%PDF-1.3 1 0 obj [/PDF /Text /ImageB /ImageC /ImageI] endobj 7 0 obj << /Length 3571 /Filter /FlateDecode >> stream X [nF2c,_p݆Տ؎dUÇ11`fW{d"DAږUUux_j̴jsˈcZ;$ _:04u78|fĆ.Gqh1Z"`<"߿I)18ĦL.'kܴ550$0A>]] !Mhsr3!p[K%1暚 nD<aQr3&3oiҿ\xIOQ- n^|kG6),)ԪvRT_#OiQg{I0 uCs,{U:k079#]w${I8Փzg/țaľkuJ c7ai6336svNcyꇓ(}ɁAqCYڂie 7qv7'oaND}:o24 O{`%0ض^`9@ɵ:m{o=z /O;{O zO~ 9&qB,O ڗ:pN ThOlӍʇc Hw_;?{s97UFΎWN 4 OTc1&ß(5fGDžIaIq;u7* Xb DŽ̬ف?ar7&i r;hᇥ]@)Ԙn%$pI*br+bu!?G>$zoDb$xLcoQ 3Y EA2zש7Yx/ew32>E3Wj]v`pvj]KzOGX2(J0QQ|itV㲝 (uW^ L^ea[,DS\&n]g♽%΂W>G`QdJЃ4uAKr"~\{S̰d-7T5JJ\Vȕhz~XԶxxiFC] 3 Wm/9܁z%HwWD'fw'@_!S:r~/#>=𮞗K'>zx\wxojlV6.ab,\a-|qs0n:򺲻uōY$b_n%ݭ[>U\l7ZvVa0_]/M }mm?aQge۝-[eܵ6'#,S|zjTs, Yʲ\AuA]%SCYz4b1V-gx*óslf_$<+$yU\ˎ g79qicRw岱z?,HO˸~-,+/ r{wd{뤂eO튺ކzVи:j]QLl^ ~sLގzVe{+Dиhx])]mWWԠ]mWҴ^_4:vJVyW B;JkkzNr eR"$7hTDWە4mꫝjuR: jQ ]mW#zp˹RSJN5˹n'4_V]r#_((cX9YwoPQmOs߂.4a+М\v@c[lw嬕;Zg¨c:uaxp Y~p*à5BII:Ntkp)r]26B6 r6D"$1y9jţ%bM3 A"x'w؟4ʺ)#'7"f΅ҺN()QRJ+ʜҭgx/*ؿq5cr6ZxS=(gŠO"g>g3];٣TuIlTRY9tU&l$bt)OX,<5nWJ%휀*f+:uHR$DB0ZN(IŜ$`/[ÐofX?91{%[:_m!ms49ӡz`_ Ή <$Lϛ6ær2/l/N,H˝|I" B!ށ41^8fys|<&!% Y,FZ)1B$"r}ٌ8=`n'Mcsb H!aaR,RFӬ2  <ȀϿ |,;qP| Ǟ,g+Y}cCcY2" {7pxӷt)*$1onE۫n 28 „ɡ2};56oy&XRvLr`<53\g|ir{2 >epYCYx#DE{4Sk0 > /Font << /F4 4 0 R /F5 5 0 R /F6 6 0 R >> >> >> endobj 3 0 obj << /Type /XObject /Subtype /Image /BitsPerComponent 8 /Filter /DCTDecode /ColorSpace /DeviceRGB /Width 838 /Height 351 /Length 727730 >> stream JFIF,,JExifMM* C(12ևi"-'-'Adobe Photoshop 22.3 (Windows)2021:08:11 07:17:510231C^px(HHC    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222C! }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?(& rx5K@,Ωǰw푰&WKB8ET?J>$Oqx#OaY_6)Կ? [Cdgǘ=??qZy~!2&Wa~2ea_s'Ҫ~mylw2]ƛwlIAԫsc)-[tnta\ =xJw"_MG4Uܯ}rZ}14#kD 85d:Б '_Ekĥ.ײrZ<濕{p)2yQ5_K4M4p~UAK4LDGQʋDMtTf4i!4/d3[‘=_@ju KOgfˉB:};~rkc@ 5GǿI̓<OS%=˾9ů|>֗W?fHM@wy_* ?%+JkD~O?iQV>XaRA='u} 5($y Ӄ뢽Y}oڭ~ʥfi4ƍ6}Sfk+|v?O*5A{WN_ȷc7SאVD =;}qںҼLӹG1o>_$ݷqVqIt^2nVV:$'?e$N7c p>u%(EAr24/- 5aҵ{x#4L@<8=sT0²]ԓ ==q՟@j{}y{?N 8`*Tk"0s|1CG>LJͽٻiLMӶ8D&i:r4u U2pEx_A+Ӵ hаǽgH2\p%)lo"n#.F֫<I赭25]9&"*Pw5(`؈vVy$xu7Q#Ŏ?byK\/}9cdȵ[O"򣑝[_e|\sОNkj)ԩ &"0D>m4-VKȦ6䲞qkcK<Ԥgi,NI_SJ:W_@R"я)t:I; 3Tk6{bɿ 8=pslHmOd6+<ДbH|䌟JZI<9䃒0Ab#n7Wknr=SLx2{++뺄rI'NJڕ N:傱gy=՟Euמ֯5R[-2x~ d"qreg!B|v_ŭƳgwJkM.yϷjHbH]GZn7mo"QPwH}aGwoR9spssS 9RvW_#̢LĘ~vؑVAl?]M|ؚy]4)Va-cGa+L@=Myv-eXZL3,F4a!@8w3i΍R+^>>qy^G=9/Bw3[<jeA$ 2 ;V9mP-ګn  =piߑkВKkh1Ra%W#AԃPn'aWVEehAc=*.-zcU,d@"sGy#kduOSGbdaxiAϝ~>_QKFegqjE֮нu}fcdAe Wq"FVz~f jt[c-$ s#1d1#WE]T w1 *.QW03ƲFʰ8Vf)մ`I]9wJnxkyLl @ߧjΌa5dѤ:ԚZ`mD񷣩YލHT4V; ƶzOl a${psyBTQxNnV1ĈUT[Z:/l㎁4˙52XEՙ'u X#SGA9l0:Oamhm[\ !t~(NIn%Pެm{ 9,+(\rM.mE9nm[r ՛"ԑs4YE2qq r7`nc9?+g8Z/m5;]FLkfAHctb 8-'݃P4QƚL`-,'?>S`'d4'y vf :zWzd3E#Kq#dăW9Vm+SisSZ[c"Bw>M[$0mvSX7o$A YYbHTԚwF5߂.v+1 a?+Γm#5Q\.#pqw=1bxbyHf`(mS~uG3iV}OُwZ.Yv#!Ot?Qj8sE..̉[}2K,aD%TV?0W.)u)K{|6 r+j6L7je#|UθѲi  2eղkf _>;us{|՝(AҢ*KSeb룂X@#ɷvIEP(k;kaGk*šm"=EFN.ğeer\bKE(] G7EsU)>jLFjD6^ m-# R(ö>e su& .!v4:U*j=`m6eg(?P:ŶchCmck0Ue''v[DQ@Q@Q@`((Photoshop 3.08BIM!Z%G AVENO-Logo_4c8BIM%,7tzSҷ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTprintProofSetupObjcProof-Einstellung proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM 8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIM]^CAVENO-Logo_4c+RahmenC^nullboundsObjcRct1Top longLeftlongBtomlong^RghtlongCslicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong^RghtlongCurlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM ?C}# Adobe_CMAdobed            C" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?T/c][rqeUvnunncd㡁p;0Cx4{qɹjw:4IsnC >Gk]\Yy bә?,zMytONQ"+8O6a3&|F<_/qŌxB5uߏ?+(hOZcc&q i+?И=h-ֳp/?y!&> ڇ;7(?>>y_&XV'??>~0zc~OFXݵ9==WNֱj|f'9}8Q?[p-N00ZO>v֏}/l.!p?[?o~<?Z_~ tlx,|9ۆ[2]cfEFf5y8UiQ4K-^agt1c{Kàw~2ǐ㔸"wù@kwВ\O:Ak]:7FhFkVQEJ:G~-}z% p ?/2u޵7 1hQASmKҔrh\e 8e_TɿS:NٙW[V㽯f?Cv{{*}uzk|=/^²*X4 qEݿYf ' \cbŔfFQӤHje1$Om?K9OU*Wv8'" YΣِ?U+㫮:m>u얇h#mlߤnǽ,oY,5M{]{?5O)2%^8|21GB|q\&>Gݗeu^oNv;˿uJe&w5he>b,~3^1[8Kѯou\q0ie9V<1λ#eu? Oˏjs^TϧRҭhǽCXF[f=VUnO:Oq캍@5ÃzeY[|C.)O?6(G,c`qā # %oѴt˺~8kXNvKwouƮrh>zhkQmUc-fFC$/c>_]nYAyc[ '!N;?Nj3<%+5?vӈ j۴6ѳKf_ֆ%fgi~j"bӿ]²,ɸƍB?Λ?'k\ EˊU tfcc2cw"7?HǷ?\F,،6W{4~&ؽa hkD4pL)̓! Lc0.F pǰoUձdְGkecI&XjCr*u7Y[s$;r1# Dg(Ke] plb :\ߦϤ9qZN=HnΛlVznloCΧԱ܌lkC>g9xĈɔO)#ؐ')6bidiJn|I?\f.$J=t.H(m^M³OHypN,tW/GFeō2[WPeyN.dV7Oh`lsmkl;Cߤı(ޟMtPnshwM]c+ݑ=5_eϠ~&D(!~QrvdX3fܭֲ7ퟤ`߽Vm&y`cܠg֭}_?'װ6>k}MObf^Nn;v5PWs!1JcC# [0?75f=WzX=ҫ%B555uy,SN߶9tG~S}l9<_?Ied~G{/z_kKqm.sU]PVe]K˟,Gl:Ks멢{2*lُ3k/Zލ]uܶi~o8GU+8db2GT߼oxWY{}_LZ>^.-cbeёUN-WF30]C϶kHN5YYcp褘+77 Xdy|lFDDY4;.߮}< Ջz@'\ȻF]k[㾋+\g=c~^.57s[=оtc1ԇ9kϛ/\"$OQl@b]yָZk}= 27_[jdmh'p8aS9%2e)˩1N\R$ TI%)f}^y6:Kѹ]e$O;dnZI @:~j~YM3CC呙]ӫ ]IAc<j2EJ;Hq>][Ϥ@e"̿{gв I_2 (w< -j>R?5 /8xpߕA9XsNuHp#UWs v-Ň,?5?ꓬ$bӐ}zo؜ۊha?xKo3LWCD:"t'a>7;mM=zՏL]nwWQ>jiʰiδѭЗ=3#짃dx 149Z>KHEb+֞?ԞYk~CO^qz=Wpk/v7}5~ts]`]Ek1cCZ4pxh,&RI$Tʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$8BIM!WAdobe PhotoshopAdobe Photoshop 20218BIM1http://ns.adobe.com/xap/1.0/ AVENO-Logo_4c ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$C {/o.s^4?SL}_=/±Y>_q,|{3??Dߥ ?g~(Y>_pa?K׿H[ort?_zX?+9zXd?—ωhZ\Mgo++{'4vZ54Wrt? _˦ۯHbEzF)/a"/+'uC᤿vTC5f/N)s"}}ύয়?-ƧA" 2w1ۉ]~yt>ӗ?]F~5H6Pq۷هN_~>#u4qI56$&OڛA_-o |T2kG͘w/=O41YCw,_)I|471#c/M?L|M?|w~aG~?dFs~>p' e⩧׎O$Gώx?Tu㾞'_?nl4㧍_x߹h--G-7Lo'IAf!1'CftG͏Xo?WgWfk+sm{O[,?3k'Y ?\ГmWx}Gˏk35M>-[}͘w/<'V(cq1dx>ojMa4l~!bq1P~~kSO/i.ҟYg|4֩z ^o?_F#0nC [~yտ W >ZVꢚ֑7X/ ?x?7,WX_ơ 1>,SNh*|_tnvS[:suBϊa?JGk׫uMjZzˋ 6く_šY?Bn:m>5'/'5ij𿈴j-m $y}@Z~V蚿 zwY0JTQ_O(|t[Dg-[j?xvb%(_|/T!|Oŗ+I`]ş_c saWe}B ?>!|b|_'7)/!IU0xu+?@xG?7_&+5h#)1??{"L/϶źktv/?ξ&DR8SƵp? ?L'ϷX2ԩy O>O_" *_\/ϸQZC*dƾ_TC%*~"?//§!ge,z巑 /r)_ گ_wŗSG_|^|0/T2zN7??ԣӮWq5h~u'TpkQǎ5/?§!oɿȯ?|*MN Fu|Ÿ?Gƥ~(?o?zԿOC<38p90k??=?†>9('O!mɿ?3c'`()GSOO5O?y&!/gދ;ŭ0+>_(ǡ~!j/_~2~?w3ߍȻ}6W EA &|'R)WQ?MA_~2ޣ|SoΥ|W??FGĝk(S)~ĭo(kVe?f?N_ًºz>&k_4h)4ɿ?֜/H3~?ȫߪp>"zϟz$Tu??럴 mN_~/!Q?8~ȿdcW~j|G??4]jC"֊="3V?O?!~%??~z?U?&?Vim{!c?!ɟdck~?ȥe_ LL+70OM{oRj?Cg|'ߪo2º~v?#J|O^ ▽|oRl??emSO+9 IZQ?_?T5?_3?Y0?FKs?-_~r7Sn5?¢*kgT9?oɆY~~=>?c||WRh?kGQoGC~C&"<73?e p _-A/ZS*6ЇjV|Q3ɿ?,73 xGi/DkVO)zH? টm`S*7a_`4"*?F? य़[][O!iɿ? 73&&«U_g MFR?Y);?7Y~~Zc|9qWKG<ZM?QB? ?7`,?MZ>ڤzaWKE~9 [O|poXS(wdU$y~'RU¢ۋ|Q_~UF'p+mOZPgV @*Bޣ3 d*Vi+l?MŷP]|Nn*W({x?Կ~7t5b6ӭ".|Qy|T2~ۯO!3oSW|ԣU곈!CAK~_;_m6Ǟ1ԭuI'BmGjV+ "sVQ!Rj =O{:"COCf(!$yr t06s)`ij)kp% QkEJ 3j#$YC,ȮW UtZBуϰ_7j#ף+KVmeEhfQEQEQEQEQEQEQ\犾+kmkNq"D̾ӭLF*v*1rvGGEq?0C9xoU֨2~Ƨ'C9xoTHx/ /*Qe5?mEq?0C9xoT}j/;j+^_U0T}=OqQ\O4?r "^_UZAj+ڑW !7 9xoT}j/Ixb<}ڍ3~tR Pq# &>7g?ZS!cERG=/Q7~LTeaKRW9`}ac"N1Q`ioFOʚ|;ҷ5/cQMS$VZcgzcOh&)nʣu旱jl: u* G[mTn0*=Kf!