xQǫǫ6Kfkfkf OOObIxDo)At=]^B/gbt-]CЭbtCЫeĢ :ȱ~ydKу4- Lo#:d 77?j.fj:%{ ̮Soٕ0؁nlCGex0=)YLt#^4\G#f6XxL<`&0 zxL<]&- x^,/ 666x0)w NxtFR{tQoC:+,,J$o o ϰ ϰ ϰ Ie $W؂؄2T I3L,>3L,>kOX{kcX{k߄3MX&|Vɫϒl̩Ģ&cQX.>rMEXK#9t2EİxY<Đh| -OF'#ZC']5ͻj\U>Z ] ? ?h.yQ*A{chd4wkNe˗V̽J~nnXN XY1++fee*?ae,dv.dvj'3ɌQ13*f6;NfSlM:pjbљi##0R#Sf0Z%e0ZU1Ze0ZeE\T0j\T0r#0r#EW1z0zg0SP#l_kXFdMx x\>*5T$;Li73]r+Sչ^6ϟ2RU}7Er#|ga+u1.ft+upaj](Jt%dK6ْMd3/UETL<]+dF6G##[PG:ߎtbbM1M1M1M1L1L1L,fN_QQQM |;1ƈ;mh?n\ oq#sH3Hl2 Ka,Z8+Kx!dZ++ mM.k k0 S;'L*Fra$6ra#6ra#6ra#&ra"ra!ra!WcYfָ5 k\ױud֭c=*#dֲuekYG&aX:ֱ5lf X:ְ-n],)>p?"+b4x $1 _N@.9AԂ:Pv 2C9NSitp8sy|p3\z%R\.W+Ujp oʷK;=XrVR}|E9^ ֪7)'x)r,C!m@[+_DiS+Ɖ0@N1`|/3 Ԡ1{ʥy"8?[d6p`N@.[A@ff|یRUr\-'xUՀ<d^2Eo?@4MA3-yr|p}lg/U2#Z!Zբ%V ǃ$p2\׀k?uzpih44w*a`8ly6<m6֟%2&W5:xL3mԧy6՞M`3ζD^8[6 `m@[`189l/`7p44g3 ͙As`hl7!^`"x|fG` jdLAB _'''(vJPA %''''E2C/DՉnRPAb+s_r.6ؾغnmN9|`3{3Ȅ#L8žﲝv.Lx0lm>6[~~4w((Jv7W9U袹_H??g\4$q#G0t?:G0JD@"'Si x</BI,rDG!בl$:Fl]2&#dT7e2Lomx{} >'S0g`>H,tT=C$g.տ!:qj9@} ٮnCۮb;T҆L-CxL#͢*_/|Zm#)'h:B*p0< FQ`4x $1`,!//kES},l!A66Dۓd|hOs֏ >hh@Ohnh2Z8Q4Nb{H§ 4eoK(.SdYfG t]9KҒxI kJ6?f?[A@簜ױױXlD$6(}%?,(٬M2 $֠ h ځ`^e^ @wK_}} 1`JPdf9w+H|cvn|؍a7>x ^7D0 LS`*wL0K4d0p[c~ۏ}yyyyy9999Z'MK9{iYx3'&s%`o9D L&da20@ L&ZZ D"d2@L B&! D"dd_d_d_E?<!0G:::::ooooooÛ>oÛ>oÛc6|x޶_kmM6&_kmMփփփE!l(DA A)(BN³g>}DN"ӇC!r9}>DN"ӇC!r9}>DN"ӇC!r9}>DN"ӇC!r9}>DN"ӇC?Dr'ޔA"QH$DA"QH$DA"QH$DA"QH$DA"QH$DA"QH$DA"QZ"Zb j%K%PKRKRKRKRK*? V5GbQRw~G_^.ͮ!]FdTj@%]HdOd֟Z|6D~-ii-o |&u:њ(!iH!uwd;Id0 i`:x ̐RRR>(#>(#>(#3mL<&ϴ3mL<&ϴ3mL<&ϴ3mJFjPb`u`DDDD y0_/D QBT a0UB*!L&m*0BHޗHÜ<̉ޛnQ5= Ki(@E"LE-"Eeht\{|-UF̠7eut%UG 7ESy)y30ܬ/b,ik |Z9O_ @la 6rN.44h%Ng?l\/D0ci>1Xz c<0/B/ nb'3`5Xփ rZ!A *A&)h6rAp6<8^3;2m=^n,=5Zor<ɜSǠNnLrsBsWvtپ{e A`(}ػ{a>݇^/``Wku&` xLt`;]0̒WȰJp\ׁ+c c`x'Si x</Ke0L 0Lu$A~++#Z8\/T1<Ka0s٦~mg٦~mg٦~mg٦~mg٦~mg٦~mg٦~mg٦~mg٦~mg٦~mg+\sRFYԬQj(udԝ;QwSg":ڪȭDQlFt&^^J 7n*5\.J Oa0Sɦflj&ɦfRMNJM2b*5M6Q$6Ovgar0p8Lk6Mk6Mk6Mk6MkQ(Mi&ߴ7 r29drudYdceQ Qn I3q~*T'u8m8O[,оgi߈6xm1\DmB 3=̡yNgI א/Ԋe]YɌcZŢ ~hw)[J?OuQ"949hYKop%g;ptL5m{0lTֈ^0kXWnPq>N|MJ~5 j9Z)%<&~`hˆ7Vڭxwi1y7L}( F1 ƀ|/j^콨{Q&E݋ڻv/_n+i3خ}$fvk 'RZZ- M̝VZ&ntmW2O(&sF=d3u,9Ttag|w@n;h7{E2Fr(.W /wip hDZڴ(I"/J% ța$G:(Rot ",O'#Ծy,r~ORL,Y)Z7@6L|,gvFZ1vw-g\?9qBo-CUJzL*걳9peh˝ jsipX:"_Ml`] @=؍wfyv;qv7{y 3ЋOßa<weVNwG \"UNm\G[oRi!f nwI`x+,\%jRf5bf']$ݎu;z}P Z;mю;qG;1歕u;Ɲܻ%nCd{ax{YJX}d N0 tZ%a9S_FeqBL{D@x I9LamCh6,]-~n-ޚ1:W_Ly l^Nb襆^K^z?"W_c~u̯ՉSDqFb4x $17#6e?<0|>>0=]=JHš~"Bl q˙My|t|BgL\ee[DoDp 2YUFaXO#0㭒⭒M3'r1{jj\jj\tm@RΔ'ȋu@븻߰[=0e%-W2oəL{m`e̢l ʢle/Ҁ@Z̢.uZf6YϨ T8{=ճ*numP襔^EC;!.YÉO CwwljXgn4RZ'q5h#:1,NOe~*w]Wrz\z[Nx8wof U׺sn&V^snCXK{߁::zgwq\ι\Y@67A94NYvd͝hә6]GnN9rym#Xy$2?