З2M ?EQ43Q6smc"co?wj7{s3M =P=m0u Σľfd>hֻ ƢnTd̖jLnḑң:2 Ȩ.JfW:~4ZD`\T83)*?Jʵ.KMmiK֤/8\m)qңMRzsZp*&5>%ͦ/Q9@5Gq*kiK\?J i*}M TTm:~u'5OF}<~i;~ ~>˟L{ySOJ\Q6 L:z^#8-bbݫvJf)5W/f(5_ʘlqW{_Mf3֨o7jiSʆQk|E,~Z-ӏ^OڭvW+/k֜􏶨}e N?H_?OĿ:&ֽJݢ#Yz<^g<4Qש֦[.粧7'd{`Eq#?r "?<CaW?̾G;j+^_U0?̾Ƨ'C9xoTHx/ /*Qe5?mEq?0C9xoT}j/;j+^_U0T}=OqQ\O4?r "kŸ,͡nKFOL'GNNђoN֭3rD9VbȿV#$^ mK6? O_]V ohWmK5MX`0~=?]ѭ.4]KO@?,@lV\eI$rAJOQؾYOvk9zdF Vݷ#5y[߶Ե{_fNrdZ#k}94[$νoyX75@O?_?ΏIGG_~E~/?skIG$[#/}M o?S?Ək}95$A?k߂>G5@OgA VaoJMMĢ4ve魎_|9;E7ޖN୏KoX5A6NiuqخzHzGSB6j7j74F?S?Oơ} H߯Q??J5TFSTF?OʢT2)74ק74ר4ҡ0_L4}Ƥo(5 o֧c.߅J~Qv+24:iRY xm?*Oj6r7QJToҦEߥ4?JiRRiܨߥ">ҝ'A/pJR4"_\7jiNoyJq<_ Cj>IQi1?J?7G[B W\@տ?w?U[Gn?M-,cv7ݯpW鹲_\/!g|= O)_ʹeļϸ|Y_W[k|k{4,P. Y_j :,VHU|iWOծsW˄.k?<XN=;_O o?S?ƾY|~tH??:oW/}M o?S?Ək}95$AVaoS[E~| |~tx{07_ o?S?ƾY|~tH??:?ռ?mbG/?sh_,H??:Miij%j#P>_j[_>EM> c' 5  +rV/W׏)p6'ʸ5oV𬖫%\jZ ?S_,.pLE\U%h&]K98Q ɫEWڟ2QEy/ YTQVEYW.>*| Ő[$?>gce>@ |bތ^+ڧ_juQ=ƽgp矽GC<#ۃ/w}Qp{4no渿GCP;O|=ۿ@?GkhTn?5> jiɠ.~W7]7M:?S7_<4J<m Ѝ~wƎ!Si^"ĝ/ݳ㦿5*Y_Nͷ5kSJ׺׭dl_x/=r uv_՘Oៈb> [ }fD:Oԣe߉5[ RAfcd=X+"iؐ<֧?iGOqē:U0_n#'QWn앚ڿT~G0¼^1&4T_Q Q'? _af#F}G8zO~)|<־$jD2$Ո3X0η1V㨯jO楣G!_iru>>m>Z+G0pE~< /vZ+=MOTςY]dӖ]ξNZN M!ZN1 'U񧈴{;+[đ:)k?br>OqGCU0!Nw喱{??Z8G)0pBSZU|E>&}&ݣ`8+! #aNy3\h9.-QAIkL ,RȽ8' z0gJf`ɫ5{nگFyM԰8u6Ҿ^q0~%[#tvkzWS<7kl2Xai'\" |5Na {%q_Noivq61FT`W~!\T%U(kVLnf*uqPZ+iw=φ~$ O ZcIU$W"zѿ~ >Am ?O}+8 |vevlgxZRRU_vO.cQ٤lcmH88=м,⇅ִ]>Q!%NZχz|GHs5G q:i?wq./'(9(ɵfnSCt+7e}>eo_[֙ #4g"wGK_~7?+sZ4V-hY[T`ο/H?|?:W.gkONWEkVJS%?_?N}}_v:h6';7,9+*K^:tK-+=3)2L//c'44֌i,{w1kϷ}V*]O[WšyͲ}+~Ϋ]Ɵ?i#Qfo[r7K0$pz5 {qo }|@ԭ +BD~Z'Vb&ͱd=O8KMl /4 O2W|k8bhwW|mR|geCWIpO~&I&'Z[IZ5/ A9?Jusqs6ï5uĸ NEJϙ7ѣxʲK诧g7_\_'_׉UZX$rʗ#c{Wޡ_&a5C/?.K1x8j,䓲w}=pux]>G.JNn+KÞl:g[{xSJ<N0}q0$HR8г1s^*9'ugk0ܓ_F.J?bo ~|]4a ?d@M{-ަų*Ye5$ԯUo}yO;?$ bnnIB+vk Tb_"xx_IO aI|H#??W("~wU^w#'?šH@?_D?!`忉|=lGjJ;m/x~ᎦmKg̥Z9 W=S+XBicFQr8VM?ppj3޽fش^ =>h QC OS~U;R*\)uWK5iz>F8:Y/񧉼/kjjZIpcc|W=JVl WL[6=u$)5K9?j |F>&z~k޵1Bmx;M<+`k_tKǪI|!2` 8$WU*nrUbis])+9E)4HUBP3I;wJjSQjާe][-x"wk61^A?xSҽ1_;ş*/Io$ƾjb;ek]b1p:6 ;|I R/ί&R؏>q9e_k__ u#/m|/˨FjmlMz" i:\Gn5U2phQ]91Z> (P()ËAUɠE+y" _{V?a\C-6 ExZ~H|QiS[_ V~O%H [ }fD:Kku;դwƃ18װ 5Eumc 8yOVJ&ϩdm\}o]r\cH᷂,ǜ\?<+(;Ub';m=ҍ JъI/$b.7b?{-?Q[~l@~;Cn'bhۉ.r<}}2So?4Tmo~c"o~87hfs/徱z.(q0Km緑࠿$O^\>^I6^_ ԟ?Pk|hScᖫQ JW& G(~뗄xy6e Z]^tg\s }c&u+(VEM'S\~>գ0ZLm*N2=\Z#5B%Vj?Q*<;KxVs֟2ʄwQ>4?X#ɾ>J~?[׺~|Cq;Umu"g,~( Ů\ w_u>Q6Oot'ςWFon!겦N0s^)ӁUb!(4g츜<+ҕIYƺkyQцXpAʺۯuLzh۾k[uz_=R4񔶒OC6΄?nԍWal&i;[j}"Skc)a0Wvm#zI^Ri/w3+ȊvybSl#XB"PW^U11v[%V?2,,0WdEWR,6H ('+sO~˷igC~k*O>2rljnJPyn<}|WÂH<'Zo4Wzz/36:^lt.*;W]ц#j 夷Uцl 2<=e"g5W%kO:M\.:zKi8;s>(DE}ӥSiJ)6?UTp)t'pQB+xͧ??9_kATG Tе?j~d2Wve'ޖXq?r[f~~k?}~϶M1Tu_??/˲O8?嬼g|ro~ |m~mzxVG iA1{V7 ?d_/ ּDzs~ܾ S16\mZBaϚ!۷k6նzv4?Msy$2 tuè#ظ2zf8L5#{_WoVx8]LMWZ7 >#qS$-?F<[//ZWAfO1_}1/?DO2^JF 77ʫ{UǸ? {7G[S^AZuW qH?57)hOYG52z؜le U+s.wm~* 54潽WCTs'+n[跤m.q7C} \~jUXҋ/GZQh[е/xDlm.fvR)+ F]*aݫZDQ-uJyIEC8E=${?{f9}LgJ{t}+6<#kcju/+X 禋n?_ %EןYH _-ZkymRM|QcmBǸcFo>6 W>*dծUZ? Iu#?b#_3_0XZ[aZGa28*"qv|MG?;j2_{7ޠfցHqڟ|Cm?:Lc̓ʱFRx(ࠟk4fSM2P [SA^SG]or;J`+N' N:lwmυ8+ʎ vz4~> /t> /uZbu'ʿO?ȸ$~/g̎|e[ mCx'_Mu]}|cžc@%Ze7r a*ÑȮlOM^Ժ_I?֏bԿ{tR0|Uo_;9U[tW~Zxz[O;yFjAT_<+ 3Vu2?6>H/_o>|_Wg\᥄'5L">YC+iSM~2Jb:[QWGCtOC|7½~{W]&*b y'׭i>/_/^զ[gLvT^W@?b4}O+ :{_u>M"(o5\m!#8S]{h<3ϭM?e؃?WYO**8}oI:uEf~)f ( G?x_mS~6Z9%|?(|?+3G/ 5_s3/y_2'<  gl#y?¿x\ό?Ѡp# [ ]s2m@NkکkI?_fx/V𵞗j)oא~ȿ -lj a}?u+c.(`t~/9g_V ?W~?5-R_C6bəozѯn??i˦~VdeQ;6 袿?<S2q8ri'ms3MZ8I<<\VMt2_\ny$bf'$a 40\6/Xm>O O8-9heJf;jeU>Y?~:vk]]*]׺knCl`/\uWx캥y|ۼм+"+t+·2+j;uMt{=okJ5,vjy?4|q+(&|H’ZAE)Iv{jtr+g#ֿDo^Դ=N%TkyT0G>/ Lռ!gf)QDZ\~}c ާzzX_eYci-%tǖ4Z_h դ4.:/"N} %tSMn}oMŏ~ dɲ<p+ػ Bn#btP+kώ8rY.k<4WC/?8k7Y5Ĵ=9>Ʃ| 1}?4m:9nN?ղH?ࡿG+_i+O700Ȓ???igkYi{@EhX?w> xMKW6算5т?2Mj_Tʤ ۲]('/i!Z:kw=C(*4H_9ZV\n=4 sy20?_XlcW]P? !hZ}gGR <}e󝣧e_#E|M<ŏq#K1ym_#onߋvu#n\84уVhV??jH[|M NMwV_+_Le %8OuTm7 v? +3Tq^aQJ@|Ay'?LOxv0~:|.|-G!㑫wsXZm鸶R+5@x;Xqڿ$XF41#iQ~~_e9*,:Š8z qC^g5M㾻7|RU;6<$qk ǽkC5~"=Fc^?~__o-:kpltG]ﯵS>iG?v|1OJMon#ǥ~ƹi>2[Ey4H7,Ðǵ| |4Qn+iCGE`$zW~E~h:KXķҮx}z{?| E~vaGqXgxWO껟3”*QUUZIk`y৓._PUq5MZ?*,aY {Zz~=־=un?^oڏRT}cҽ.\bxCҽ(1_;ş*x]]BN¼gz,sԧ+ .0W}i~Xvki֨ȾS0_{|0!_Fx?WOs^(Eٍ{'5GlpF%<#sJ0M=~8SOx?)l E.10F^kt*@<}ioOioO_^hq>0FdOۯy#y?y#y?¿x\ό?ѣ}?LO?nl ?l Eq>0Fo>$>(Cg fYdRN?LOe8slxLR}V~|6_񕮃xjo* 08^I٭=6FH>a~?A_tGk|UlNWmvcƅ:5:}?1QEzǞQEQEQEfÖ+w&#ov~W AgQ۽U3b> Z) =gTY.7{3ʾ72kX>Âʹnc WOg\Q߭z?]gG-27M=Tג_FSaቤ٤ףW4ZY&i3놟~}Yk?M>iAYk?M>iZocUayg7kK~#_?-0UviV6Cʜ7N#GէOgK@5[J~~v>xҮ?_8?k? e/{5SoWP+_{'J Chx+:eoH>9h 'PݾG)y?#z8XyMLg~y=KVK, ?ZuoOU[F#A=jCXx̍Xw濵r–7 Mx&?19ʍEf,[3G,,$FSʰ_TPf_@>zeP2~>~?ůV#n' _gW*ui+գyG_i|֫#3974~O='AkỀKKGהaC]qF2kS BkvZiO+RX:sWMY/aW[|?{B&MofҞEiZig[fyl~*xCDcBVNGOtoj,V:=O!'8QN$u>+j&75ƫr'"$=p++ i [dG>b=Ҿp}ѥ+0zW_yG߿̸7mvij9J*66C_K;>t5Ӿhm{MM~U!_#H. vǿesk?nMa+dl.FXlѰ~lDRHHmduʑ 8{k;wL;iNPf{~Һs9q ϧ+D~iQIWj[tÏ _Sz1VOڟ.39mS w Fj}/MOPxFҴnF'OڐEJo̿ v 6OKo?¿JIK4޿X:cMq^ p$I%p*3"WOHt)--mmo[+T$}O^媳s_G9}mCV{d|iak;~omڕ%}kyWD߲|,Z%}}'?DOҸnKl_k's.Sw`^I񾭟 }~C_7묟}xG BjvhUmCO5 lFA^y֯ߵxS~"=.$o2ݽ }8=k7vO2elGc 2~8ߏuGp"c*O8IHGOxU֊]ᾦ)s%zŇtZ[xMZ?*ɢ_^ 8gq[/?1?k$&v^c=l ߭|ga^?GKa#iM(O=kSS䘊4- dU,]9kz~(IxsKwC(S=Ou׎'˫Xꈭ[[A0,zF_'7e8*l%h3JV?"tq=O%zvsWYˏ/k+@f19x\4=tm߭f}G53Ϯm߭f}G4{0߭mg4}G_mzCm-}œ+B vg>4wnQݪO ʄ|?jmcˏ6UoN"x_W~,_zg[|7ڪvP8yNki]qleRNRr(Ѐ(((wo5>ib&#+F5`ff8IN;? XcggxޏVOg?(Oҽk2/&dȿc_y/~}^  pߓG2d_1~MD<#~?Jdȿc?c4y/eGs׭ke f4u?[WFן(E i~ɞovo nX\3|$ּKF\v`o_*z?ik׍t{%\ײxY#7b^<uU7J+'#7>x){KM<7py_Z[jzfmwv0 DmP0Z3C"F1b+|!sK;&]qW~~Y[>=?ֵnxW+|g'$N_iik_u9ʯ9emuFE(}`} L~F޾ȟl~?PǪi8$ ρ??JRw :_O]_MѶd${%kb#7ڮV76n|]JjmGK-/h~tZ4wcTGNA {\U]h-K\Lx<56~5 <$HpLJ]BeSk]UO9)Yw0GPP3jO#sctJ !bڠf_\:MB*?~KIJɫnK}B溶GIa]?7Ol@_hk??4N5vKڟ-??5-q4OK?K`j?t6'Iƿ3ᛅL>?/?C}OIGm.c|QXi=?=CfAƗi5?yió|5uOI.4&~wy6{[{t>o5~_蕯}>!~xn.r[F꺞WV]Wuu?c4!B!?ƿr۾s[j3/W_ƿ3?Q_'l}?/?g?%!Bx'Yui ,r1Ɔu?u[j9`t"4<-.+ܒR-mw0qdНend$r11)ҿ[+f~_SK hv.+U[k#zx~#}ό`/}B&}Fs_}ڎ"֒y$2CFHLUIғդ;yMlM(M)G?n"g]Ѳ=UyM_|QG ^*ѪF ?m7 %"%/Qqz4yf/K1^I_W~J?_0Wgz~)д{ i?}9Y׼શWcb͇c}W~)ˏ/kдKܭW׼S}1գͺc2׮{XO$0^>?c^2ʰc l/ZdXhL8ɯ/C!%KiW&EC?  pߓF%,_(Oҽk613_ 'hC"K?Y_K.&K.$t^ >hϱ_^ t z78?AWGl>8 YG"Ä GWl`ھmZ( ʛeGc')6*zۗ[]}w*ZZ{5j-;|pޚ-5|U?k mV?ٟgG!w*Wfo/<^4w/Tv RJr RJUa?~+^ }{}j>R~u&b1?Rɍ*l\H~z3GCe$,E'AdSI}jYYGr3GRi4~)2To֤= 4D-Tr}ڑ OPh5M7iCP\v = Fr=*6CQH oRkЍC񩟧Pk>mJR*#1 }1 EDd?*ROʢTȤD|^x^#GJåBuj^#oԒTr}E~'o֧**S*YG,駭;YgIdr}QVߏ_Akr7QJToҦFr7MnM=*J[ 5*C*7H78xI}iK"40 j1ґdD~Cšzӛ4JqM~ 5%GƆ?+S5?J'!тw?U[Gn?Y,xh_4\l-FqV5}i5>?WXeSՇ>ҤxWm>x/ĺV=t^FtI?g»"3'tfb:gkdtφ˖%pOOjSCD43Qb_/_KF T佯 DR ''GU/P ?? zV97O2F ''GT ''GU>G/P ?? zQwS̼/'џ¿ IN?Iѿ|K?-†d/P ?o?y_򨝠M@OMvJ0+I5|$|PtR0;i{"v}]{uO٧IZ/Uem*;U7((((((+ /4|iCr1m}t+ ~W?ZL<"*%KUc>Kgg_ c/˪Gs"As8=k֮vs]#fݴ+U^!qdl%Px&h}(/2}˓*)ǹ~Wmgڸ(U?C㮏 {Bj祳m_ gYe+UVjIے{y(W]D7^:]k%\ײ=}s5f>*WAw_|?+`;O_u ҹ_u ҿ?|A/APߩ*̈u5{GSQI:TC j#U,娏TKbG/CQ|1Nk2OyyA@X/o#Nş_Mowg#WrxrQWXSZa>?G /Fog ?p,j~̷6?c?3> xU7︿?@*ch6{|fb?"t??AxQ7__-*+\Oʗf##E> ߲owN#__*kvSS?ȯQh ?g GG︿߲_q0j:Oʚ 1Uٵ)bh"?CN'_Mo'#WymBOʣmدͯ?kG% '/F OW?︿:EE~_)"?DAq54O7//FΗUh'S["?G~Ox;}q5~r6n[R~Tg?j??G?Cn;?_M7|q5~po1TҭOʧ>Eo 8q57 G!/F4䟕DU'S[K!j~ G!?/Fe?r3j:]oKSJKRo/j~ O︿߱K___GJKTO[RT[K"H)Pb'#S,x"ifDdկS_CVb'?憎?N7'O/E?VDt;էK5+C\߱7S_L?'xkDГ*q*_Q?e\~;?m}Eȵ1*R?eWG~Nli?"_ʘ֑S:_~ 91'//E[ Ǐ9Q-~_8g}N@ 8'1/ES G1/E׵5cTS~!qn?ދk_~~>"~^ 7V/.K `d$d3@W4T(iG8;z3i wƚ𮢐M=iZz`Fz_8J@}cC~?O㏉Cx3ҽ %/Pp_;ş*//dJb+-yG px["}_C)<{OZw-?jhe8A }?Ob=?J#ZA[xgñ&s| I&-DX2eJ)k> .kzŇ uvxVT35Υ6b(gS䖿žt=>`*Ҵ)ikf1IYIŠ(QEQEQEQEQEPFEPct xO2|Ta7ּkCڽ۫U-w:?/_+ǩDz㏤G)f47rO__g!Ԕ$>lUߝh>'>gkʲ}[:G{oۏ3Yrtu^y_gCjo bbdRg5kZ|;U@ޟ..N=Ӟ=5/WJe/:w?/q-%\ײ73^;O_u ҹ_kNY# z M/AP߮dCߝJ:OԚQd-D[9zGI/Cwj"¤¥Ȥ> MM'Adk3HF~Yvooo&Hwsc?~h?m牼=cE9c[t)Ӿ{ka;0Zȶ?/~{{' Hλ z5wkHh|l~  dg޿IO_5GǦƚ_M[;뻈I *̙#R+* _"~+U;V,5%NzKo1ƌPZW {h'OuT/֥y>_[vrsӥ{'_~+i;ltF᝹=k9feMVr^4g{OQ>5SVcSK\K=3&:><~Ⱦ.je`[ LRxu `)]RG7CQZzSKX_0́:g K<i)kK4uD>Pq!anOBM Z|v_<8¿U:o^a#`~P8\˿U%x hf7ZA{R߷qXoҺut29:4I}i'D*Cң4;MPc}֦M=k0#=iҜz_ Cj>IQi1?JJV\т^|I_0Wgz~Cu h6?0x_9Uٕ?)^_C?WT+;oE?ֿƏUn6Q+?,o9g?}f~v/V{Yawʗ_ʲqտ:>}[~>!VꮵGs]J,KOS[a׫&]*J1{ZG \5'_I[Bú (!^޾Wg}Nef~9xW4(/(s)ƺ܇QEEPEPEPEPEPEPEP}F=Bh&UxC ~S|n/e?XeVh&i V<?ҿXk |@\ދ]"yk5ݢJ}2GJ%9mgtMYsI`9魏n\pJ~Ѝo.8-+?>z+@? Aq__˿?F b ]pn ( Ϙ0^k5V/?֏?l8rvEn{Iy>_w?g _bjOt6<{(=o%_n_W#)Gi_kN7J+N[# z M/AP߮dCߝJ:OԚQd-D[9z3>^LQlE7}*3I7}*3K*;I}j:NPfܓI;|A?3"4" jCt_=6z_}x%յhجMzunҾ+im~Gd Gt[-bןjp:ю_Z^78|&º:ʸ a~RB=|Y 94X#m'FVf"+b N4{^`]GqC; f=5y/ 0JbxRCqlE(=-uoO"pg_ xj|AxoZV/l&0̪Ҁ˸sW̞/>94<-x᯵/x&9/w>䟭xXŏG?J$CrBK~fk}O?5ŏhwhDYU?//:7xA<7İio)@X/|8L:J[ ?b|#kڶi˨C5 $E@,9S+T̜9ݖ!E{?SZ/爯n kR[,ŽW$Bcz ƾ(+rGHAQ@koQ0G_?K{TOIW/pg )V)(zE_jo/SGOn&~ZE~&^ U8)Uxq|; \qw">ic;]?xVemZĭKy #ԃ۰[_]#X >W ȏ :5)Fg'BvWOKAo_6aÆu?'6s,?o_9[1_{~Hq[(,eT"Mt\@_Wzno?G'm.Zk{yVG WO3-x'_j~}]glA _jLda `uYRJ}kc l3n?~%gɬ kH l.* OK??MOu /n%'΅^W#o_ؓ=|7zVx.nH.A˱#J~?]x@ޚ7[D*aF{J Mlc{+kW߈0G4Y~oQ$F:riw4n,~FV"3_Z*¯(< gAY;wPBk%$!~%~Nk? /Q h']?ߍsWgߌ~֟h/[Ev:C"?PWY/eV;/\Uj>8!gz]0j+5Dϙmdǡ-~W ~ è8kګzefC}gTC| |G{)ojD..*$&} >'/m+qOO_9Zٛ~O[["5@ (s0}*`AVmj,ą5pr@#q_D7iiGK3J1zTRVm??:l|3f[8BO1צx3|u!/Eu5-х:öM O/_u\tY_х~R>(’?d5spLwPs ^iZ5/߲„5QK{xJMj؞F2 ʾue}Kkh:_[MG$w%Շ"N>%|[,WOFڗm&[I>~=l/CMڳK( =qXzqSwSjԋgs>|~]KVO>`\eW>T#DW:fa0*+JGR[QEtQ@Q@Q@Q@Q@Q@Q@Q@Q@#|xq҈gF~߰tg?*Lߢ8 :I <+ο8KH%e~:]7⁑Λ8 ~5|V~F}j6oFq_?~#ӵo$ #j^6E>0n5;&27 oҺgGry2hmՌB>xU濨~*qqQ^7ݟs BMԤ_zb^oQw`Cڃpө'<{1SQI:0?7A 娏T?Q-֙ޟ/Cwj"¤¥Ȥ> MM'Adk3HIs ?~cTƟѰᡙfhЃ^ axxWR{Ae G5[WVHZwexRRR~>O_e[+K{b~!D&U3xgKgA?d?5O ykQ70oek81ňMp_-w5|A*b MyC w(xVVjVש~Zw> څڼC,?]сkO &nIqIrѼۀ +o/?QCr#v~OU=W#w-wn&A#jdBբ{wR!?Q_w^ ?=ݹ<د?_ qV%m*M #ŌQ:iVj﵋tvYSFqVşύ>~ÝjR<Ѭ/\2/UUE|T6AlmmdX##'֫q# ̝)fNj/. a0݂z?* qn_k|PG c޼uUe67>f=*#e|N*2޸Lj<;Cat-/)RC"pĞkUX+Z qY"Epz"A]B}3_5#|&M+M֠qbH8|xx/M[7j,q̣<2Z _z7|3㯰Z8$ dߵy$4oEs[':o@Vh%sf\/~"|? m$=(x5叅?m^>4Y$Mt ka1 q"JAoeյ]}DF]۰Ee+nϊ߰3?ђc7g=k9+s~ I#ˋ:Z"4paqAj̷:/2:aOPi-ֹ(_;ҊJ+c (((((((((((((k_GQ/Y+y-n#=7R?#_kg~_ufWT3iO+PE~jt ?쭡zvb mExySm.O=LϘlu;8線;y7 =Aw{W3~(~ZxRMkEWȶ~Xt<WPXA_ ZJ=сVֿ/dx<(_|΅exߵ >)R,oכx77w5LǣZɅ?ߵS. XC?WK<+[ EyK:w>OWmY^DZ8(3-FѼWf;oz0Ͱ/woo?-~J׺|E<2~uFx.[ɌQ(|!MGMS̄1^}o3[CsO9[6gKLT#5g?q' 8+3`_VxTcc}c|B\FyccC,ϦvCr@2&2%?|_kE/<}V޺mSྱf̰ ) W:ƋZuk݂n_q_yFU ^2}g;?NOKNoTg ݫq*˚qtZNwϵFͺ;,j۫j棤ˉXFGݨ~?S$:j~jGQ?ZMDmXnQjK+fڣ}>5nL>\d+3E'bJU23sVJ+&F8ZG#t54 %cҢ=jjfZخIF)SVQ??J\HJtbSڂG2nSUw}ڳ'OʢTHJB:T5Yq *i `T/ZiGjJ}ƂZB)X= FjZ4D>H EFb_JYBЮ3izTΚzԖ@(n6HͽO(!Q14XԳWi٣^9 >X[ \'?a*[{='M@9[KU-}5zF+zYVկd^ txQVVI_qS_&5SSRb~h,k1W|3GZMuu1B42HRTp#n*Ѹ+q}bttOVI\DQir;,-FV2鍨ȿw!~}qһ9oUg~.|9jvks4|lv"&z0҂>a< +[5 JUpO^; ~ ^\jrᶈձږ_2cp$?JQb&OSѬd;kxWs#UNGō$AXyOߎ ǟA}pr-Gq׹|)R95y UlNt>o4 ՞#x>Kqmv_{8.Z<0n1ھt٪W>F;J0(B(((((((((((((NGUOZu"<]IeŴoҼ\u\}jb{kI$-&{7sV35M'OVpuށFiR׫GA|#'=9 Z4 7[L^XqF+~~nYoI6iƍ^ f] wqO9V}IUNCnNw˓#kͼO [:ݶszђ?&8Zc{?>L^ 䅊o*L}?Bk|gş\ZѤmx*b#'s>wpǤםև>zwv=7Z.pAQisck}ƛ'QNod+2\5}ʐ5}:CQH F&ߧPjg=ϡj'R_Ƣ~ccTO ~U¦E"&ƚƚ:T/V*S-"G%Fw$4#= FjCo֧c.߅J~Qv+24:iRY xm?*C_ӥF%ToҤ}$O]ÏCG obfϫkFP ?ѿ &m|&Rz/ :_qx{|KW[| ? ӧMZ /Dy7sɋmg4 WڽM] փL]:#Jv8ֺ`U1KM l(dQ@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@P0=RQ@\6JϽmT^}rRWKgxW/q^Fj9-Aҋ0eg u|k FAN· Y CY?/|k ZhX6S ͧ]&οX56w߹^}mt+ҼFQ|8M/oxm?"d&庵Ͼ+~ϻ5~-}-+nzћ^Q*$o󍯈 lǃS z}jNf0 N64G+% W ckqzI4c㚱:%9tT&{7h;Vh)W$5n{swu 2H3zՇKNS[0+5#+`<ꍹ7>|0>)G䲟QA/_(]/U,OdqeQ`tff+eG&V>]gΕKuͬ\=I|:h :dumF_id5~۲+}%-l+f  }]kKL](]U#q\d'^`sM8wŸ?{V7RuO%~U+Qxg.4[[߁*lƾ/k'%JW_|o|#qד 1o_I|CQ|\XM6M=k+?q_ n^?xsY37?Xr q+F~IqXw5nzhW5OơԮxQ_Ƣ~+j'H?AO?AH~D_Q?*dR"oiNoiPiBujaҡ2$rTmJ"CQZsȪw qo!ռϺ2l|E:1%ݻ/ڝ9M* MB_d/$|\G?.4?Yk{|rC˗^7N;?xʛBO')`͵yf8 ]Ïw7<9j@h_> dzF>yG>LWK|vծ6ojhasv3ZGwĚ;vK7&2$W'dG\ -y0W+\Ĭzc\}b_OfK/3wM_ F-pD&>1]UKڌ'`r9)=mdrkqjח''M8 I/- in[2Jg[3je5;ߘ[K!W°R@Mcw-bvw73Ad>u>U-GumS+O^M.OSέa)SMj_2H{GdDB=[5xǝq$jǔvlN42J|k0Q^^I_v"GjP3̮ln[eK9 &AzTψ%-]CHԾm zehm_澃 :?7+MlSgoC {u_9!h%#$F{v-2k~ζs ,~*ѥIZRV<ڕ*MmS ~*ч^fvn_澖5F}+VC aG^ٝmmrF=kd/^Rats j[B>oJEFʝO-D(((((((((((((((((((((( FEIERaWץf_"ƼJ(+cs \W?gkkBݣ)Z$QQ]$xU[oRZ6t&#i+k _ʲ mu5]ZKA>~ELt{Q,> ־݃|A:[]bڼO:i>O(昺_ ݼς|mO#8QT. :o^7>k~ʐAfƞ־t-ء"GzNMiV igZO+ǘV1ܭ1_G>/wyr}5貦^Fχc]1LμEƑ3tVbCY:Ūiz`fc ]EX)֧Q^g7L|>Gص+UO25ޡ=ִ3\VhFqJ|CĞ o4ōz?Ȯq6d4wٝNJ~ b'ùXܴx?y4rɒ=֟?V1V/+vo}ҹ2S^G7  XzomTMf>ӟa |Qzև(8HJ';o~} /HO2?+mJѭ1*$r^ȷfz%@$ǀX3iZv2)>p E f5aLuov ٦59]#ᖿ1ƍS~5I[DYxKXY'= `%]F!,Oֽ?ז(+.Ǘ[)/A]v[xy^u8A`Ӈ};dA^Sn~ݯR !w[9aOOY7Ec̭bZ_>J.c:hccۏl?ekNE{.Kfmjt+ǵvz'K=zq{p(+QHVUޤg~0^?V(vn-m@UmCWos;X6֡r=+ ٪}DK4H.oNc^m(r1Y]vB(((((((((((((((((((((((((((((Q@ hՇJTQ`FCa*U-AkWGGZR9־ޫ~*G:Z)½ƭQ?5 ?~ʐ܆G_Zo4iՁO־3'Q}kwƼT*KJ94c/cS>:~F4 f Wݚ[rW/x*?T}֟G4N_Qw2p~Q~Z׿bz8]Suhs+ WGV5j_~KlB~+ptwkJ)}"x<KC5T2Frt>VV^W{lZk3džoej"ωG۳Ipb8s0T_Ju4xѶܤngW>y9m=\ψ*uM'^%܏ǃWV;UV=*uQ^ ?MOvm[GW]2y]fo&1lWhO}bn $,1+uGO 5-b74PeoKI,> {kk"#~f >S:Ous,5?kxτxƻZ:K8cڽH/II/IeF~'}SO߈i[XB?* 7p4*eTѨhs:ok0?vl[hEh(bqRv:p((((((((((((((((((((((((((((((((((((((7NSQ@\θ3U~C6}b_SW1:kK߹_^xo |BKh.N72_k߀:τi4Bŗ!:W޷~6Q*Z~U2dfʋi, Zކʟ¸͖[y8VϺb;|qo}j[ a%9>kk ^R5Sq~z Qi+'{J;cj*J ֹbyo'D FVSo|iP7f;qG_S-m@}+fP(Һ9yOonWt wZ [@_ʽ>->8ԫj5 >Z*5mZxrp>EZ@`QG(sacB()h&EPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPAi[E%rSEvQD~Tش(VԫjuB1EP (((((((((((((((((((((((( endstream endobj 9 0 obj << /Filter /FlateDecode /Length 109228 /Length1 222440 >> stream X x[?jAںBLu BwuwE]+;/kuK_9B~Չ若A^!9Eu\tߩW?? |)Hyȳv@Q?b%ܗTmTi&ȼQ aYf@d=2IPKՊIhQ4Y jMo]7WO<=y{=QIέ\O3+fΞ[%.q*Rojc/A0 ܭ?CAytz$:iE"Z^(DzI盐\[ieZ@z=p]T;W *?FTXBP/##}7ѧbj{/F 3b\K#.AePc xݣk[݃iF[wQq8?h^[Q){\>>؇P+k9;y0jP1[ $pvm~P{C>bN^Ta':WİBF?GA>zE,}ތ(P5;? _vЏC `v.f 5{'QH! nu>?q8?Ag3/Xgry'&^k֙טq8?#yGz(~ ؍ˆǭȊȇ(T"-Bf4]>z'+-t5e|\STf fur~S$Rs @ͅPs%AMh!Z.@[Rs2B剚[BWBP35 t)q FjJSǔOB4U\Л܏PSQ3PUh{l8r-L7bhmDnA٨ %jPZUM)N ZLRM u1:BX>+&ħ>7NB$H sl\31|eĽDI,}ح@3q . p}+ҬIp|Aϧ\)91݁^):\׷w=] 淶4756Djk*JK [tiJ\* S|ʮu[CkrX?dy\6aȹzF0N2TmuXN8cn8c[s]HfZoxoX,vTrѰH b8pl2)Ψ-Qvq._5][cz8T5įpuY6kvLV{%/bCCLCW )C]oCَ!