\n㸻`9$2#koq{;JVEӣ ֆ_~np5jXUp z9Yѱ$ʕQG7W?An(ƓލWZm(ūUo}պ= xԻFjW x^ ^|=FNaD m` :VzJ;Ӯ m8FA;Irzi^$M$NV'rd{M-HS\-.S/(f{/rvȿ"2i;7Z-w[9i{vѼG*|9.Tɧ!Χ&=I\Jq8C$[,/+#X$8W*^*BN^i/*S:*j\ [..a+(}D2@yHT)E&?iW⧃QFYtVOWTNSRUTWWQ/R{)Q{+穗)W*VVV.VSW.QoRoVz)SRR.W)W}+~CU#p3ʿԗxu2@NQϔj\yR]W&!5_@-Vw(jZ|V5W.NIS&o5UӔ5S (˵Z g-QKT2$uՎSkݵJH;^;Q kNQ6ki)9ڙJvv]hj)JvvzkڵJTAY)nU*@A{D 11hcTSMRm>>Wڗڗ-ԾWjmFvi՚T{&9z~z~~z>TFI^_׿ԉzF Է"]{|XjڳγQl!O'_ٮnyOSP =Uȳ˳KԩQnãD6JF]?j>llq7qqvqvvv1xxUxxCϘdL763@==!c#U{X=j|m|5~0Vh)ƏFia#nl1r7B#M2ʍzm)LU4.GfO,myyμؼX 1m40Ѷיi 6&&ռKnkѢf?fj(s|3n>oxs54[izK-sh2gIb~iO3 lҬկ6M={~Ti޳gwzBދ{{x^^V{F-@޾Cއ!QQpo7Y}sh 1WS'xgz?~?㝣_Vy1oL'$ j_KZ&g&OJEwng>>|~zA߃@CAAWB((}1X}'׾o|+_on j.;?/ik,j:gu'f=h 2GFSke2ZYYOIֳFk58zz8hmlkkcͲ>1εZ[_ZˬRJkk*[kqָ ZAvk2Vq*3vZ1cUkY a x" #% IƋ66kvNƤ@@OXcF`\)^3>h L L11f>0l6ib,iҢIk&t44iRk]'."/em ʹ9{W^$#oUps5"+5 rla$g_}Qync".?=9Ș?\itzca:16eAw2G1yHD}7j0Y*?32ƫw-zȳz^]&WC~?ʷ> zS09}xܳz h'ko۟ANrM{ts_dp-w7YHar+{ZpTccƝ'vӾm5x~G;Zyx}:m4yC\m!tَ֟E{N߿Gguw2/Y0GGH_Cכ~C\zԋPqZuV=q_<72Y<߼z<;ʞ'~A9,ߏo4g8hIީ&,x\צ_s/w4t"_ -_ZB6S"OSwq7sa/ף] xG9?_WzȞrrkۊ [*ç:o@bkdym/Tf>UqH/Ό͝#$;\,ęSsb8WlJQ(fnn1bSˋN/FՁb$xH$jE5:x^VkċjZ'^vjs1ީ+~Y,&kkw)=bpZ)? "XjFIdҐbSӉuNM'B?f9tNM'N9585tbSӉjA5bS:5̩LsҩVNMPNʵ^Qnz>NmmmVzy;(]n E^aTg*Rr/eS)95ퟠs*ej,>>QYVܩ5uNltj eSk(9N:JSk(eN;RJSG(NvUmįMZ5iĚԪg \Q\QјTěT13cGD''}Z-E|VЪ9J_deɪ7MdWE6u8SԈn"OwK=DȎFjFZFZhL^Z^@/7$uETsԭ6j>q\}mJUHDkUyV>m8v|<|7ǻ:,}^ T}^( H_/+E'JM^tw=\jGW;h_D-_Ϳ ݼ {`WpJJ\e^%Ljj5Na'밖Z04fn];DSNNü +jZQs׊A`` 1jcpzdڏ)Ǹϛ/pu93 m^3'rf9L6's>>--aLs&2gcc|b޹\xg~3 ̅sNrf#}fhe3Lofbp,bb3"3wQ,1m,5K̬`Εf%-*V՜1kIEf-=יu\o֋ns77 +MUGtt x&MxǛ7o;ބwP&Y:>EOSOydX,Bó?$ 2Bsh-m6hX"`m$*jU$XV`Em˦}UJ26;WZUUmUӦƊѦ֪jU/V%ESZtz@0D W$|U DZK$D;ǻ$[;:ЦSH t tF8[2#6wxgf{D+ 񆢙 E3P~0 ョ\?I~۸~۹~R*ME@U@V}2E/yP]/û%Lpd'&Q5*~[ݢi>/>'kjm7};;96vt`gڽ^?X(4<`z\<>/1/z/5/q:>J惡p[ZZ8M37FZ:>Nw[|wkw[X~y/3㽯ٗwy]O{P #͑;E=n,> 3}y]Ogh]//sz^Yq*u}_;ix=-6f<ڻ滴wvA^"}[73xw|fz\z=Z^ں^,sߗ6k}8qW*BkVG}#Eoo4ɾd7}|8))P]hkYVhfgIij԰v)Z@M&hIă` -i@@GwhhN33kf`&g5Z^CeΓsqd,v?=X"*G\fo?_r=~Zf >ۧM0Byњ=;}ǵ-{ #>rȕ>8מ9}0wm~פ,s|y^w͒ziJ!!{?,ǂ=hmy &7%yxQG{^ە|5fDcPQ{S\iWcaȅ~w*_939qOGv#)j|2cK9v/cL1ca#F{fǞ"V u4q@io>w5VOt~}V Ƒ% %Lpk;ۑ?}%Gɓp|.!?E_3O\uxhAWc X,AoyVA܆^^~$Oþщo999C=wso3X>G=sq~_Y9u)Tr|_.{`='#?\wg0|?o ɵ"4_|{OHh|_~_ 9o颺}?5m_Ko~LDkrI6Z#! >պ[ȷܿ;=J9{^ɘ98`*7~sh_wdYVOTd?HF9|f'y{wαZ.p^ۯ{ь8yEC˙`"" @~$qr{oWOwYܵhSjoƏVcOsjyR~6h7 Z|z6l?w_s*$]"y/$Ni)\wgQ{vq- (pI{G:?yWX1Tj?B{c=onE?Ȼ~R6=C#U^ ol+&FI[7r;r&=^r}mOLpv_Zoq#Lub#S=z}~aQw|?x7Rg"†ߤ {^.