*kZ5s)C#hc1c1|cOqd9A 6n5ca.wk+ZaAag)S]8e_<%Qaìxnh kN6Pnb+VŸ|Э{(\'屾y?tb&C{߱y(QE2@`]G7W$Vl(zvYkאOyVC=Cj`PC~*nm(qt`.9ColRзqk7m`z0 Z?2HPKѪ2k7e@lpX|6`\F4k5T"m"i$7nPv&*mvҘCH"iNo$8H_ K!6!goo?)5 {#Y^%W%& _8I~A^&3?%8A%/ I!qx <!A0ԈW~#C @L<\#R'Lj }D[`#Vf&Ft4i*J@I@A@N@F@J@B@L@D@HL! |<,M"8& D L8M |F>nK}D~DC x_ K!6h&ֈzF4E$ƈM k@#Zߍh^%[!U+_N%_~NʽLg~JHTc?"!~08N ^k$=$n.ru'ymDp+)~ DF׏#9%p C#iWI[ pHZ/F#iK$iW,|_^k,byCjy!< BaC]Bx-߄ B: >BhNw@*!V@MFZ pk!T h!Ч" wD#X:ĢE6DB l p(0(&PD@|yB#r,R ( ( HG)c@ ^7ރWBx: !«~ l _Cx <'!Pz׈NB jU*G&F@ a葰B8ai%:h#0@+4h !PO@-v6x+ 3#tz:M-M. !9π)O | #W?oC7! ' E?c?C/@0qQG B8 .}zx֍(XCȲUVXA`9~}% &B]: sd"I IAG% PdD}¯ Ks/CqYd|+(Ⱦ׵7҇tiÈ.]]쮴]hgd{׎wS#]o ~4Ȥ v6xI<88:x||6:XTZoA: i4HqmP,ҵ-]얼-tG[7Pt` ն oqf[4u---EM]5ӦM{7ݻMnD?gtxPZwadc)='GѦctQt4DGϠ7ѻt RSF*ܟIgalwߞ|!,)fҲqћcџHU/Bt,U+kǢNkf h'څ.A{Хh/@Wj^8]CףЍ+&t3݊nC;Н.=kXƥ7ѷ#_Goo;@Gw!ĐG!>t?~bq. a4Q_gQ8c)=4Ys\_ϝ>яЏA2^D/g_*|29I+ 5-z @{@W!bށ㐓#y~ϥ$}E)Bpwǡ;8>ba<1V7~+|~g߅@8fOc!~ `Z1Z0 \Ӊ/ri#\NQWI} ITuLퟠ,>.W1_ۉcoc}'yΌ)}>FIW3R&Px()EΦbB )%$"N(H̒&bR)RKtzD) eIiDRr4\I}rhfRj;g~8ϥ|*u 8Bmhڀ>~ O2x2 *F-u>=VKGkjRrO%ԋ(wOXR‘ϿiW6T;Qkx~NOP?2xAY?96%d@;>:.t~a\\^Aa9 i&-SNkL턓i+Q^֢JIa,f+d78 2yl <UtɣdZ֜zKqwS*y”{2jgq^T. t E)eEOܑҊDZWхrMEҐrNeT,c K"uHC4na!+렔 tasX$T*#xLN,jîv񺐮"U[\ )}zC-AJ_֛; qJw|Y/9 jތ#߹[nqi4o&1]PHfiKPY./`|///n+:8i3Kc )NTbrj1È5&^y!$ӌHX#L/OX8bwb8,TU^6A萷b /A8ij1aKVf6;_WIX %s)[ݼ5-'FnEe:_6#.0o59jsO6Z+k7/,Pyٵٞݝ<(8=˩GoT}Ȃ."|IoBBuS7FBY{%¼nRd`k BzMxIx=}޾[wz-+s;G&k"]mݯ/ڶ7]O̵Чl4DzF UVBҟ;=R s햶{v{%̟P//D߯o8I5q Ʌc2' A*˅ѝ/PmbB&c'kA幵b&nsf%P̃QLo k&d6 2T@'RN!G\&8 9\oeT3Z29mS#YX7!KɔqZB@:LηJ,A;dXsN}P03QX!ᇽ5#g&e9QaQÏG~1ra F3jˏQ~[E1A4N>Ұ0_ ql OP߹M@><0*As-Ge%hS0 DJҒ˾t>NMIQU"ueuw}CyhMA֚"gr6}{KIZS`tkb%mbœnL|;^!"^[gq' 3bGkCZzuF+|Ժz~^L:*-*E,ĊNO?x!6stBQS\ԠH(_$MOp]3t`"VGErbRCBsA*8[N]$_Z .,Z_U\D'#gA^"r@|*ts.臰iWJ~@oht%DxXq  WGY< )C#ٻL}MH0&)4MYTGKEbS %tj6T&z-6!$.yWJ(K٥"װ[ ˈԛBrGq *qeP*6[cT4!|8ꑋ|rykcFhA&&DM7gf>1j0̇?%`l{AO{?PgƄ0Ľ6NYvLap6;B }icfYtE׹2o;bZЂ2WE-Syb F{/5{oGG[FWk>BI@ѨmB*Iviإf!iF_CG3xfk/DUH7L/f9@+~X.d%j풄XbV0N LkM6ՙ˿oeInض3;:k|qEWٿeѕu/Ж]Qӝ%6uq|n{P).f]lx*2zn4&ě)vB_;qv{[H?3lmF/Lzɩ0$L9K/Dh7t3hةJZz/u/`?:bA+=y|F<8sxAAQhFS8˃ze+1}!@.5M(%Ɗә?*N~.H~1SIPY I:[éapAւCV$uN/.N-)NrDsMԇޫB1v{Ϊ f~Fz K}UHCByzZ rs5Zgxr;֤uL UmoT:)Ng0Wh<,(6xڎ[:FEa b7An)3F)B$H][Ȋk[Zxwrzf:ZYhS4EF1[]=9*j+tX@r92=&+ɲ3w(T"bfT 0izyu<]1z# }Or8-[Cy^9\zS.+p=~U1*eXUWcEX+go7ewT,R1gf*Pg;m蓩yveP)$SCU-m24Wxj$)%&UqZGWXCNUT{.œeaKQ>7Cc/iQ2ٹݖ1*?".C'{ǹFM\#4"Kw rۼEF /E"q,(sž0PRD|̀ɨ|骃A5s&Ndr_ڼޤOdbkȖ؃_缿{ VƨaR̞>綤_}@'o~bl--n~˗b/{=ً]<@K s}H0LH),FKBmH>5u2D SQUaIH@ԋYN 3vGԉ94"j@q >.e({4Bfs<0zB/ɱ6DU91cr2UHY<t-dYAFl 0Լņ0/٢ kQDMC7|r>R'{JhrOD)0)8DHf^1q.*qȳ3Z|öT  YZ5a|0;sh!䍪H-lh~9ՒUm),ëvefRiԛtrg*SZt"mNC4@kPz{@EW;֝17{?@mFWW ׄ/oj.7_WZʯxζ}K}k\/kg { u&rc0v#H Ӧ0'qaT$ME'֙6%/șK/h $>7ZDSe2Tk}7O'S/_Lt_ BŨЪt{$QU(I:+z'sRgxh@Ka#$PH W^id8 cZk4y2SeWs~s}YyJ~nj۷u 0j)0jo#oGB0V=j; 2.UIUI|T[ 9 Q}_dō08Zͳʘw5ƙVZ kK[Y.K]Vp񅡊,J 1H!y3؝ݛ`N{dSS|Ȝ3[~pEZz]& ڄڟ@U#byWyGU}w$6*tgobU fR$"Uͨ(]smoa]P!1@,gk BꮞLu"BoJ-KNdl=cկj֖%S2]nKKѦkFp=@B?ȂY aUQ Dp/E]4DR1'yOI:"0t~>ydޝ_ Z#9BVz7 =0L)lj$mQ->Ob 9s|(6ܙ~o %w^Fϒ,4 [$ۄkގi5v?0 ۵VV=FZӀ3^dk./м:. gԔT4T櫎4;I~=FPY:3){q H:H +u2=#'w\2C7x g8/ڥE?2%y9!y+1B1=ʈl ]74iWOOЧib }Z eqrg'Qk!7 _|XJJ2 xl2_Hْw/Kd4%uKtZW*t +NSDQGxgجt:/44C?xt;̯2c;Q16P2ZC-Q<oaUfQ ;_g6{-vZilL"M:b׈=a!\{+,ia%z{z}^Ht[1oqk8>ni7jc1,'Dk28͛,naEy;G/Rz*+C άn٦ug?oa"g)հ!ҺYUfenirU] يy_y5Վ`/|E( CŸ-a奯 ZTocy90F5FCW-üϽ?.nj)̢_ǐJ i)Pj4EVܰ$)g-zp&&Т)eVuHQm@D.\=)ضxfw ʏ?w1"6$C:ʂ,MN2}\Qj溟H I''N$,A ȿ[yle'E5n(|Ǥ)HpPK(-JPC'=<\3k:yM ]Ed,oD[k_JO_tJiC^ogIŇUcfTOՅE[7sajxEu64N&T3ɣFD펑QWh\.1:]FIȝ ~)4|KgҔ {67F|'2ex)믬Ue]֑]Lwl5+' "K35Q٘ox,^MSb#8 %tK:e{m\cq<>]ua.O$IUǁC{0,fӠAG7kUt~I.h뀘wACڲz?3}:"5k;Тl59~KK³6|K`lC3SŦPFF-}e )6-_/ lV&,9Hla J4c&/êӧT*ܮ&f"»]v3cH|}aqh^h>mOs/Eۛ?]ݑOPUwxKKVòy#~a>z2qX)qr Ouܾ( +PK ͱIb7ӧs-uZ[{U7tMS=+MR|Q +VZ} #U4L*WQQkBP53Y e++/_U06i(e{)C+˩h<oSŚ0Z m:X[sq/6"7o$bC1z 0?%,R+ˊO`4ľѰY.E2K/[Gd+XbBfcY!Hifŵ/]}]OFhM}Mtl|^ ޫNͬK XwemW)y^)f|ȫ./Z 30nGb<-Rٲץy٘lU6m~ơVJ Vml?K4cd'1ưr7>A2V22NBuAY`' ن-/Ŏ?6({s&as㓀9jUC@ʍimU(-7߻:/PJJF.ieܳuU-M*$ehk+2>4q>BXYk"3qn ܹ< C_eSD` Z']u!P.1\xJŃMΖힺ XP )Ի( _\ӿ ڠiK|RTYO4@;ЖѬ,ӏ R,Zp].^=fՔ.ڼ]ƅufLz_ t:,5;#m`8݌ ne>PŜdnLX; S"`SfD)3c`ԩyg uRJ1f$Va+YNcdE~H&Sof#pJW`[v^cQ*li%A؞"qAZ!cW!!> iF.:S, pSn`CG=~ ;ђz{'`+LiO/||RQAV/d6%4%D-٦ׁJU]Y` f YYnl(DG:419A2]+4Fj4*Hzs\-ޘSpz@Wptmc_kΎj<E-y9}l)23BDr?ldziʫ8)@<bw`E~:vsj|6v.HKR.6\O"Xjb(dGZ,fG rJ>F]rWq7axrW11ϰs4ǖoa03&ڊ23 RYm59fG|ڨPO\!Tj ALf ;Ȥ"4@ڜb&bmm9;0F{7QQ6sݽ4y;"1ᑴ~i4XQ 5 6 7NָIM J㳐e9&0+& 3 m(~׺c"X{XdJ+Pܞsf-1A2aڄ.Gײ~GNЂ 1Q:ceݝExtrHksy$% .+$6'%i;NMnճ8˾ls %o@O%b)S2F"vf{gLی5⽒e`tSVl c6th?} }}a}z5.nUc+XR]a ZR;p)ԬitK5 ,T57"ʄ)t1sbjM"هt8C^Rvbfl*~GyJrMćC$>*mDJaQQ'&dށŤ8oS[QH/]sؠtۖ!,&L@1l0bvtaX[,bB~l#^l pH"KIs]Qu$Mو SKC_0DB?!`'l<˲{p#$ukuZ‘PD9coDD( |Ek%1GR{JdZ_ꧾs7vOC`_ik62I~__#o#3y{"܅BØaʃ*w,~L(,p߈-/Oo.#KdNK Lwt4<{Q׳3!ukjLL#uWdؚ̍Ӛ b:mVA6IRf.noIY65 ܘօ&ufF'B\/py0{b`Φ1b+z%fW2?>j˜d$eKs2.dt@E1y%*Gcx͗L1|#cic PwPJAuㄚҪ)ViZ_|VɲfW=UE*DQ| `'VҖE7e+p ;/Խ˪^*J~/j],ĭJ&F{;5^(O 4Z0IS9UjlS3|ƓOW %o_rͶ3"61J|VJu+D Ɏ Tt\3HXadDg˭VS۟9[|W^ ƺyi-F[+h_n&>;7n9~$ArE1RF7Ɉ7쨎(mtu3>xlĈ8" >|"ͩ(3(5[ubK3MN_Ge'"n9#$j5w 蝩oV <([0V"( AyU?e> JF# `5$c|{׫^z}r%l_ۗ A;K"MpW=ߓ2\vUgp*e$E.n ؃V|~r7enkulC-Лefh/_М%IUj`OujY#͒e5ڲ=KymϠ"ڇRUt3Su~/ 7VTrUrj1ưqh:۾oQ-EԵ-C <14=;yƴߏJv]UDuܛ*UI[gp)r;cR<\V)v9J25zIc64'LPfuZ~l]-%\M59S9 杝".V_sI|F%f2NW*ȁӍh}Rr1IR_m$o b nr M/|J|ڳ1^w. {d b>oW_5gpYy;*Ȃ7>Z Oݺ*l?n=BώFZ ʰ ɀTc>]0ytVl<[b ]-/p{!_3Ҥ-17>1@sSyvj 竒 5< ;=@_J]^|lU+k5rVF^,Y4aWW$;W";eKx 7%H꜓@Nf'Czn2)Kaʸz}#n,ii(ۉZ#H[>IŃղt% ى =m-y`5g쭝_^奈U_% v섢NPEk|W/M&*FF.EO_t'F誑۪1}]BU5XHDŽֺ/wW5w~U;]v%^o _/Ä_DŽn6)kN<{__Uu9wyʝL77 @0@ IHAAhaVmWmk@k(ơ_}>hu(j ~ks }~s>{k>b0 k߻zweR MVҶι`^{rzA_WeSev3Bj)/5BSDr;} SD?> S%"zff{ ͥ7n^fkCbJ ?`G.?:fh4dF"If36z97bzW\q>aqovم(\zҵ~mw{9 $<žBh?3B j}̐\hɿjF7 E#0}Tדjz\{r121˷f=zyTp05WfݱHIfnfh"MX==H× i>s8uBMӐ;5 FVWkjGHRd53fjbrK~*ְLs9H$2|ܛI5)*g;l3x4m֛+g_$ 5yu%%|Wn?ޑ ApCcGY8~y!_b#.J[(T5K*re6gVqiB|I Kr~K U!ļǎ)SFZOvs?/ h3:| uIaȄL/'ٲeK!yu#fw)xN,dTX -<ۤh3"GuNCb"Xbp;K$&,G9t ]f#\?LݸXf ~ ;&/j#TE -_YXLg0R[RSa 2K'\WLuk?𖸕aʜS)7lR"6tFmluUt9n);*R DeQ,᧒ZwTOx7X{Te{|έΊ}r­9EI#KT*1")pLeKIp9rR/YH&bY`7}yu]yN'36P~ I Vo`0JҫvSH팜 #cc{+jk&9SLLŃ T U+7:bApzj֬S9,jM7ɜ4{եj苯ȏ*P~BE`RuXl ?TXCC(׼A\^;uY-/69 /sMҟn{"C{~(V2$b+ĩY nwUؽ j(E!{Юڃ#I3TR={A&ٳAepp2}'L ]4sݞڗϯ/˓)2{0>hϷ ZfZ7s-+m*rR;Uo>4c%nl2't蒃yP &ڂWz#G z^ؾ^3mT ŁO1BPӚբUjrp:fl[VZKm2#5XBD4 Rkr2wCyh|^)ȴvR P-jF7z9?  :+)GJ ]  Ͻ8^uT*FBI߰hgc`T|w&oLB< ]z]>zA ʛ D"~RkR_򦄹@%9mwUPa Ӽn(dw\VW`M21ꏅa + ;[iӖz l2}n]QjH$ZZK~?z 4%oP-YnJS *TɄFj$zY<C:b$Q#6lVl=t+~t# 4iqMk]V;q7Xf;בzI Dp{!34Ojh߸oU^vI K_TOO/oc,+IT +G5%䭌 E#0[݌qG$/ȗd&*R|,֛L̽Rnƅ߾\w &VJ3WH5ȳ-9_M]9L+en\|UQbx]ZQr_G7Zn:Q SW6_ڗ?`Α*w뼟~o.+2gZ1 * [KݙJ+yc3Z%ťڹ%kیQX5uU| }~C7oe 먇⯵~ qpҾEރrbJTBwEi[T1hFF1d5RQ2|墬k^Q<&7ϙi?y7l]j=ꫩg:}5n9naWSh5Gjs3Qh+c2"@# (B4CAA5 p:kA0`D6|u6^WH3J6yra|ȼ)3FcsI ?ŀޠ1{׆`IMv<6W~\|餮jRӕzmebLU*-66WMWr,u axZ[wR[J0T;&O.NH"e`^A݌|ƘUR+.E%TkUf4 %r֛F0XlFSFR)P)*<|^-wFs@};* "qk.z\s̓}Iu~Vn+bv33䝼p] dHe ng7|)a3rs@h`Rɒ*Thd2n2f|+RHS+xTOLl|ʙc)=2!Jʥyڇj#~0Q'=? ށ ESԠȀ:qP D0je꧟? dFVbyzNվl=ϘPq©HBb0ӇtHFF@(}nvMz*an;*f5g6*fKFs++f+}NA ͭss;_guonlj߈77Uěf_/:*+ :DRRF+-`\4yuUS9{v<<J̞]A.!LMOħ6VVLSϑ$L#2#>(17烱ܢrwXO ZN5ʹ*u1A ړaDCfIgmMO~_ h/GTyxB.fM ZODҌ*?(.~) M^\h󒻖%'/^LΪ_b2FH, !"ZǝN`mVɊ( !:Z\7ӨqCI2b|.fp%} A|=بi#Tl$9!5zmvp1)RRf%،E|tfa?U?q`n}o{{W1y>K魉;Nκɚ&繸_c~[&;޾ Kmo`6g0?< ~qp9E"n^{%S+f%*960tVqyYmer6>ŬD.V6Hh21. AGO}' EoTMDRₖW(lp2oA;ɵK~G/mfEPMzBX )T_֙+v,MZGzfg&X"~_P6'&֓g 003ֶ_7KU2C0~ja|o_TzoFZko'l碻k3]d߇ /f|ak^$T!qSg[5YZX`tZ^UJِjttuYWuרSE=h!(UfYG)"6Öi%EF> #Y-{z1ErOW>"r[uJK /4ZbIG߫#6hZC5Rl1tvzhs E^d@a7)s}tܗŏ2CM2?8(+FF~uI6fluK qw_neq<>Cfgz2&oئzԕZk܉GozGnT%Zo2M5-s$Zљ1ko7ty-l73ϑ}cyi7̘<{'^?PWQj|sZ璙'\/#~D6^}|Á;vlpc}Imcsx/}qa 7^@W ֆ,aRui@Ȣn8ae ]yi-UKq\"5_2;"FRGf /M?5qs@.-nZ|K.>K|1ȴvpU F.aS&MEK#ӷЂWUxܟ\ ijf櫛T8=d"mF-ɕl7-;**D*g4Ann Sxv_c٪zޏI\;z3~Lvo\=dRzM7wGkƵR!C,z+zf:y7VnoGkfJg ȷNY] 1eneJV|\cG$ 1#sQ#~i~,*{1xċ*&9 sFbEu5'VY[[A\Z_5bWnjf6cGGKKKH&,2|N{Ϣ>).FN? fz<߲=9SڀSKX&F,EӰh*UbQ*ʰ4EXZ,-D)_>@ׯ=fv'M6+oNp9Q#aefL[}V.) sfjejQ-A&x!xGLj:>VP:jK'ilѲ)A[+&_3~#&-ZWu]Kof0vK1ߛ J[V۬겂Ѩ Mk{n+oL!_bLYohҀTxz>a=ab/U]: 2$aO+nS"E][ڋ:f\ozmQV/㥋v,/i EjRPkl<|">ΐMɊRޠaPU"'S{J#aJuUUb#Đ1:ܵ(s+֤VRW ?YW7XNĐ5z,>zvk:SeK,*Żvw򊨥za#N/nbGfKjcACQ|-v쟓71ߘr9 A9Roɱ]yy< َȎKkWFp}1oiɤ_[J]B ZT_ooKͳw=/;["o_%ԁH d ĕ[ti!a,퀯ĕ U%TVN*BR|~R*"O$J3 Zߓ(v? ۃ&3JMрcRv E2LAm2/[jUGOxWe{Xhb Oڬ:>^ڶƈBB>,O^WYetsbD}k,sq殯-~·-[Tu'Z~-J?YZ ~qZr 0+VZҵ/$Dwƣh6Q0]4G%DsZżoFSKXlӴ:JMw+Zy5V-LV n:cm_zkdH׿kk"N¼qy#/s!~YI}B(W7^"G>z_׵h$"L)+?eLun՘LJ5rl+oMĚ2=ĔUO0ѕQܼzT?# F+ao9#<ŀR#eE%ĖB2+a)^"]mԣ:U"l8ȗs&K3̬ u~R`n Rv&uPԃ20CʷsTb ǝWJ7'Vm8;~:Xft&5tY"^.}'Y;oкj Q!i4KXXcT d ("׎8;$ؚZ,jFpd= -D?YFbYi=i|'*RGPfvɌ]2SIȒ,+fb/; "XZUXu1M#{gy88 x+U+}i%Rpn5:VY 2_NIAd ~ๆ֨֘?iQ%]B, +7&S4N}SbmZ> u _ˬ^#[38VLܬsEɩ+QȂa[0'#@\^Bf NiENz9N*J7=ra/WVj%r%~ jYͯW /qmdr|y[p\62|3#:,by^Gfy΢2ӹLAPdN= F$GJ9ȌRy*h5珋rUZ%%/4I' qb5*k]8R#̇?0b|<=瘭4g _=2~Oy{Zȳ${`4KvG{& f-oಁJ|Y|Y%no /</xŃ]_]U]d嚳*ˉV813 ^'DF[5; ?e? 5].ZBȈd f:b&UK˪WY|~3gd)d`j塲fiR'=`WÛ?bo&3- \UNٴڨ/jƢ|T$bC~NdjV(&P%fVUJD=fV]zIjFLnDyw-~*7"ߝy >A/)ɝ6 (&W⑤B)e}2nnK̔;~ٌdbsf&=?74BM3f45LnlUI$;j<[Ъ KT&C`q[R鲗,]he~_УqZ-On];P8H;Agrw o~?so@˂́KN),a:fyöK45m,~-*gLXV|<)@̑¬.dM9~3쬫vL %{rzA,; @nj-:pS.F(@+b MaiIJ)˿âb]34(ȗU0RT$ jfN^V̨EjGͳlFr=AN-ֹvƨWKkg')m`B )T_/T@0vR/uau0%3oRop{>mzĘJu`Y,'x` Z  #PYO3RTjjۧ_*WU $R2 F\hҹBaOM&nS xW_"}۲UyvJ}d@&~U]R++LSQ)kTdR2dWPK7q{@s*^j? ^d@~M\{Gv] _bEhf+C2+%@tfi(5JWRbN β;]pz=v[ LVQ!3m*Y'H)tCc  m1w1 4Sg5V~SK=.Cr{,-F$9@a%6kOfo#̋\E U#GIA*EB &LM,-yЗ^A0s ʵZ|oWG éUjyfZ`UEG1f_?"Jx)6k WOfZlyOЕL#E(P]#Kl>˔#Lia"w_O]g+)e4qkf!|/ $RaRcױS%8p<\ bw#mԲi6ZY-sӈ`"TuUV E5jIaqIM%<(Sǫۀ[GʈT3te:s:0rEUHd1O0>]̉4L*Dz˧GkKf.YRؼ*a-C*;ZuҒYfG&-sTc؃PU T9$*LZ AFQ oϣ3GpJa'v!; "> H;E` (5{;_vpHgܜ Fm y0T %,oGrЬtB%fZUEF)vo,L4'eH'Trm@2V(Dp=4 .OJ, hL&B<1]T%a],ļm{,*tAw]—me,>f'Q)S/SȌ<(505$C|N'Nj<=+bQ13U܀]}z&|w7R(`~/(뵜x#Ue)fWMa|iG](K-/;WIkDT혒~Limn:DMSe%Mz比OKbv+֔\_TIm57QON=;}>4-j ǶvK?&'mrL k. 84A٠ӥ:IC^z-N(UJFuq-ty.2}yxOjPm嵎?{MNҷdmv^t[ld0^ffLY[9uEHyarnR>Ъ^V7-urB!1E̩U:9vK K&ݦ14n9&Ef4rCj |pj5M| \~cO_6YlZuU+mo_ߺ?Fi#GY$Hʐ}L$iI, s_K3q!艂s*BՉ9R >-GKjoO^;3&j\y#vA\g9S&O6 k_rdTUc6β\;[?*PVLkm =t:d'5tsiZ^vE4'L 3b֒?.Ib;1{N[!8z|܆Lȳ !\8'pK'yʹw|`k$"^"hՋE1|>΂iFaR~ rKxm +DZ$͇؏ On/A{2AUC}YϜ Pe/bn` Vix+Ars m[X1)E^ 0z}9գ˅\a$QVd}TL)G#YbP=org_K>,}$8vkr,%I%/H6)i$}),.2W߫ڲJ!u7Iclˡj._r-,M͡W!YH&q2YXK^ȶJ8g\w<5mF 8C2P꼂|-yT`,z.Eנ} c5]A/n+*T:HɥQlm.mGxWs'+O&UTRWWVFTτjSp ՙj>(^Nԍ$uM>X~)hZC5п4<75IDzk(Mk44>֌5s 5}Pb_54_"4[m@f?2GAiK74OnUK-@Ͻ h܇~g=3yz5H?mNj:uaZ_7w;}Fg}F|+V. 0cE@G-nz3>3>3>"FH1 aF@HjooJx K(HH?|0 q$`#5~8Kww | :o~BP㟠B ZQ-/|9U 9j.\k]A&( )o|5 Q_A;)Eji<sZ*IZ›gP@s&A&A~|oMI.hP>ޏm'/NN ʗPN7: \LVJ? %}j oVNwѳ¡%В1VWʣ'(owOb_Li~1/4j_Mi~5ͯ4Z XM  \L&vCoJwC-/OŔk@!] 0X@x協7QBsn,ߍD Ъ 5r +.Àe Pb/A>IZǰ#cHC$ K߲BG #{ oO '?2a_@O /O ?l D(G\8 ǀKҤK%$J%~H~I yJȓs?~ bSHȦ 'Z`@!  /p++ @L=@F/p  d/p9J@A/4KA \DI 8( ^8( ^ "Ƌw>௃r2TtOGI>͢(+m|ZR>-,>-Fٕ|Z T.-E 1{uBV>d ik-ti v>-EZ>--ٺ(" d~O+qtOP\.`3̥99siN\3̥99siN\3̥99siN\3̥99?<P *lԅV~ 1^/Z Q5@Q{ EH=VطE$~$[ 7 p^7Y G{w=l w~!_6Aj"yA [Cpv_!BN{ie&źCOtV8VBZrMKlq3@9Tb}|+ÞZ+W&9Rc;#m^s'ꁼP "ɌC۾Keoq.""azzlG>fCKL0|Iq;i ~_6_F(/k>l—>(ژv#g6WGW)p f`h!5]~U@ U`Ae_[i;:v6KF^W5esm`= 9V0s>5s{i@}h(Eҋ!j>(a3%R\M%AwbĂ9-8L{|pEl@좓jJznFZ]ϟ۟s*q;DZEjr$*!*ÎuIJ9]HƕI9q㜕,SDVfkZ_Qhn{s%]59 H8,͌Y/Azگsr^*.=D5oA}Aә-Vi=?e6QL[Cl cXIgvתށՃQO}wkOk@gΎhC{w.O׀ٿ3о~ǻV{Vtuol\Z9Zѵ~̀v;(rPOg? x{ݤPzww&Zh}ՠkg)PWjʮ5`A8k]g xzo\B<퀥 `É=>R  t{Fݳy~hXg4+L) A4S oi_GvzٽDs <*>4..޴iS's^n]޷vsս$_G-l tB r}58Y6kڂz8O7:>ٴkڜsk8d5 wAUs`ԓw=ti+ٳ4^L櫶f'J 40ߵӜlDa2eP^bD;z7mϭεTIbhohľkU'ɳ2@';:WD9J[Нjr@THNga]? P`x7RIͯVhH~zk$]o~ Q4?&(ג燑\oBA`/DsP-M;4t7jB0Zh;rx{c 6܈]x>wx3^Wp/6O);x'>wav>S#c1S.bJLLe`f0 =}~21<}|p"nf:=p/퀻powaQ}p?_ܯ;1rm>]'ip/w'N~p?'nM w=p/f}&>ܯ!M]bpoܟoUoddx+xNbnf&^W~}p?3 = ؏Y{'띈[Vܕ{:^;<p?ORq= p=N}6 ܯ? x#݌2!#ՀsjJzp nr=l+pp/s}.FÌ0Ex)2f^{v}?~pW[8+c!vel?[>`avpp nsى "po_K7;p'pG53G0",f XL܋w'OgkEx;Y7l >6#}3*.~pG~p_cA{AP|Iibmj/ 1H.?"(1Jm NmpBEK;s3g$$r%R$;׷? ĝ+/p+"#$2z(y(K*f4_F[#GDcײð!ChvBeHD3gi1-(g!Ջ -$ d' Ki vA"і3gFϜ-錔ARvtqqI^p" >zq-gi#bHp;k깾9 -p-3iG ^y>6zЇ{D Bc19ptN촜3c}{/rGXbmJtbp¸`LDL|>!Lr4L !fzQH$SDp†,Ymٱ-t_$'Ҳ:K%A":%qq2i@u6'#wt7-@HHH8;m]Kg"$T*9JK(-hxx0-$ڮ R!yqe4WDO;VǕ Ò Ҟ\'i(0O Bz6DR0g}& (WI h-nSaUczdBzm.(;l1*6Z)cWƶ& H&8p^*ER8i6t|RRb,r^09Fjj|q*lR'ND;qdKrjlyPSR!fzTs_hq'~/_{'VouBիQvGTRbYZ % d9A%@ݩje=FC䱊ʆȈJ''wyLD_/ (e^ X行m-8zrX&D2a X 5Ήe,d`%62ƹhO,bE%Ҋ2'r Q#vq4A Ⰿ!~S,GbI7:Zd;-($A ,AM3bX <'.:\mc/q.r88ඨ}@R2"d,D."!L\@dPn߾ Jx׋LeDO&A} RH7řM8d7/xw&Mrb:M8ٔ8 ξpD+2չ^B/^?,b7zy@'8O۾ A)J9jv8A U֍Kt)  [;/$=O&E슳,scgjk-1K΋`%97b,ќ-=KKcr+H[~<%mQɰJA|BW@Ut>Gk5ΡO]xԉT,F ;%Hc :Ѿ7)!~PjGĝNWuӐ0YN.v*0o+XcT4$m=yqZ+h2ͦNFڢkHnK]x(UNIUɌɎ 6 F`"hG% ,Q=>&Vd4Z;r*c4X?sW@@ P1^^.fvc| j\$|ִ Y(1aa 8VPegLXȥ#)⭘SԊTJlyĎ! J?RiB R!;%2o66 ` Q(c\9)Hݕ3` .&1vAJpCemIbۧGOmP{;=8^fhO!t]: ip1YbVh99מ!wIB+ n;vlX۩m'ڎ;~n=FadX$BZYhKӜ٫*p{G1sR3.MUNNihEKAAAgTD*^@DR)wEP(WA*XnRP[R@)&=mJsNC-s>|\^kHӟ9{/3 -YHlآikf_#Ay-k ͻh~?@\!8a}t_ 4?,ꯟWo\K9si<"ڴH#T~jbhzIyF_3TvB8!. 1Kcā5Q=G[X-:.QZ&wӘo\}#g^X4hZ<⍕ z?Xl4㾬썆ƀ,b +2ZDBcכzo&Lim;Hh Zߢ()hSsn=E;k8c_?S& SSxF3ѴIX0>N}I)EE;-DBQ蟙kW5a,ZvPLICtwN։q.Vj3Q"NWDޙmUǟRGyP~,y)WV?6h? &UBȆ6ϫ?.3>cBKy@'^g{? hWt,m׈{xC'>{D(UJo3/Apscjvkw{CT_^>棋ۮ}|..~뀈16{{IfaҾ I)'{^D)b1x\lTVLiM(Ag}԰Ӻ(`8hkal3M0~775xc| 6X, S4m̅q~w;v,dld;;[ }օ/ qƥ[ܡ [[,lo52w5m [.m*Vm~gKbƱN㦟ds|Ӵl=[5*M #ےfJ}[~ۺ [#]vn)`d6/Sk>PxUw?ҶK[O{[cO,l_7)ui\qwkۺiFEli]vַ{g_CVt۸:tgU_^t]l?25lkGϯOӮω/ߘĖ~olg?xs^7v`XnuV}+a-e_9ȭsm孎oOrˬƫٻvݝ}"j׷շƻ2,ī'ㆇiw1#bַ^)[j$HMbtOIq32udȪ{[~ޟR}p\/3z)>=-Ooݤ6>,&:y/N6y䳓brՔSn2%0S:gݜvi%M;6.'ӧv/ӟd%֌C2gmƐOϘ1c3(9dڙvyV¬fuVf:dN9}L\1s?