{ugf7#"QDB! !PB b<8ܹ:3 Xbx,Zk zRcXjXg=ZK- '9Hc|KКК¿[O=j:)gɇ_ǮNc&/0,scvfN׋V2u뤟0ҽdǼCiv:2Dӑtd/NG~% 'G6tCiirf#f_`+GSl3BN(Bβ߳Ofe gbk+r`O'_d,ɢe1&0G> s3)d)Fx*7M+e0 EcV'7SV'{-3o8YߘL:Lofzch ƤUa,4Ө8|oL;,ޘƄh7G'_4xcޡ9ޘwi7fl9ޘh7fxcF׹#ݍehv7VN ݍUn,mŪh^76ucgҼnl>D󺱏p?NҌnWhF76-ghF7ftciF7J3-qlgy dC4~l'Dz|?g{d q}f\ch5|~>ͻƮyدѼk| ͻ~]c7мk7i5]wy-wg{m4m}77AcgwkN}>;ƾO?c #4Q'K4+gY؛4+7MD̉HE|li؈yٲ"xBdS#FR#J"Jde"#*dY/ʲ#^X,{"="+dnh6Y9&slmMAޘV;M'{jO#MR.yd^̲+4Olii6iGM@yI4O|ExOAsh6y>&iE<_Ss:xEpԫPf|F\Jt>> xI3@EZIV s(FEsh𹏁}ZҘ4<ʤCz赳k໳w!y R 7_ޜot}z4t}z4XϢO}z&}y/^>|x?_>}QIG~?~" aYxTiGesds6-o7եNI<$_AX-t[+wLI]?9AH<(?$4(ɡ ) &(f(ftu!ٰ'2ů&Id#GD8 QsZ~-*FR;88CS|Lkk@f(S(.)7d M*8"qdϊ?õP܀/PSAB9dr NAX 'Q\IsӸiD @(.,T *H;7c9?Kb~9K$4\2OR\{ҹth#r. *1.{`|eñ D+.IIhSS0BWD3sг+%JyyjW`9 }8#clsy>O&µY\W^\:`0:N2,\7z,\H(H[MP@x֑x7HO{ $怅`s` 7~A}F}vñ?~{!#n/ ;@rAaq?#3~pG/0K9;}>>+<w<}}DNr'X(p(7 # v?> \3gM2tLU$GI*cI2N@TޯL"AVfC7G #h'|8Sʧ.T.sќ L$j&`LA3f 4̥ 4yj&f"T394W-េ@9A (' ɥʉ< "ěBOd:]T * AEAq:0E|?,]Zu7/ TiA (-I0(-`PZy_|"YTuAss"y.`\P`J`>'OD$+"2"B xz$7bFD ̌I "b#bɂ"# #fĔ9sHND|D6u@R>7^ʲ ڛfh} ./$A !!g =n8c& `dРpj kZu:zC l7o˜]]IDʕrB ,3) ߆0}ރ Cv ;a]./ AˏA ]`л?BC$U3yX8 g~ -#10B8p N8F;w$T0Y,yjeZ9L:HrTw<%ͽ$#(xVQ}Q}䁨Ghy+j54ɠzR=MXAO&TOlPvEKQOE<>V>VBe\ʸq *c5*Yg2CeLQLɤL1'LT@9F`~ !p(@1 տO~lTcPǡ⟣L5})jz%jYMD5D5?U{)u%*TsP.W.C]^ Z^.9Z<xsBKQ[:[ں u9jjֳP[Fmz9\5Is>*n-کb~3Fn#Hs͠ P+E T\T/>^vQT%J~T8}sQ+V^+wFS*y.~ARe\x!(P53bT%_Ee,gP:u\'~pi0&(6s)0t"6)0X$f,b "P(k4sM,bEl&f,bE,)0)0t"6sJE,M,bELYĦc1Ŕ,b "6)0L"YEl:fELYĦcj"a)?, Ma V=%Ma 6)0Ma a31X%a/bj?Ua)?,) I!byWpw4晆1<1OF;cND83HF8%<ŝ(hvDN6s1)x8K:3 ΍^14aA "0^a2 !z",8#%KE#H+=t;#H/0E7s\ta.0 E7#6/M;-|eZH4VR!™Qaa `A"XAӸAXAu/* mB,aOa|('+MR(W?O o ka;<a4<>4&~#d$F!2I$K8#$Dž 0;`#M. f L. WNbd1_4Q7`;0C\S@<`nD&x?&MĜS0sGC;/53j&,iexKs f`T5Sa/81`J5JHa:0{Z"^k]5w QHF_ G:\ ̅0 3bB9a^Md+4.J@?`qf6 ``p0 88 \\\$l,clh<@ @6 P(^ò-zt"Gifz=.sV]ڲq0&"' QHHeR*O=sZ7ž؏,[ X"Àt:^wvJH5vp<佈 x)y%U 8!Zk-*{r om;JOyWpoZ5F|m[jyЖvXQֆSͲꀆփEPw6 u.AN8N/qg+)g=#=6xp>`oop/;ξep@s}o u'W[JV5n8&yܹ#_,[w Ҳz-]V(0rPǑl5Rvt lz[)[w`8Ԫik] ui`=u]xAnl8(wTՏ8C-NV`t%>( ?PYwO0h>#YGM`غyd@í끏n>޺Tv3;[Ϸs8pzu_%r ʴjeuDwߨ'h{zG^?.ڢS>;Yz82pr516.c{"5 \p-Mb5=pSY[i[rd]ݖd5q oiKmYA^XTi{#<}= 7C[u7=,IT*S g{Cy$W~Oj/dK<١#aO^Y_) xJB'{ejOu~gQ~gI謨7Z6tAoᭁ];<5o:[=!\ۘA}~g]_H5 PqB솵u~g/nPq`)<YÞSg}L Qs@TnCKjAVi|]|1X_\(0K NRIӾp/+!vޚ._n8pWx8'zBe_YpW.1r#Ն% W+2Fmq6 >Mx1g /1֘ê^+Վa196k%t_ \"#`1˷j _Peko\,4h, A{o?MZpak-Q`N݅FoTqwq.*kn8u*c ]ƕu78[~6<`\GpWbI86wS[{kF>jW3ܶQ5BI8菗ɔ(X ǩ 7'"|Jb"ڍCTX/uܸߟ,7g]>cI*hGEcrio>oW|Qp 0CV\W NǑPͰv iwJ xg{^oVC5{!;g!'O jMA)ɿ.jJo L-ɶUmۚf𦶮mk@m{[ ˶mmO>{m)k{ ڎQFچ :Ҷ?vPOM6c=mgN,]hÊy.0lvsZەmzS꯵ vo@ۅv'liWuĴNp{\{|O== )=Y=ky==%=[e=m #1W/)FyZh`k_1]Xk{j=vGA۳AY5no,xcLJ-F|}go_ }]Ayh0Za-=#ݗ9ao!j {}sm{Ί}h=Q\"1+}X5 xG91 eECᎆ!`?~)ƿ+'ۯJDVKOYUȵX+֑ !zvEH1b]Q6WG|M4 En`'q~yr`A< ڡ%vycV"7/ρ'B!uyQfCR ې=k(\4pd>p|zV/wL4p=B1)Ͽ3Tݙ(0е3TNG;L㝥&yLڴƤŘd_\lrv.5y7:VxTB'P)$SoDk7E M=MѝYa)!iZݔkZהֹ y sicSfV12minhiTԹǴsio@SMA3; 7-<4a:ڤu<5jIl>Ҥ:gIo>-Yͣ,Kn󹮋]W,Wk-e׻[ovݴԶݬ1ahZNآ--߭nIꎵ4,xM&djN[喕-ݩ ږllMVgEݠZCm-B`IJ]njvW)w/~Pˡn-U/fRSn8>}v\?+?n u;Dcj}C?-`|Tb-uq\2X߽ڜв{[εlވQg;al 0bcJ,C8Vr$ d Q},2gl2ɦo$eeHTW sYs\%q/rKXӳ  lc*I.嶲l 7};e]wuslw;öspXlwsl(ط1wR*`w(QJr5{Im|GA|O9(Il=D} Yʓ)yY?˞SZe^lH:vQ 'o|a֛GJ/\+zso.JVV%K+++S޼^9G>/F],L ~O{ƣ\WBPp~*ac# ;ew߃?fL=U%K"$*wS؏ُ :#G;{12FLMa#weqYYd,NG{sei4r?f,QV + I eEgH2f&0ܑsLlVjSjlmKmzm0pmmm=bmm;icg;h;b]]]ى {=ўHgsb{^kkF,˾rJ鷯ooA.l'~!00-`ċ Ԯo6 | ߐԐ D%B>II"' Pq(<ɇA DB(H y{^>*s:RGR(1d&1C%c/1}N-2~ ( Ay BI&CyJ 1ɿp}G~$[(P#@$Wgp7_|2e2JDgo?1 DA4y ZYGJ y2ZR4Wo?+;c'UL#H^d|T3˙0Co}&G^c~:s)=bCψ9sbf~  گ |D|:i9|6q<|>O|!_H|;#?~;H u yrm?杰 ŀ2@Z u yZ`-Y:jڭnk3pe] ߺֺٺ:he[YOZGW׭7mlx[-J-ۖg+mնE%6lsؼV[iV6ڶl;lm{mrvvvv6nCϲ'п/*,DZfߕPG@+VV~Z,8xh hh''?VV0Zy*Z#h叒a(h33G[B[m u}?~&ZvZBBhEhϠ55? ּ@ x 5ԦJ*jf츆9%/Z#B^ Ig? 5D,CCR0$`gXv;js`:"^>Av6a`w/u9hq )i[-[8.ry?w-mk-W7c ͮ+Xv^˸X.ζCVkKrlk+1gMp%ڎuzo@mMvF])tHs}1h?k+˚ʵ]|WĸSa-rۮ܂UexƟ`U5{b?ºԥRлV~.7E%Oj2hO ZIxßI+ Y9*WukhX׻6|r>ɵյͺ5xvv݅=۰ϵKk.YONޅӮ@KvghrO>Mj;^)nڈt ;P787e`uo n$bܱIw3ܻmqx;`v{Jt'}yBRܩ!ݝq%,w}S[;V. [.T¾}f·%_9K'|]4ՏLɔ:^&}u:7^%H)0ѢpΒ0W tݠL&ٙ:IC۽q{Gny"=hι7yu֛8.xS.{ө/W׼YԮƼhOЇ+jeo㼵DoHjp{h^]:(6#)pryp[]91py:4 Lp{]t#cx]86J!O;X==ȱ{1^'ޛC>cǰvJB1q:Kr\8qݗM/od}Q+ n-:C$S} Ycρ> ccϋ }8F/D}yc׸ȷqo]ַ 4z};mlF_m>վ|7NMT4nioỄmڸwOIxa?rV'ihڧm#,aT=~B7+[@L mA.~=Ca1Q}T6#/Ri` Ae5 Cvm!PX[d(1b1R׊Š5 jz }Նu-n^a}DG g+b8od n+=>zF8?jl'Vx 4?އ"fb%J<~:? ? }? MOCOCOCSЇG44Q44? f&(ih6~? }? %?'ɧP3ѧ3хh~& ~&,$L9L?}?-D_D3 LT,g`:Kh ~&2~& ~fɫ?} ?}?I4P+#a^"Fuxn٪n1--uV_׮ zutktu\]]Ӎ>FOԧYva9|D7|BwZwj7<$Sa=CmE? Kyl~fQ6DcڇG}5D-D `+X=(B -<|߀ѷ>z~~?$q A|^730G:I7rc-f[| b&~8Cf" zwM=ݩ3Qt۴r΢G#bѫ''rG듴r}*n/kM}vtD*Xy:A' c.].qоRIJ֝Œe &ѭ+JٝR8XW %Z(ݺf]z> -]?lxue8Bēb)ӹunK:pR(pTdY)TiD/mE֓(znnD7n ^W ːnH*=?qGpuDߧ;twѯ NҢߨ~ ӝVgtq\],wSE=??6vqSP;;?Wt WZJ-*KE`ħoOZ_Sf> ]~F7ȵ#HC4Y,1Cː 41Dp7Ӑc ER,rgXlȇ0xG4W' V!Sv^ vԟ1 U5M8OŰݰW>( G`^gapp,:>e5Ø9]Qe~ 7N72&6S,ݨ1/-CXl,{g6VkwnZ %+ X }JF#;s8 ׍cQc\is77uK]ލCCa1j`K΍'`mCQe9(Wti}׍7u'LnS;>gRbM$VSn]4e=RԘLps`Yܺ\K</b; 9 R;D?Y1 Pk@ErE{H+`M"_|Ec">+/VkZ;{$MPuDet?X`*O [E5`gUtL?'e&tӵ[ĭ19_'5̄ cHMsx_&4O^M{N-x띺n&ph7,vU\KwMXZ؂[䮹O]uROj,5MSEV%{'yZwjc~S盚+ھAmwzP.8Cv9H:)|S>(=Kc,=Kc}oJ)*U25hl@+ %;PW"1N4ϩ!5 ր> :Cmr+AVnr{-JЈ+TV TyV^h@UQ=~-TZ*Yj|n聪LUj~#@mNQeL2ـ<@m P XX h=>j:F݀ÀS39/Ui{C?N/H@tm-? H'iLZ[8_#_ X KVa@/`` `=``+`9e;`$o# i[[\ ijedZct||OR;o "8pk4. "'ohHH))?Q~lkc*b**+R*+*r+ *+**jUh* wEsEbeEڊ ߃PvU W8VqFU\^qSͪyJW'SlwP].WWjڡ[!uOZNQE=ޡޭޫ>>>שOϨϫ/o+ѕʴ˕RɁrz>J5kr)B Yl W"VU5a=1)"1T!1`>X0 1L sTIdj<ҩi]"ϩR %UzK#Ǫ}$:17_0N[Ʌ`&$KhJ9rCPVFhzK7x ala}`=GZ[]yg;{_ë;˂WnuIQƖ<[ci< GW4b#pֳ-v+sqlG^{q(+lx%ؓȮb9h{q2=)?.߆}DC>z7O}}LVLgX }m2#|[ފcΠ-G|{ab=G Y5,[ hr2SSɰ 8+?