~ޮ].;ie~[c,'K37\AͶnZ|[cdТīmW r?h-"ҾCg˥qZVv-_hJAz$n} iG]{L;_Qvŝ$oczkr؋#\ĎDEbfQMEr wijChG;xJb) c͢14~Ao;Α!Zrc҈[74f2}Oj[Gjhc#E2υҪM_O?jMuvwichG\\6q.iB;ΗhP56ϩZy!6PrwrLIt\ dO#} 7HMF: l钐X[#Rf5[[iʵ"k.{n=ijz虨٦eƌrhWٵɲMoгޚ?.UJۚr?loozon%Ͷ+6-mm_u wYo);U:6K;20U7ڻ[fesFKMnӫ)nrr5V7c^mbXYYw"M^=OkGisYo-U?K{iS۰iVg[HVgxLDslZ*2B3v=whWjدٰ~(ӔYը>ϻSzϨlWj|'̆S.?Q~YصQvș7h' MbجGh*?@HI7DKZJ?ZD+ie`dN>ZVhq}É>ҿh+6 lH;ig팡!񲀶ܙC{h/iҎeJT>UqfloZM~mq7\6FaxX'HX/˰^Ű^[8N8 @!"pG6p J4/P%jyZP ?"q9]3 EJAA^eT"X2l*~S!"pqpC1|2Yo*JP !9J[n?]0 -p!+[~K*<pn2)`:d~y˼^r+M^UיldFldF FldFxJYqˏpBYJV B\,aE? eKK E,M+w;y}Glܭ]aG<ӅgL3]x t.<Ӆg$VixZ=VE~<&DŽ0yGx^03QxL<.k\x q5.ƅ׸^k\x q5.,ƒa,Ɗ.raj.Ra,*.BzTGzTGzTE(F0*P1.TtKG-3޷ɽk|YNR6u}&}k7< O:ȓ< O:ȓ< O:xRore;re;III欇9[Üa0gk5S;s9[̜-f3g7A<`S<ŸHHu;NAt;NAt;NAt0bI^ s$s$s 9o򛃼`v̕b?O'kg| >_Lt?ρF #s*m)r׃$Q}=_;8OV xͬTc sDr2{"y^' f̕+Oqᯰvj)5Ja}p2<8Aƴ#1xXYh/M8yp÷plRF9䙨B$3eN7j| [`;y/]Bn1:B',-]+tЃq%$zU\w5\ɼùdFy&ZD, 1`XAăZ@KhCF6 4?3t CLn" 8v {{랆0lsa.\!$=~ TqF1st0 n0- `h+B>CKhZCh :Ag]tp%$kzUp5p \ }/7B?70-0n@g'Cap7 {`rH FhX\EX %x+ð\V&U[ށwa#l}Ȅ`3|@64d'?>m|5<^8yp ;$DQ$@ #$7LD<D3LD<D3LD<D3mOa|_a;쀿NȆ]\{av {TKarB$xk:QhWz 捜c,8GLDiܼ 诙/olfkfI C;o8( g338v\):{kjl359\*WA5ŒV[e-%$:K"ˡ=\!:A+! zKfy hVQ` DC X!l`ZeB$B;3~Fw.Aw D_ ^_G伞2@$Dkq wz8#}#o~=ɹin4ue 0΁0<<:ZZoz>98u1B5&ȍ1V-9~1dKDYkHj;RK-־Rv7_'(Z(Aeɔ]eNz}oe$sWʣ_y+~ѯ#t]*ޥһRzWJJ])+wX&ˤct,eұL:I2X&ˤct,eұL:I2X&ˤct,eұL:I2X&ˤct,eұL: @) @) @) @)I@TTHGQ!{5!1ь~4ֺO$^ɫFũ(:b15FhQc4jF*jF*jF*jF*jF*jF*jF*jF*jF*jF*jF*jF*jF*jF*jF*jFѨ15FhQc4j 2➌x#͈[3C">C&m??c1g?3|Ɵ>ȧ#~ӏ|O?G>seҧ>k-g\)5q qm*LtFseq̇ae\u˥Ǹހ7a<e `h+Ă ZB+ @[HDhK U4TPEC U4TPYp [6 'C1'Ix 0,Ly S`*4H`:d yPӨXղ_Z(OjE VaP3O*"8rȨUi&@ ad&!~CBP?!~CBP?!~CBP?wяap7 {`HGO< a<Y0uCBP7! nHD)<c06>cظa"l\q6.Eظa"l\q6.Eظa"l\q6.㱠 `{`;XNr*Sf'c=UɭX V` ,X+`5~R˰bVcE?VcE?VcE?VcE?VcE?VcE?VcE?VcE?VcE?VcE?VcE?VcE?VcE?VcE?VcE?Vc%+XIJ*VRTb%+XIJ*VRTb%?Vc%?Vc%?Vc%?Vc2TʰRV*JeX +a2TʰRV*JeX +a2TʰRV*JeXL\X)ƅŽTP@ hjԭFjԭFjԭF0Q7a nuèF0Q7a nuèF0Q7a nuèF0TN5TN5TN5TNPGd# %[2t^ k9N1qu̸:f\3WnjcաuZסuZסuZסuZסuZסuZסuZסuZסuZסuZסuZסuxKк|,_D TF퓍%أ{`Q=JG (%أ{`Q=JG (%أ{`Q=JG (%(GA? QЏ~c6 >fc6 >fc6 >fc6 >fߘ ^,B^,B^,B^,B^,B^,B^,B^,B^,B^,B^,B^=JOJ"$NDO< 3F?c3F?c3F?c3F?c3F ^17:gVabj_jtj뫼~Ziբ(Ы0_L_ZvV^ݮZYUxwA;w P>|(@P>|(@P>|(@ x_ }A/L2UX Ta*,SeL2UX Ta*,SeL2UX Ta*,SVjQpӺEa%hB[ b 'D,oaDUTJk`rt-C2t-C2t-j(]BWՅ.tu ]]BWՅ.tu ]]BWՅ.tu ]]T SA|*O >ħ^e^e^e^e^^^^^^^^^^^^k~;\߸+ӌ{c\bǾ8{7'*)[5SqY@G8>A5[$^V:x守Q=GUzPT=>T=UzUf5GI("6*֢**(D(xi<>i]i=(C(x=(AD ꩨ\TSQLE)T (G)?JQʏR~G:RRQJE)qo!?A(Uʌ'l\nƳC2yE\+;JG1A.+Qm7> +'RȿJ9]ӿigҺiEk*shsha*ܥ͏0Mnwdѯ ՞\ॅ"t/7rw<w2z<]#w딸 rWOƓsxQ/*5xQ9^TWxD9#BxCo A!'T xB5j<c ֪&Ɨn%fRm;I72@^Ҿ׶x'H,qc# g3C0Cix4dm>_W`1,Dq*5_ hg=a\iCH˴m}|#G1F2-xOnXn_.>|vvq0|˱#| s9='C'e!3w3;;vc y?A,6|JPwyGTH8E3,8,x^ۡ[B+#𾸶5.pv|'3pK4J+ 6q:[aW5x]n{Sndo!R"R"R" l!Z[O;oλ>g z%4QD<*SD`/ffOefg1k?aoCؿ1c2+31 1 uw2`&όyWfifɫ̒̂]x8}?)xxl&c4~J!'nOw^^2ǑK,g^d\|?qKϝZ>YYz~xabd >594^mR>!s`ddܦ!Za3s3s3젍u%x^{{{Mί5_ hc>G~O{'S<7>/?/?Y|,v[^,~uVnݨ$3\.> w̱g4a7JDBU P} eԅ(G6>'e#Z>5ȚCdgM#$r#" "@ Q;H<@<@<@<@oEh}޻ ϭe̛^2[>]5}nюyWN1S˨|#;D!zw!zGAztGM)zsAzqJtI$j*dW/*O+iZijejhQ͓yr1O.hQӫyz5O/f8IQ>fcVm ]Xwu7ě}jo>ه7t6wUg*硎Hb~F݌/+8'W;+ggZl .VIo-)A;8랣ll҅MΡ983#2+Csr+CsX}Ȧ;KHy.hҙ]300zU"y}:\TJP-KG)(<>dz'x wY]KξA$j#k7ȓ3jO-<^E09U0)99py*)9S^'U*roUOȻUTEsTF*`JPiғ T n_YSH ~jM-*[|y 0ke+~\_ʵQnxy^Ic@C;VfFh`|2hxipE׳|"\S*д'TfV 4@ӳhZqɧhZ魇kJx_J$l00>}A@Z u\n`vp'}bAj +H RsXAUڪ>}A RqBo>!F͂y2劮=n' x+ODr+Gr+AZs*4 `?|!a\np\Bnj%?r¨B$B\ =F(7ILd9_3eg'$Cc`\fYPP R.?A΅xˢ0Z{t55MA<؁MN&G_7}7#~<jda m\&E+<2p@khmJHp\ nHp/h'?s?s?s4 ^0Cnś[xV4 ´rXo1.mMr+V$tF1

߈o7"C B|]R"Xt5]E., ¢.hUbեXu)V]Uxu"xmVC7)WH`/'D"5$! u$id]N8B("˺Dܭ"IU9a7i/tȀ0flsZHXHX~޾o_/%֬'\MYuN"'', [Vptr*Cћ܏zzzzzzFF3dR޾]̴̴̴Mu;ZJf6-տOC)s̜,fN3g3gB !̠t~j[GVe-_捕yceX7V捕yc}2X +a5[6u#l}3EB, s`.̃", X KUx ^ &UZX'lWoX@xYpF7t0@4D3!w 6xhEu{85p%PASx*JGL#J%Ӭx&³0 :L)0UfnD!MMMMMDS+J4MDS+J4MDS+yKw]/yKw]/yKwDޮDޮ_UJUɿ*W%_UJU+++OEÏpPB%P%?'$$$$$/ / / / /wSӻnjz75MM簾wSӻnjz75MM簾wSӻnjz75MM簾wSӻnjz75MM簾wSӻnjz75MM6DH-$9DN2L$9DN2L$9DN2L$9DN2L$9DN2L$9DN2L$9YKdZb7kݬ%vZ"D6kl٬% 8ᨰdxzLf7!$#ӳCoY.CllClڷ$}L*9d]"NɕrYN|d9r\"]A9~NDd9;YNd9;YNd9;YNSI}T>*iJG%QI}T>*iϴFނކw]999uW6l]dQ+YJEdQ+YJEdQ+YJEԙ*uJRgԙ*uJRgԙ*uJRgԙFMa*4' ={qCH[FcHs0dvLka' (9n/. *~  ;NgS٩T|v*>;NgS٩T|v*>;NgS٩T|v*>;NgS?U|R90V1£b1qb'NjAedleBjCrVMJt*嬥~duNEGLdɳboVh􉕼R@ erc.2qѷ0W;\_\GwsX :k/Io7{׌):io&I1XzA|BK\l֣V@_:vZgD%dW"YZ3*egaEVqvV-f`\,K2,W`1,W5X*;v-? `h+B\@,1K @0; @0; Yh s6̆90|xBx ^E ,y +a52x\l HX:K.y/Vga|l7~# {ZP~j( -J}[aU8.=&t, StC)a664d)\&7A:!fLaj[Dmk5QۚmMԶ&j[Dmk5QۚmMԶ&j[ִ. M;!rK vnra}P   {\U/7Q2܊euA?BjX{i׌x̌x̟rl|NgC| L͇x}pQpqgs>8*TA5je%ZB̳$B;C_~0Y.Ly0VIndWa{`G˼9?1z-[^YӒ=+yC!?[ 0&w+|2߭w+:,e xV*X k`-`=l`֍ ރ!S.K:c0kH0Sna̅y0^^aa rxބ VX &rq|oXIۈ>\vC9UKg<)W3qnPx^ +E!EX #^"՛՛rJhD:0;߉L>G:-}M"[f- z8O>C%T.)j&!xq'*D7ѿnNIC\|aQw'+je Jy7yW &Z3X b `82&bt)Z7d4H`:d `6́"|2kdɬѓY'&Of;6}MMV_nfײ'P{hYU w{ߥ=ojZfe;]tբe9B%&qfsŚiX+I'sXGJsr֚iۋOgAQw< "*syn)E=-ҢUZ4G>}Gv;ܑ1eJ_tr0UF$,muՇu*{UVЏ 1T|PwP.="Q'O0U a/NvW*sDDsW-CT C'³0 iN񑿋}=TF4b3GFzq^<}ݖOj,CKca*}]J }эMmt%@*SJT?լ?ނx `6̡ƿԓz- &FA/C-k)=;ސ|جLz~d?-mzW6mMwT 1$}TbYρֿ舍4Ln+C*1rU"V2Yf2C'd1Ydǔp>Ol(h#aSE+a,U?/%ϛD=•\y~Vκ9⦵^RGo#,6`dъ+zV*=+ڿ ?:;<ըJ&"Z9Oh;Z DֱJ=4h}֟xw wsw>D69>*hG[9 dVJkaS YQ/bLqZ>O^ײfC)-jrE$)+>-R_h*2{'"vaZ.\/!ZASe~wu&6a5˹=_kUSGuu7ιR*Mmhrvb]kS[iU:p#;~# Sk+OWg6i s6;?څЅݸ;zJO+>0ʔ %Ҋvk#2u\75%Z+wW#Mv\u9xP+Ѕ8֝=8=Q~kζX8ز=Ͻc#:qMgM5=J"f'kpDTO?#~umNA5EE ]{m܍wzmo}Y{WO}2Kp(.Zk͑O&Z F/X"S3S?Q͆#&☈j+u j+?7%ܤ44Z#6&jכbv.76%2dk'1QġH) 6kҫnbBuN\p]Wuݹ]İRhEh^;r;PU$kS%(0V 0!Gū?]zPWL54Jn:^W]Kmkzg4?} xEmuuOwg3B!cYYDDD!G3w21"""", ,,,`d#""bD1 }OLbQ]R]]]wO1!N'H,b;IOr/y"ȟPg$"#lFmIjI 9yr\hC^: H.t' #P{0|!$$ai& [")'X…Xna&['-FBOx:ѻPaF pz0Gt/ Ӈ{$:IIT>JSi: i6u h3c48'd!. ?;B5} 3a%=A^_봁ޠT]($ۈ¿ 1H@ CZ)|$F7 77 VVK-|.Ɖ}bO8) `qpJ"C}7Xq(&SEhŮ\j"/%TOSZ\Mۈu4@|U|_ߦnCY<"~IoD z4@@$TEfJPAL%OH{_N_3 Fof^C!33ӏ >G g/Q×@ Я  7dmLr(ʁr{QCpQȷm?#{ĮCbr8Y!?*&ˏˏr&?%?%fO iby%((f"+yI,ߔvyX-'g'\NɇOħIB*MQqĉەxe2X,GKGSF(OģXe2NxLIP&')JxJIW4%OF)PJD]q+eT*J2_Ҕ)XY,:(EeT^”ʿ)NiɍSh)IQc)jV)ES45^JWipudUG#Luz>>$V,)j,H-P RX-ܪ[Hej:C*WUgIU FfgGտ˥'ԕJIuZ6JOߩIOgճ|?'I)~/96~"v~~:J/u KˌdcƘfLnf&h5ڤuLc2WiX*f20n1>3~`<(?J1`a hbxOE6^K34iӴLYѲ5l\Zhr;Hjm7j5\9Z-o֖hK8mJN.ސ)vj~mj䇵:yvZN־vA..\l&*MIL~&\n 03L!y)&?a 7EsMѦhYST^h*3UϙMKLO2͓W1=#dzeӋl_3;̝͝]3sy0M_yOHwDVDO?Wci$}J#|8S_ۦ+fk`q]Haoޞ/~Ne{H4-#?/b9Zs13^yz{G^G2#v3o_ڑ~JoO蟷TC)n6zh7_vIW2;zk-UH_>҇ezJl8ևw7ee-1h$>OpFՑinX~VFOG7J~+yDBګK֪Wol1^xG,ٶO]K}Bx+|۞MU~a`9#x;~be_C׷+ױs_~OxW{pk>>wf,7`.w{8~76TcvRl/{<6}Un53H0}~kaڤ֭-@Gr7"OA# ~d͠#uV_*ثҏ\{K@}>_Aߢoꊭ[8Rmu/Kxd:"txq YE4Jb{ؽy?E.BHr=!7I.͠V)C_  *Dϐ<=Oe0Ţa2Ѱ?#DOG<1QLKdHEB9B 0Z"lViϴV=L L a_841aϙb_84pw,L ~f*ۛ;P||o>~#pyPO7ϒ ,#+JV«dU2j#oܷP'l[o;Hcrgr|K-9C"Y,]E./r ~)rԸ_jK Vxƽ31 GH<Pڑ{j;S 5JxZe|$DqO 7lj(O7Gso7L918)/}-5wRi#.p}aø߇qEPܭM$e΄W5#DQS#2 gH$ΐ'~>'&vkǵX{B;A:h_h_NI+Oikk9FooQnԾ#& mhgvkkvQINҎ1P2I@I&/#io7f2Nv 2H0-6H)"QjQ(wߡ9"i1zz~Ѵ}WҞ1 HK>Ela(? 