{aֿ{ctG>z ԆYNvF8|VV>SE(3`Y6B-./)ymOw# "_so{vs4O#GI<܋L=r[زI|y22lǣȊSx[>Uj@E\_ыVdg3<-w# "§UGx͟!qkf>U _CTMd'r=2Z0 yhm`80#hgqYl9+ ^TDFv"#2Zh,+ ^ý?V&`K$N#<UO-X:/moc];%hiX*Gfϰ)>aUlr<8GR GͥEװ&̿O!D*L3ћu!Ƨ1}2p./!o| 5 *)so{> R>ns. $wڣIUѽVџssΣ s8Ω8xoуccsF@eՔk%QX?@?KWXچ;vv!DB"hr109d1$dc9`1 $}]ό};={LMuuMwuuuqSץҲ4z"N< N$'/Ls]Ec#$ifyǎ|89?bo+YXǁ|Y܉bucUQdE*b輅/Zk=H V{2qL~V<C28͓hh=ҍ.:3ڞ( m,9JN!?51lt$r&Q e"%*4jS4d42B4 gY^#i6w$d߂ kF*4r_ʩtя<|F;-=JGqMA=5~$k ۝wDE@C+a&Fb#PCCRK@0twk hԅF{UaQ[8(584Z>m]$m3'?t1 ץai H vXZ]c7 rh=UAwCߧΥvuxؖ,,Z5B^55C;kCǜHF'x (`% NI",l:Bt9' гzvCYȷ|+͞RK4n? 4W S:84Ѹ (`pRo@eh{ \\\j X:Cgy,塳y v ,D#e&8 {"ɴ< z^7"HWe3B.d =p$и%kk!JJqfz_Yմ =zwfbaSLi(Dђh% )3f"*B^Ɣ}ɭ4vS?:w6BQ=j#R ^B \E@%4"i(0:Mh΅L^xEI;ۡ4+JS[@W] kGV0+`9db(?4aop# =ǁ' ֦Xg[ACt}5h(oFvdq]z5p1p.˼ WXFgG\b0 iXɞ8S8f#xEC=vAY{RdF&\ rRԋМa@J{Rf2]ˆY@OpЫ]\ \ R'd+cVWz >#ȥdYY_o;Ky|!Ybܭ{V_o(.pS+?C..rH !ẃx<+/gyZi<+d fFݧ2rͼMoav=5ݱ\=N!FX0v'0RÈ.}5k툵RL(CV,h6xqi=J _W? ~Ch;8;Xu͋#㞃5n2ɋQ1, mTڞf]̈́ڒgr%Pj#/)0sa:"s:W^65RiMhDߢg1:!Sו$NZRĴG,]OصALvHqω}WE/j=C vYc;nG z!]Ka\fb=q/hWndG;@>V@ڑ 1)_y#uFrZsg7]P}-7~'=X`/Bc fDi͞fOY2Mf&ʮzBauhB؟ꚹpYX8چ9{,'doU9}.}-VTjfA D[I*e&f0KSS5t8J/_/?FoM&!SX.MmX2pʃN@lWoA =)Qf@=!t,A^x2jė9cA(<@O 4Ovz:cyC&p.U@uR꺽P7qB2O|Ub Z>8CFhu\q#Ki : FvA爧 ЅWO 4ACYӁhszc;mІg ARϩ1(=vwQ#5&AihCmO?I .dUXkH e/G1jG 3"LǟAJX=VqX̙S2 -ݕzN(1eExsm,J1< Ȇ"#/OʡaS#QwaY: HZuЇ(MI 5Jt,oѠAYwf^Thn -k%vzfu 7`"DC_%Asb $G@2qc0wv~P^YG ڜ [E@.<H(BفQΜn7:׈JgFxXdXUBb.@'VdNv?t)`;x'/r.Mp֎G ͜5S7 W {/а$*t@W։J-2t..us-u CWo`e2%$7[@'A/h'b=Q0O43%9B*q'e mʆJ=Q&0 xdg)S E?hO(; Ц%BqPpz=eh//v9zPZ ρ#IPlݴxNYwaLjf<{H, =\&9;9m[JwQ;`ap-z̐h_Ez{p!+m)8~w8|3JSwɪsҽQX'R) c5 G 1qrl+ʢhIy)W! D 3buќ" f Pꈔa$LRHVx}5VN^6d.Nu4ӳ8"R4<~CKdkiWi"4ˠH^9NW7@a>Wx~Vj  O%cqn.7h=li&7M?,s ـUPzB+-(\Et?`up{rVC^dt'?=qh;l <|/W$&8_C[ *}td-51ߓg6]#p9#E 9Z3ja=g x QVZp~@rCr$c\4Zű qDjЎ`gc(k(%Fhיほ ? x 6Ov|FhM6D&^@f t|PzP]oRSB<4 bQ+μ O.lkf!~SDݕc=9b8j݂̗@C`=d\7l?g*a~`` =:/4^\9ZЃ~Q34,/:q# (q)qN@Xx+߉i31sD$BBp"y5b wb#hyݠ/+#tfӣMA~8θo&06KL0tZ01 G=}QSȿh>TfC D- ՍV qb by$Dλ)]b<%&!B/e={Pj@^"FBjtu(7f32ۄp0_2zNA2 J@7]Ah?[`OB֊b( "Xb`5G2umm' 4%_ށkhkZ!t8uSndJΠo=`nF-nji9kE]?@)z$6.FYcN wwSA'Qd@ d.IgKQˋRoRSB<4thxq2hAeDIW5hm;z|ȈB@dThs1?J΋Zyׁ?:=h1=AV3˘ ?1݀ҏL+vz8#\N4μϛ bNI6qGqkD08A_ .t|& ? gd7_D%gt:¸gF垾)_1zc*a!/{!?D<7B<(5 /d!BvVftW.ǐ4ݭn; Q:*#09Rqį">@fiHh#4ru; V vבuw320GA{ vx7.J%?y!7TWJ'p}~@mC"vE>K2,+O/$c恞UwH '1i~2Rqq tz!V!]e@o${.u0G8i2a6CIQJ ?t6z@=i$:fS x e"e1Cp^ ɟ c_K BAf0pJ A7W^=prjI;pւ8 (U߀N7ӝHh趁hd1Bvu@x+&#S}g8 y< :t^z;:>_ 1Ekz'軠oMߝùzQf6ѷ;-謠?S^ 4~KEipC:h( ѠAokVY9 <=}R3(M1 os3葐%+AZH}[K~Oe\h؍_GJXn͡_,p# q; qutWs;蓠wCTt{pmԞ)PAPkgeNoyՌo,2V^| b+OtcM0v:Ooe']ڳ]Z~Voۑ`%(UV$ UT$kKBKX$ˢ|(+*ڬ9~sp%pBm[7O[txEh `$0S.M91JF6."MaQ;v`N.~\ ܾS1E-ż ||'@0>xSY%:uiSXX3[;{t# \ kێ^-x,|%+0DZQE#XqS>!²/^r"O:AV}[#:ڹVG_;{?y?i[ޒy÷O3o'y{Գ,O9:ڹo1'a1sC_23#{t|{kيl#e7sſ)ޛoB&pܥN2~ҸKѸG<4E[t/8Rq>$W]kuWVF{TEI5TDC KJD0K菞f|VM*շ-̣۴M[J2)CE{5@&X_Ӱ~x}ސ y6 #tDz>Wl q)ʾ/K6\Ma_$X$fE2}%RTlH/ҳ"ʦΦXэm=DEG^lLa 1CPS.1ILb\q5d>R KeE.t9K#֘ ٜ1[-y^ٚ3ۚmy~ٕǘn ?zBZoy?_V|o! }# %WzU:N&RUz22ʬ20UeITv]*Lr2V2ʧ*FȔ*(#TaUXREUQZSdUBiU)UJʨ22RUPd:H5Qj!ӫV̠ڨ62:L$32ꦺɬ!O'2/sj̥a2FȠB}!h5ZQ8WWe>5QMd5Yƨ)j,ifBj% 9j,檹wBPSbY\-UKe \-% BR߫eiJeFU:YNmPdyYmVUVTvYIT;ee[U^W:j:,ꨬ~T?ʚ:!kSꔬNӲ:gYWQwd=u_ݗꡬDzzɆy"~1D._:%=Lg&"yEb!"|nlf  VLm6,BX3%6YT,RQzgPXRIebT%WT6BP9XJKb*?yYj_giTUUT!*HzSUq(G͠ʫ,P}29ˬZ,jZjϲ#ˮ:,U,ꮺ\r> ~V G UCY^5\ gH5W(ƪR} j+&IJ}Ŋjtfbj͊׬汒jZJEj+%Z[-+S߱jZ*j5֪ZֳjĪ WUXuGGj5mkC:VGt(:l]uROz@kF}uA]`  =u}zzš4|!fվeݒdXcac[[L1_s/ޗ-s>__1n|(d9K =h,Gql zcvdufϸCz25$6±{ȧ8Lc5ؐ8v c8ݴ cC-dC#d>vr#p n!#q=BFc-7ؐ8v c/qқ ]:@ca߰kD2\Lv-k)eZdkEfZdk]s-2ߵ" ],r-ĵR"\,w-k]Cf"saEVεEVYZdks-޵2]lr-ٵEZdkEvZdkEZ[Xd5X'k]X1,<&w걬)jl-ɏdWM09\ˑ $/+&WySޒyWޓP>@ *~A߽ee&dUYIBdl#2"0,Dvu&Sd-{3#*$r<q!;FΈ2FL ;JjDv*u\C"+MZ# _\7Hj$3)FuaF4_tLΓuD.^.uՖۮwIC<-DFIn?-r&C|9_k_(rYN Xj~f\Q]GޠJ6 b6 coưzƳ l"&ʦlf^l[x-er {bӱb6mՑc;v]l78`!vaGuTg'IvNsc3~2®k:~h=fOS=g%{XV_` Y!Pk5a}nFY1Xk5ޚ`M&Y)Tk5ݚaʹfY9\kZf-VXY[+Ujߺ:khm6[?X[6kiv[{>ku:h[G1Gu:i~N[g9uٺhb].[W5uպiݲn[w=zh=~^X/WVo%x[kZl=[O3_O'^O}}؟ڽ>v_`C0{=iaGc)T{=ݞaϴgٳ9\{=^`/ً%2{^i[mv{eCa}>fhO'_U}˾g?ُ'S~a_v_~WM-m]=}C#cS3soW8?!< 2`̀'`/`@@Ba$@@@@@@D U u M m@d ] *>!1)050-0=0#030+0;0'u`n`^`~`A`!R>3s>[V ^O;-,V.?Ye9YNfW_źu u[7n*W5&VF!0g/LA3 ѸǞa|.? M7H{.{3oW,`Qzͯ3)zج= RP&%cGi{Ƴ?dOij+|"K3l#45xؾC5URҨF4BW&DT>FI"$%)P%(,DZP]AA(„('1)*D5f}<55Po^_߬u?fY-VVSYVU+(I6ba=+m|}ujjz~}U,=̃:;^q@1Sg/׾=1k'I))T4wt(zF&fV?]mzBOi]JBU[}w{X*|JçycL%ǚ|q.*V7fչ*5aLt3]|?&s1\|ƈb_BG{gH c3e ge2-9dnQF2l VXO`vҘcf7fb|j>)sa0_Tm.3OGy&x&̞)o|)_8/bi0MĸB$K?\fK˭?^m:O,?>VLlVe~VY?Ok?IX g]Y,K>aXrWR)XOCY*=G#Xeiv;zVgzgT7 35=o۳ x_&#ƻL3pGl| r<3xŷ,7wh~`yq)f^ rJwq/l{/,T-u#b[>+J:c)jꌱLd|3al|[[|'}X2i9Υ{}X:z bhe`Y0e8r8~E}gceV@񫬠[]gt,+c=FWsK%})$ iY^@LȣB:{_>+~_oufH1w+廧E=ͅF1iAzQ.^SVYJqzgB=(ڹO_;-УG^a)x^y}bYv`/ֱ1~(Szgއ%һqzzebN+{{Zb(렳1z_&4__W_zxxFx&xfx-zeǶۦW8]vH8)Iפct.]Y"1{БP>fve`5-V_uۈfk^W mDXmV`%<9oom俚}ӞthIнWW"q!q!8d C! qȋ88CC q(P(PPġpġC[t\-?=t+x6x%^So;:wQ|,>/|3#6n1GEH!Ҋ "n Ϧ{E"'Gy!86Epl‹ؔc3^ 8-̣cK^V my9x5h6SLIGkL3qWٛ8o(8&x訳$8Oqv<:/YjOu56y46y56:}˯ؒ؊w?xi|A^UؙW1 q O4^UT3 ߤטtWjOC&7t=6jL0oqUϪzmlƳil.[Vz;sz[my3h_ ^T{S^UG߭t/kkMZ|)286،csǦ;[qlWʛi{8n1c7= t=Έcq>7#7 #7#7#5l.lFq>FnFn!Fn7O 'œ)`x, O sf$bx["V0tA\gayZމk#)ڤjCDWǓ =!:B1Ti8"@|5-^էs_Xt}01ANwꕊS*AYپ9}suۣ)2c/K}þi߶~}~ʟȟݟßӟ˟GcEEKKKK* (T JV 2v} ;=SgN׫vgzG DؕkbB`ao<߲$55,^%o.c0v{UmfU,{kwUհvW]kwMݵv]kXbgU^a +u?Tu?׳eD#5;` yN<=FRn)uۋ?:5$0x{0 L x&xc jit_Go|t|g~VzxZO?o~'[7?nBM{]gQWYvmV_VzӅd}g&-l ۥw@O~A,\Uwo[IE6۸gD&RFV5V\1r/ۭ6]LUpeo`ހ&mڬMo 9%W[.jLJǺwf?^%>U_cr/J ie!