9|P^M6_#9nAy+xO$DpZ!(D}As̹}9 m6DE v!LpB93`d cF#gF3a;ZO` ؖ3` @̜ڈ(`=eh$b@:Μ8녋ʼn$NB=c0΀b80q"ֻ@8u|מ]9DBDk ^ 2ssY~~0.cВX{b~:qn')I)L*@h g4?9j`42EW9=c4V^[,F"+K%hɘNLױӉ0F)&-V)`:q^ky͏Z0B8u||ց[G]UA#c1Bc!XLRXf,CM3rNi}6i}O9q ָ3FI4 PE[(34u0u@LMQ8"=0h9 mϡMcM/RC[^#"{5KoЏ0o.rҦIgQ^ovE=ס:2"K`^={O^BZwh^Gj?u֖ke ows ay׾/o$چ u/SW^KO?s=/}3'nQs2kY_?ߛ=a^2~~eq|hu]}Vkg##zݯYw;~ 䏣oı:cW\[jůH?O]mz+6} )W6Q~؏v }Į_$ Yw|L}%aԻSu.;gn> o{{sz>CODyBKݢgˎO>FMU^8FFxYWmwtl+Z-3mo7tXdVwѫG.<~b~JV_U٪xZ54yj=&B}{^Ǹ6A+Gd>qwO3鲾 7@Gr/iuǜ{9BΛoy{G{vܭHfߏ0߀pi흋}叉/1#j֐잜v&J7J#',Q||9:yz|Ez>[wDg|k+0W?*}oGvk]~Cu5"o[~?p}{k6?gL{"lo67`j^`D4D*uM#~oE+U4_𻮫pA_@^-c}۱ʵ(IiB|^ֿ]/o4?ҧCx8˾~>ZEXu|{W3_^kz ̧(1g}ۮ]vW|_]oW0k}\e>~Oo9]u~k7+~ in rF2^,+I uzX}?kk׳[m=80O5oB/^Я[[b~@O_ПwD[wlؕ8N=2D꙾뚗T}uƂ^y?7EJoёQVVGndwp?㳼滃s5,>7O_ˀQ׾{ܑ^;iu}O[X Q]I$8KbGG`qǙ3Wy<݆xOY M|ΟSGPzƷX_{[&fg+8\95^} ߯kzCi@k~|s6tMK? ^zSl|c i~kg>%?}ŧ"!Z\ǓW>+w߻|UI| y|y<ړdS(9f #d.:"YN!#|Hiy4s]J#t5/k5D7St}|CߣonH&#gi-%ߋh"1\`y FQ<G#x. 3s,@a!H(NٳB#\=BUirI,?0R B!QHgYz;#XeXeJYP2<#Բ<GYfJYf*<2PY^,H5<-CCYNڅ7<4Z'=X6Dz?/,ϲ,eSY6`Oc<櫲_Ej5Aj-UCԎԭvV;SEYZJ?P{,ŲXzz'}ҡ5,}ҡX.:ҡϪ)j*]rECuXFeԡ/:t:CARg7Qdu*Qeu:KrWY.ҡ\:uKnbt,r-~,}eѡ;XešfYqG$,+8bX)bo$8eGhF|'hkib.ˇ#V|8,8`pG\/|8RG+ˇ#Ֆj+|8,ˇ#ngpwY>qˇ#apY>ˇ#~}?elX6(f#~و_l6bf#6Y3kfxhuF33 i#H2[`(3 ֶD!7܈h, BT -aO`Nv8iL`qOXڀAll' yD H iOJ`CtL: PMbHwf! فf`<#[p譜CoZbj98-" =8 ۃ3lw0P^}  »?I_aμWkK99r8ο#t]AJ]8#w|y rg]9/ voptgѝ9GG5%7r3u4:,v;X1T %k &1`훀1 Mna܍x`?<=g7?gwn.<ݝR/*"4AzZOJHHy^Z"D:HWHUr+Fz9es19` m mI6[1'C >$?Ā j>6|CCD1|bÆä9?9ic % SI[iiҞ(wHD01b$G ILI[Y%/d0)4._$D5Y#I6;dlFU v6HnmCh*w"r=ض)GrWF9oo&X9ȷI&w#]ooŶ=譗 mz˽mmEvvѲ=||7ZEGc_~kDN'I9H?"I9Sv`NEȹ2xCΗ H\(bEr >KF?erzP. k+J􏹙tds3鎹 KkHO6C|"?#ܗ%}Bb r+ˬJy%p ϔW˫2XwV֮cWWQAވ˛My ־%o%܏rD]hGރaT0ZlC?.G?'h%#6Mr sV@:0=AzBOP6+mI/%PiG:*AJ[ QmJg%ڸUbP%VܮtSr+CD^h[6)amx%{CJP`/Rr+S-@ T jBZHS-#S-@T P-/S-S-hՂ2T BZHoZmP-)h;]ĤfYhm`PnՍ~2=P3 ?>Nzs9 􄦙Ux:_}忪žPrPӠ6ooZtgZtc> ~jxxP<Hov__ޯ=$BBI_'N(" Ab65%!C(3CO?<ޘ@fBMq)ƿW 2@9? dyePOI6A@n!mDM&H-QK$]d"jITSOR&MKCi4-tl mZ&dkX9Hgh\iy2iEbtJ574ZNצeV=Vkf6=Ca/5Z Im.ӞƘk3՞EBӞCEX<kI |&h$V2H[  Yڗk[Zk_6״y]{5P@(E[VmCwF]]ܡ^vif}BGZvm괏v|B SvD;B$2=it1Up8-&+,,nzj0ՐXӓ' DQ%JnaJ2%J(S@(Q•( dJ Mԍ+ѻ\zWkR&g,&)V\SqMٞk`)CZe=02z`Y /,끁g=0Fxz@Y иCM2{g3{"?@:. Eв&bg(3-h٧؅d :++d^xk~}\מDUʵ W+!(?v^vH=2 E (<2N/Rty""DA(lQA4rFD菚6ݹbm\1;ag ܝ[X1n"")hHohQ+%;s%S%]$BLIwp cz ytmVZ#}w@+o#w]dWwda,4"g5=\CY-q%ݗf+f+f Qq{i>14LJ0e(`k_kqVikCX`br펵?jֻZ8#AKYjիMGAV\q ڞk`AC gɳ\#q\k2^'C=ӗ\_ɋ,%P\YvʲL^AA_F Ӕs5O^'VLSqMy?4leG,peO~[ކޑAwwў)ˎ\YʲWw{ˁ\_q}ُ\_2TXkl֔i0eه+˾\Y/_/x)㹦Me&p59PHqMy'הrM9+ȁ\A>\AvTnWn29+;A h<ߊ[x[15[1|+e2{gYW <Ƴ YWx֕Fo!t­a0^k"ppV2pXVpdV&/clJ&ڎ'p%**+'fy'rGN:akt$%gUsRȚ뎙tv#)3kA {Ljw\F]apQÅc=} g Vy Wt.]s& rd`@l,\XZ-PM +LhY )(,%#CQ1 g+꫎&c㧍,\Sdb{98p#0p 0p;0pU=mUuzZQ*-161۝%<;5QىeW۷LN̶$owǾlݔ~Hvpxv AMrkO%nFe82/2%!{Nvo9qqJb< [0%{ ВXXlהsSdrC$p4F8/{/j022eaK$h١)˳O?dP&OY}L壉P>I'0. ܘܒ ܞojsN4>;=ә2mʮn-ぜeZbSfPY`P9}9l)rLe!Sh9sƕMrzʅ 'L4%ӜjNМc S7;{OgGslNXoϜǙ~j)GOLaN=\dti9g T:t#ǀ,*8Fra{Ë)sf9tkJs^鎔ۂq)΅r<>,%I8SbKSz:K\ = U<=#sWOXXz6es p8CZ{8Vrn*S:w^ Q<՝V>*@ndܘY=SkrSq+~S\8ħvg69)_q CrSsHFb$KI]a_閺&w\F6oa[%u=?P9b)w< rܒ5wTd( s3*Ӎa!tZpnwGou,_~2pnuI=;z96q ge5!wng]x9b4)wUY`ҩܵB1ʏá4c29- w[s:Wia{-EǪGX+-%E գ-Eg+,3.V)J,󊍬Mq,,]RV=8:ɲ8:ͲGͲ8=l)vX.*ΰ-Y(S]i9T<ճ,'5Tδ\(vUϷ4`EՋjͪK:j.q.0xA kh5ֈeū7Yj]zotm)wVFy֡{#knuG[G^^?-PXyКT|7ʨ+AkM+=j+ D\9$=( o޻$ cQ];ʒY%}맍,o)R`_2GuQ(V:d]Z2(Ip)Ih]_2CƃM%F֒L(üzFHo<#1 Fl/3f[㿿d{<g .+8G'QH+Y8#38fZK]ֆ^pYϖF3ሸdŒbLO4mRo\9cX=P zƘ; <Ҝc9.@q*[d!ĉ"gŔugzƕY҄Hˌ 7'\_Jݙ{mXٽ64[^.6-&4bmZrZ\Ʋ-isϕ-Iح贑yZE7` i*M=t)bsr^ϊiy}*e'Cŕ7btZQvBŸ4p”Űd[qL[gqGL[]1+mC^^EM漒i+̛ ܖ7biڞy+8I[Xx0oSǸbSڑu[Nmؑv*oKƼc,Zq88.p/HUԧuK!y'˴TG銆𼦊U_)My*^61VG嫕ʰIJ{VFɏ??2&}H~7;}x~VƥX?r%%揨]92=%\tKI*Km9ʢy*5ӗϯ<QK椯_Q8}ce[WMk2%<k];*7]-@ʝ*?\Y~2XAS~N7TIo?[y"BS@*ۛ+b ܍``PAX幌ЂH(QE2 nUZFU} Ud ,Y1`LUTƈ &Vf+H.# 2*#3 2zfUK fW IY0׽-]jx▂U, \>QY**!@ČY#'ӂU)5{, j3XZp$}W %`U7XQpjfƚ*~ݦk˫x81T\zv^+^ؔ\r6Wf1x:Ozk e[2^%P.*i=󪶰j7_XOpZ;PpHN"S-14iK#iWҎЛI{}t$!a{H!ېC o"f,s>am@F'+'oy|Dj1ğ_56ď%c?G$%;g|(hB B/ !U҅J!V ÅsC+KKKrHNVRP$=!=!g2yE\Z-fHׄYққ] \iOxZ:$I_ wk6aW>EalMMB|CN]γ']KJ%y| ,Oi"g) y6]#/et{Wʻ4K#A -ˇi|\>IhH+&"VbO(J{AJ_T?5ʝnQrZ<<%,MJe؎?8A S6*o:br@Scb_ xǪu?57_ydP#)!fX(lφk?Vh55!Y^U[ӳOMjjjJj_3fNͼ5Kjm-5Cj߽fTؚĚݕwo)߿#^t"d|1;ߋ$}D(]Co7^Tʟt~boDMS)1__ӯ7(BB42 OFb0(!$#Ɛp؟Dg;I$$F|"MǕ!V"ku:ߺȺԺºƺ޺ɺúۺZ;l=f6`YEd3l0[-g Mĺd[-) H)d:PyKg,p d%.d5Hu,Q ,76o'=o&p| KwrK@ϒI/rm'W?@!\B ].%E?iKHYV8*[hYr51 lrl5mfmc/ݎr QC:-;4/YNX؜Ȃ1in&K%vINY%Wd p^ak3rX[#~z:w[c=}ҰǹY9*w) wv5f&:.drl`ka s\?5Zr"guU;kZm+/bW6smG -qŵ?i6/h+خv n=&%91cN_av^$2Y9cξua-1]l~u%z0G2\b;ʴul']E.Um͸}f;u͵fb{k=Ե2t {k-N{k͵۵׵>е>Uk:h:H6ccho:1{q6mSjym5)s\b̕rwǾ{{Mn}~n}Qn}in[<Όl޾yپcy.f?]6Dzwf<6}#YLzd͓fߊys!0w8f2~Y^΍e~iߟ^ۇ}anoם/&dJ4榰}̀\KfpnvfXn?//2.͌-a<n#=ro9s_|ffkbf|L6ƖY{osdΦs;vhIbL$$̝K0fc%$!IHH$I$<$i$ICBȿ[}hLy>z}gݵ^g^Ͻst)W0;[0?w" %jCvك _^iv:;qꌶVWq,gx 徸*cY,نe8l=˒N& ׭lMWn]w5z,U\וѮ6;l6Wu5,+e&ec+{tjϞT c9 9ft-sOY5eN|؜^9} (ɱGNjSs2 .),\3p%c΄ 9 L/ܞ39 @/gQ8s(<ls]Φ`ζ"#ggQXsU|iQ#ErN55`ιe9RQlټ )܈8S-U?Qܘ4cnlޏܝ۩h8V49S4UnRѤܾErR0whߑW\\QEr˝X;hk̢sv.(]\t wYܕE9&\'s7]2wK^-)xF:l/sG?/*=_ܔ(tj~+ĩ?=CcS`*t k+h xi$O ?0g}ȇ?pWv'7T&_B~P`!{@xj7yxMoøoF-GDq]2mzH1mhz4[4Gq}6zz.-|D{O[% -eH?#uQ%u}ww*uSs;+ugoNg_ReT}!G:Itk~ɧ]z?_>\uKSv3]ezQk־eWVS_'VjS>}e%58Y]}}}kH[!i+xO!b}YJMxZvF[L WSv|?;uoՋF]{S[ko?gΗo˟/xv$_ /,jj؆Qv23;/PXJNtZ!'Ԣ4=-$u}"MIniDmJV0*QZLZi0K+[[7mP?mH%|zдQqzRX7GcTJ3-H[,mQ_L/yi[Ҷ;:'$mOC5iR76-nWN^7|foAzַ֤27'}tZHI|gCKҗӵ >|7oHߕɇZ~d]L:[?~SXM_dW EjRgntyR=}7ݔDڷ_~RO7tÏN-kT~sIKT~oU=2v4;{5] k^ bBsqc5šy+cRVyp!hSlZ)3Q?_Iq.4b;հSQ14:i}_Kq>I N)[{\/J}^FiS\*$ֿB*NS!7!JǮNQ:6u7ZJ̦{$USb<%{㿖<;cI8ھ{݅Rܟ_II) Ү+#-F_'q{&]'U}y$Q^"JK1-Irt})וKe2ۜNJdzʧ}_RJG*Q!s;I{)l=矦_'t:µGH]>ޖK'PėƏ~R_űQZԹG u*)l -|"gyQQ:XB{~sx͞KR(Hԗ JCG{PTD;#L[oOR(=( ]=XǾeoϓ=;s؂rvf]m׃bycN*S>:L{nAqS`kdx4;2Cʥ뤊뤙)̯ثiYTq-/yPT9|xqM>Yx񃝼4N:>튧O7~3.Ɓ9Osܺ?H<;~q1ت0gl;?~]ǫ-s]F\6ē]N*ɔ:jX.gxpM')1qS7͎щ[>Na3HrH~Dz /Zw$8']e^Abp;yz5c[R$h;{)y[⥷Sck)W(t9:8ەةW8\!_]8quAG|ʱsN,?\ٱ +_'`?tuWSr⺮l͆\Ǻ\);Mƹ?$?<θJ HwC=LM] ?jsR>+옕ڞ{)h=i3vڱGn{N)OZhpDŽKv8e <$ږCkO#'6gy\{JtcCk { 衹,6{1/yh=)#CsH< l;z=+m5v?{6C{H͇<:!{~G1{́zSzh'-Dev%r Љ e1bXb=W&rS'q,m.ۋ?/$]l;1*m̈667VV]JQQԚRrNν%$J}) 4PJŔFQKi"fRCiSZFi%56PBi;Y{(tXϧ("ĠV^RuJmyԣԐRcJږwԅR%/ގ|J)QʦOi8єSDiYQZHi VQZGi#vPe+d/p{qۦq埡tuQZ;':ݛRjǝڎRGJ]){wk'>e5*>8>NߗK2l{R*,wAixss!Q$rr&H4ebĎ]]$HLMH̥0qD 'N(qiH7ĝ!&I)覠c9`Vf:2L73Qj$B|@o=Cۃ3-.5 9Q}$x§M&6geI pJ 泄+̗ ocVʴv!@#g7>%m|L5J)Lk_7j|MϒZ?J2HH&ZIȭ({E8%Cv_5 24ȋ,#.kGzP68xy;rwg}[:~vBieG7وR7M(ud!w8 *Lꌬ/1<dNC|-+@ipjYH"?GnU)< ȝ mm6͆l%@s@~ѮiJ$4K[o/!F~<=N98| x {RZ%Ԫ)"ːGmhPd55?bdh\ԤH:DNjFٹqZan5 Si3 Zqw>3mt<1EA=]O!eߪ{ĨaI>?:=+,S{Zg )LAmQ#i<iF6]@.n>I/n]n5=p7Ro_K8%5Oh܊]O*|!CC|6bTF;(*u3աp `g:][9QF=!74gڨŒD_@!