Ͱҳ>LR]/dt5tZ3Ǔ(˥)?8i%g܋[vm]s\ۄ(<+Iƚ|62~%Ӿc/Wkscs߻7U]a />jLجKwachJwĚaدEޫ_vn5[G>X%ə^ޢed;j"  FG O>'4i[.AXa5zJOUa9^v1Uq['{bYanZf~9hŘ'cxܵ ?h_o؋5*T\yS3jAɷ73 WaAqy' swk1k vh$ߣQ?mNH揅1Skjf7)t3lXf{Tбhn`@vjkF S3I9^US/OB忿tN{:<}~{~ 9["Wv3rNUoI)aI:y h@MnS`7唎6U$̢t7;荨4n9+膒_uSn #.O-0= dC܁} BQ,a=Y1R'Urph{a~\WQ^iY6Lԫ6 dXL ʌebr]&b'-&״vڕuSzq}&Jۤ5JSߋ)  f/` lЍ@̈́PB/gܐM n hn¿ɉ7C?k͔~͆BsoTuiG!F d=QSXr%/ˡvˇ0=0b^_fqk]R_Q΍4%Qu$,M$}:mZ$i !ߏȝhF|89ItgȊٮF 6|#4CA(eIxǴtV:\³]ov4zM{xgk.:V~bQ%-3z2dog^+yYrwyx ;R5WgkF/aYD'Yik6TUv ᏼLqv\Ԙ_y ۇ6/̹ߧ @<ߜEl5VqT9&# \`t YyШ#AKcw LY2nc5ޔW iXV^/" |A_MNn&G9O<ýtQ#vk>=5 w?DPH' R7Q@}@H1䷊bC +~Mlb!;` ;+^XgBy_!2XfGcJ'%FD=O>,}L'PVzOӎy]dOufTI=,y59{G8\&",2; WiBR-ZoCf_־1T$/$92J82:@MHF|bg ܔeD>(*N-[/wiI'>՝! ]#_rWD=3϶i{;&,|`AI͸[z2g?x,GΞW1zQkv\y63{il;gAvNúd 0Jz: $р_z? q ;<]t%'X}IW>`܂Q VQbڣћۆ9cnÜar7EBRTf98 { !zg+C|77!ns xWH>bC!ȞW,9aLs!)-H)6.T')5|qc|AsTJx>ݜ\KwUAgVS[82tWS*/L 8|_-z>2}֬ۚ,IBUKmqn%mɁuFyoeK eb qOy# ҏ/Tcnӵ.:^%[O3bYte@j?{FeOQm@*B QYn89ˇ-\(h6[c6nǽу/VEw:ZdǨPSwQW6p5 nlT 67,3lsh^@Ô o*P 摿ݝ*sAwV=juG9gep~yZ%lm= h擶v;0oP7794Jk7$UOqf!mZsE뻒iW4T-Mύp pu`znQܬ{S~z_  >?#D3YrtiUb!yT*brqѬ 0Ri'†3wi|ăFNГI/>#jk6s ~we6ޣ[I%^x<%5FWr5kܚCNfuZ^#Ba]S[ /7xqӤc9XCڕO!]T endstream endobj 4 0 obj << /Type /Font /Subtype /TrueType /FirstChar 0 /LastChar 255 /Widths [ 0 506 506 506 506 506 506 506 506 506 506 506 506 0 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 226 325 438 498 506 729 704 233 311 311 498 498 257 306 267 429 506 506 506 506 506 506 506 506 506 506 275 275 498 498 498 463 898 605 560 529 630 487 458 637 630 266 331 546 422 874 658 676 532 686 562 472 495 652 591 906 550 519 478 324 429 324 498 498 300 493 536 418 536 503 316 474 536 245 255 479 245 813 536 537 536 536 355 398 346 536 473 745 459 473 397 343 475 343 498 506 506 506 257 316 435 711 498 498 401 1061 472 344 874 506 478 506 506 257 257 435 435 498 498 905 444 720 398 344 842 506 397 519 226 325 498 506 498 506 498 498 414 834 416 538 498 306 506 390 342 498 337 335 300 563 597 267 303 252 435 538 657 690 701 463 605 605 605 605 605 605 775 529 487 487 487 487 266 266 266 266 639 658 676 676 676 676 676 498 680 652 652 652 652 519 532 554 493 493 493 493 493 493 774 418 503 503 503 503 245 245 245 245 536 536 537 537 537 537 537 498 543 536 536 536 536 473 536 473 ] /Encoding /WinAnsiEncoding /BaseFont /ABCDEE+Calibri,Bold /FontDescriptor 11 0 R >> endobj 11 0 obj << /Type /FontDescriptor /Ascent 750 /CapHeight 0 /Descent -250 /Flags 32 /FontBBox [ -519 -306 1240 1039 ] /FontName /ABCDEE+Calibri,Bold /ItalicAngle 0 /StemV 0 /FontFile2 9 0 R >> endobj 5 0 obj << /Type /Font /Subtype /Type0 /BaseFont /ABCDEE+Calibri /Encoding /Identity-H /DescendantFonts [12 0 R] >> endobj 12 0 obj << /Type /Font /Subtype /CIDFontType2 /BaseFont /ABCDEE+Calibri /CIDSystemInfo << /Registry (Adobe) /Ordering (Identity) /Supplement 0 >> /W [3 [226.074] 891 [498.047] ] /FontDescriptor 13 0 R >> endobj 13 0 obj << /Type /FontDescriptor /Ascent 750 /CapHeight 0 /Descent -250 /Flags 32 /FontBBox [ -503 -307 1240 1026 ] /FontName /ABCDEE+Calibri /ItalicAngle 0 /StemV 0 /FontFile2 10 0 R >> endobj 6 0 obj << /Type /Font /Subtype /TrueType /FirstChar 0 /LastChar 255 /Widths [ 0 506 506 506 506 506 506 506 506 506 506 506 506 0 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 226 325 400 498 506 714 682 220 303 303 498 498 249 306 252 386 506 506 506 506 506 506 506 506 506 506 267 267 498 498 498 463 894 578 543 533 615 488 459 630 623 251 318 519 420 854 645 662 516 672 542 459 487 641 567 889 519 487 468 306 386 306 498 498 291 479 525 422 525 497 305 470 525 229 239 454 229 798 525 527 525 525 348 391 334 525 451 714 433 452 395 314 460 314 498 506 506 506 249 305 418 690 498 498 395 1038 459 338 866 506 468 506 506 249 249 418 418 498 498 905 450 705 391 338 849 506 395 487 226 325 498 506 498 506 498 498 392 834 402 512 498 306 506 394 338 498 335 334 291 549 585 252 307 246 422 512 636 671 675 463 578 578 578 578 578 578 763 533 488 488 488 488 251 251 251 251 624 645 662 662 662 662 662 498 663 641 641 641 641 487 516 527 479 479 479 479 479 479 772 422 497 497 497 497 229 229 229 229 525 525 527 527 527 527 527 498 529 525 525 525 525 452 525 452 ] /Encoding /WinAnsiEncoding /BaseFont /ABCDEE+Calibri /FontDescriptor 14 0 R >> endobj 14 0 obj << /Type /FontDescriptor /Ascent 750 /CapHeight 0 /Descent -250 /Flags 32 /FontBBox [ -503 -307 1240 1026 ] /FontName /ABCDEE+Calibri /ItalicAngle 0 /StemV 0 /FontFile2 10 0 R >> endobj 8 0 obj << /Type /Pages /Kids [ 2 0 R ] /Count 1 >> endobj 15 0 obj << /Type /Catalog /Pages 8 0 R >> endobj 16 0 obj << /Title <> /Author /Subject <> /Creator (Microsoft Reporting Services 12.0.0.0) /Producer (Microsoft Reporting Services PDF Rendering Extension 12.0.0.0) /CreationDate (D:20211111010008+01'00') >> endobj xref 0 17 0000000000 65535 f 0000000010 00000 n 0000003721 00000 n 0000003918 00000 n 0000961148 00000 n 0000962548 00000 n 0000963089 00000 n 0000000065 00000 n 0000964480 00000 n 0000731824 00000 n 0000838831 00000 n 0000962344 00000 n 0000962674 00000 n 0000962889 00000 n 0000964280 00000 n 0000964542 00000 n 0000964595 00000 n trailer << /Size 17 /Root 15 0 R /Info 16 0 R >> startxref 964838 %%EOF