`tu{Ϻc˧ ϳG c_riD2$6VӼB0C:` +7S ,0?W懠G~vϸkZga 8 K3 p`WzhF@Xkx/%|Xn>܃XIn:v.vA^U/  .GZ&tf1bf=%))[:%=ٝǻ&4(Y10m s,d߀"aP_mX}m#^ 1ѐbҎÜẕ;MM6·:b-71GG<*X'?܀(IaO$K6>];+@}4wͲ~scX{)6ڦ)${gg(%bc-{WaZ4;)XmlSSS615dKUX,vc-FƼw&#+ۄoEESE=b#[ 9 c j(PjT76#H[)\%(?}e*;oL ˛a;^MO25yfs)W{<t~;h~F︍})x#(v^W8J߬û0y+K/sQ .ΐ>*U\Cj3 sL=ʺՁB'"\{mw6»΀&yWobv|k?jb#,A}5 4Dë}kyGWzE7>yWK1 g}\FkAr'>ϻlBnJ+13Memܻ{+FMq[iGfþk0z 3̡c*඘yuBt+k<ޡ8»ҸqĄuaKۑu0^D}Q32rG#μR87"ۨ\F%]AۏW:^N>L? ;n 8A0>~nڷF8q vcxo5^i5C A.}簆?gH[w'9  Y;͑1FSNsQ5l hQ)}!$Oט4C &|%BoO wFCh{0>$fz֏p!i"d+-l s,<^1z {AG1ni2 s""GY`8OZ.3BVF xv=xK]Й|9!> >  Q3d9\Sr ߦ}|ds1Mzɰ0-t(SZ76fOF>sfF{@C~$.@?W${3L@óSwy{ kiKID `Z彩:W5ͯ, O@cxe:R )e^ mK߁ݐ!q<oJnXF r$l:ե({~(5t,02? p38xpBP_Y ͑$3뜉: X !s;qσvn<xE4((`gBƮ- 8`+UL7wf`p>pE͙M^Dl_a tMˑ+M@ N+ݮg1hH:gP0 HB͓P$Ԅ1AHM$< y3Sl?I;Ю(l<~<3>n=<кemVn؍q,r{ݰ$=Ǡ-cTOpz2G+/:twǹrd~v5ϠEc''`?x YF.GdV3Ǭqen̫`ky^aj+Hy <=3@ 5qh p4,_ n'sBa\Jn>cنgBI`286͠mpe6iNZ.c|469ض sB>E'k/u}ېjC zn6 =c G/}Y׎=#Khik _D|+8棨𛲏ͨ+di/>(]&"׎uqKȵ2_2߁nzZKp~1{1wmO@JbB=H+%Dɥ@̳N@x'CҮL^~M;:3m z8J ^ႏ5P.Lu{ B\ >fywPյ r?IЖ IIe!] h7)ОsAc堭źB;UA:#X@̭&,JIVlݙcw3i-^Կ|H0Q._ bă}ܰ?CJk&Mv0uc4{m?X ?6;eG܋=sX#;h[wk5?Jue41.`cܺBz=\bW/e;ǁ(>3-v2jь ma~1%UF3@5]ʴvK5 g"i_&2k/ecJr>\8aY<~#YC,9:l zNI^3݌ \J]c3u9:bo }G}Kol0Wpt> U kӁQ3+t6ɿ "dfPjX`yQ[{V2m.?QÀy|sQFBC2z^Ng1WտZH&AvxC! ^hQi5v*O25қqs58Ao}i QͫMQ@6$/q.%~&hȿN'2П> :Eo\ 1nF3.&0Q\ B30܎$$ρ| z 災T5A_B.lNqp^Nm 3ip~gg~m[kh M?` &p+1J}ce/Ln-v o'v1-s6)/йvOAr m/QG[l@f hiۄ9zS5s/J@gC 0J킼ݏu7kV2mkЮշÿB2u[ @Q7W$,9pdS9 Z1c!d( m<Ǣ&w;RC&C([4c~thۣCBNc(4<5mc);t[$aQ* P۷m;oE_:z8;VL 44C/oVA Ę2#A_`+hxt`7Ȕ#7ho"CkA<qp:b Ę5 Wv賐b ."Q#.x q8'@Ef8$%,e滐Yc3ۑ} QV DT4=Z Ixĸ` C)vL/k1]o@xVYVVHk" h{aHhGϢnS {^WJ1R\vd~<2v8&,?C."q'Ў_,>?O@{v@hAt AwP #βcb;.,bZ q-Mqp`;F(.&0Q\ B30܎$$ρ| z 災T5A_B.lNqp^Nm 3ip~gg~m[kh M?` &p+1"ygroTsx8(<`mh}PvlTm:DDmM/P]okүQc54~ O@\iij L(h G@Lh@C.ǩY V^ @H]Vh@oа^qFd <Ќ  V(n)Gn:ĈCkAF88:o}\ }2ADrAޅk= yD!Oq! gdy4Zdhc@R’:D` E@;<«mձ@G3ݐHxD %b1 |1#Eu:g!Zag XU[a/b qɰ e _i?kp'";ƎϢn= +d%Հ.;2%;΄xV!Ne1О~;:CBP¨쨲|Xޅ\#EtK)Li4z+NR%<H"wi >AUIg'1p$MB&ߗh4 4d#0+t*+t% 2O9 -3M8+R,#0_9%3p&=^ꄓn4f >+sȝ̾¿YsO&{ i>z-ݐδ(~R@Ws 8.8 Kjy (*r[F 8Hӿ2r}8MziyUt*88[!e DFCh!A31O\zEӡCS!}rSg-sAqt_ ~'o;|:#wʆ)\ :@M\sوiV<TgPW(J4g MB{bNC}tu310nq94 . `hh39{+`QI_cS>GNnSg&ۭ ew *V$/͡g dj!oZG'!w Grtx h2OA۰R π~e}bMm 3?D~ 0t>h{Bn@}O]4g7 n崺94̣tkR,̅Z h?%V&xYsޠ <d8͑KllnI/!yfj}A&S.b.{ `pla? 7AO5Џ[jfas q n(/>#~Uc.^5};~IonkMxAu5oU!Y"،vњ\L6}ڤQ);=5"L[N MI+2"Bг۱}+PuECbi-pxP"4;Q(FeG"nwꢅGtCb $Eb'f;EG녛DKZ)/$"2.t'œbx] ŝN"N<,RE11YCbxF̡Z=7G]1{]1ZnU[D[D#Z΢Hb!b ISb2KԢ1EċGD31F.(77dD}_dѬ#%/cijoN "D%qU4ݢQ ۻDs1H f1B$!Y%FS0X X;0ll s!ICeӀ Kˁ23̍m=$k]0 X9nzX`[`C\]q@o6{Ӏ|pioboV\SO\S%E1u(V Gxo wfՂf*o`3Z 4@E(g4C"XK hӴ mVjgtC}X_oG 2L֒Ѳ&4Y,'Yr1}~V=d|σ*|Xr . /{זWĵETUAk}+|Оj{\aϞ y߲ Uܸg V:Ŝv ov ǹ:דu{WZDOwsMz_Y^9>Xǯܼj9/#eD-oٺ*|9^lӍPeE6z]F4-YPU Pm 6jq\//$wR;IS)kgB}PifegUjġgKdc\vT$ Z!j(^{r*S gSS+S~}:Bj(.ӧ݄-€~zM7qTNԑL PB!6c1b>N'>֧&}>Cl_-y%+cEPv|P+MCil&k1f57}O5f@kayZKs9LkeZkKxMXϰډqnM W?>GJiJ#+M/(]uMޠj*vuPw՝NRwjj"fIŪXYCT-eMZT[Vެکvj[TAQUGy:ɺ*oSUYO Ve}Re+l2URY*KޮrTlaU d*REN5RԓIyzZ=-jl& zN='2FMUSes5MMj.[jlfYfj#ۨyjln@-BPޣEZ{DvPKRyz[-;w;~zWvRdgz_vQjZ'ՇAHvSewYmq>UxL&ңP_DRzW+S}7V}+{E"{|DRduFs7ٗw @Ҵ bW+=Lg&ƙ kD^O'BzC^( s7E%3L~qkPsbU=UxTUCPܤUFjZjgZJuTFܪVwuMݫh>oz@= ~R*YܮRTh|'P*CD!jSelH UC]*_ƪP&j!Qjhƨ1"FSDszFĪjh&IVh^T/6j!ڪKnz+qoo^wwA^kz].Wo7D'zStV2E-WjZ!jxPRD7ZZV!@عQ$P$O<㥯:N~WN1uV]|bk 2~Z?bh)B33벐!CS/W[Z}>cFZ==Vv1zڢ-14Zr*fbX.V b)8E+{B!CB>,q/}CБ {~蓸>Ea$7O>,t,p/}$7>,t"^< Hn2CC>,t*/^:\;pXxIE^DB;Xfcr,cَE^q,2ױ<"s,2߱Xdc,r,c7,q,cEr,2ڟ:Y,-cEq,±ȻEs,ˬv,c5e:YXE>t,GE6:رf"[|XdcO,EVS"C|Xdcp,c/8ʱ."_;Ʊ":ױwe9ޱ~2?8ѱHcE9ɱ6Xd',r?ώE89Xc_p,rұȯEN99XcsE~s,rޱE.:Xc+Wl˄ 2am0ݶLt,s9E.iZoqS+dL>&e& d|B Y9Q>GGY*C'yX,ȣE'I<%O3l j;9V]vB2E/%seCP*e> epr#S|Y,ng"RJ-pPKu[mF=i40۹eT8+;9ا̸ٚ*БhgS2ra \9F5qQèi2n6jEjh˰#3FQP Feϻ jH$э{"ܸϸO(k)jȅr\"ߒr,OV&?L*_%I RIq,=Dҳ}[Fߣտz~P?֏Gc2LE?. ~J?~I+p4)]Ғ!2T&J){ɾ L#ȧX9N _2|Gr\_ȝKY"rFʽ;O~/v%W.kck|g37?Rq8ll1nj_ q8m1ߌqɸl+f%uѺduXX]nVw+a[ JVOd=lXZ}~V1k5d%ӕBf[V5ʲ+ʳZì|*b[OX#(Ik5zk[Xgs$yk5Śj`M^[3K,ek5ǚkͳfͷn-ްXoZKerkv}kZka>6XYMfkf}fm>vX_X;/+kc}kY[֏Vu:dd~XGc/qu:e~.XKe+h] !zZdn-N[g9뷰°Æ=6"ldب'F=6&鰱OGGGtv?~={9$Yݳݯ{UBkE݋ot/u^~۽{]?7?rot{s/%ܻܻ?tt}}7y KJpnK )pG %xῆ ?~&lχ~k;Xvz CD2=$"s@ DT̈b1a`ps0.ϽzZԮ]{]Ӱ+[#Gr,"XN%rT*g29+9\]!ה+Zrm\W'o ח FrcTn&7[- VE%cG- |Q{ NDDQ?Q hz](JD7ƣJQ(r]n'C[DD%1AbOq 9B!U_4"| e" S” Gѫ3 WqLM(hQ@rHЬ3 L=#tȿ  @֡bw}TlCC<>|uƱp8>vO ;vRq?&jbYVckƬ kʚk6dF5km'o9Ud uw95Nˎ >K8|EV!.ǜK0OQqp:tֆTV[#-Ysp$cp rű8<yx>jsboŧPD%10j JQj5M2h65D*hOr%"VDZhHGd E"'[A 'doħcZz;n@WXH.l(ɐFY\2_Ir%dd vlM%$qI4*(IH*p交7#%5 TU*U^KpT)U#Rw;.zJ=Qa ǥ &ҎҎ4XOKK3^^4DIc1* ƄL$1d| Og⧀[jUFzS*T(MϐReϷ@6Ql&H{XqPz"=߶u(S6v ]{9v.p$98ٟ/Q) Tx.A'衋k 2>zBׇ "!dH2HZe@Pl)G {X gEPo(Ԓk}B"f)o <~ȝ߮NU &q8I8$&q&qHB CRTIbH8Ē8đ8F:C$)H"qH!]w,+ =a(`MKslq]@wISL<Wuxގ> }s !~%KiRz1eIBc[^~=쇛7#27'2 2{#OQ 1؇ALDҺo,$ VHYAJVHDrDENW5RMA{Q饆ubjlC ^@KAQ u u(v: ܠPGPG³XA(D`$\ Eꅴ@_mKha WbHoi& _Rk݀H >gG# "C[n<S-x쎛7b@(b V.Z"uD 쏋  DMDFDF-DFI : 4!rԔȽR3"H͉* Fj)Hи!^x Rbj煩Xj 5_+Z-}p_%R&g1˙k0Ls9f0{D9 IG|ejddsdy,Y,G@MV".!)%-#+*&!)-+/{({,{*{&{!{ŪRVeX˲rcX;֞u`Y'g3ºn;ۘ`=&lSۜmz-Vlk֛möXNq&സj3 9a Ҋd}dz40iAɐѱgoj$+S'sbQ1ҔI6"DR%%At\ 2`3S@ξyC}uu"O;`w "L+n! ݓU#H= u* H=܉z{[B MDzS&GҏDs;Ѽ3I x2Msg./=sI!uQ)J{X*<+Ls4p9կ.gӁTRB(7> T7'ՇXQo"c/pUkd,޿+> O%EXM_@?)?WsGʏߕPIIU}j\\W{ n~6zȍ' LEQd?*h?: Yt'kjoNan8%d= AXh ^x/eΆvk. oϡl[v %) ɤ$V!IFAM)5;HȰ)MJx+6m]Jxל>emCJx 9yeI55em[_(;hSvH [H-"jSDԎDi\7)>t;$}Ph1HޟOv =ړIN <@T qYJAIITcV P c'b֘ 3o_o2TC 04%@D',LYϜ#urRmߊyiz|OQ.p{W=Z uwi6E]5H5 :$:&~@rBR焝* .q JcP(;ń'% IJ6NHJLH Mo&qBHиD@V\{򍕍<\={GM~XVF|-x$6AmM7puiGɻ* RȤa1|6F4R0Fs<_>W\zJЪk{r`ڸ-.b>aۋE77b:jasI~2iQ6`IQmךss8ʹlίgLщeu7垷v %"`_r9>}ByO+^grūUm4iZүҚl9c?J#_6-q:Zi֚tмsuZl `NCUt/fOgv\㯱QJhyVy#R#aA44u8BFb=^'UµJDa6m,s۬ 0w;~yڦ{G'''6qr ON qN1^ĤC(X>Ha\Ҵ |{6O7vÇIɼB߆bR$x ^𠒴 ^z;R>,yv41=s_DzD,28ҮDžOa-:1f}'yOTŴ1i7LUZE5!``ǝkf ӫLp*Z^5Hn$Rjc%vxhWSsM|J˽liGWB޽@!}|-esVvz =真P}֞F&ujx?t}|tbE5e6i QQ(vQFjH;Xd-š&GD qԙW*I0k{(<`cO[qџhe*rSGh9i7˳d,?xNѫM֑w<9'ѫILy|5һgmVgw-)S]bE+mr^V -N]I+]x^lE:z::x8x;;Dx)B\ sikt76Pj_F!$  "T|cރz!+d^lO/= K$p bG΢4z$:&K-uNTU=`Э*<}?/=?Dz?Vq3wĔQk+v=Z4Hi%5oTOWٮ[;iKgh\oXd~Li^l0/erFw2Z8tu:?!ɖNJ a\ifնyB[d|-V?2T!^ޞVe{5X̜W72)2]-+~yR;1/ř~tl{ZrVO?<ڮz[}'pvW+Zf,tTR_䲵[Kwx̬q^;hʩ]& q/z~8Bzou*ۊ=k ;ksJ{z'wlwGLXs|v;Ϋ*~{:oգa{6}aHcɦnvޱɆRml>ܫI)+tpZ~c{;,LϯSDTׂJbl jUWQـijMqKBOpݘHVCbGo̻.Jg7^`J 9 AŕcsΡ-ןoLᙎyS'*k3h!ou>i{N"qɋ_`hyԃ)F/?`tlǶTO+:xهd}'hc{>֥t8{6?uO~DZ7?4[}VZZeKK}QvQlVe='~هTӖNJ'!uާ䆅ϮKSZ)XXtPjI5RSzW84/Q/] HM,K%0A {?>66͏ŭK߲[{ mo1A{]"ow4u8c$X ~|zpbAڳE> }=G[89s'\1pݼ)k7e տ9Y1y4>O ?o <_; mʀ(6:o|vXᖲ2/\\˹wn/Qg@7O1|?ݱnҩI75\U=g•QF\iQ<ÌzޝaKC%-:,j^(cũo1skX1.h" ,&S>}ȋ]M7y~!zN4h  e8d}ϙuh^gFv`q'Zg᛫ѭ먴ڛg# zیn{@YțI,+,8԰{ńO;kgV>QdUu?B1RO K 4RE} ~YWf=~VnMjqPNWW??EīX&knA9go^2;;~/u_ТĬ1PQq\?IrhB)g{Тo=.<4 M81:9oYww5v65BQ$B ɤr G#`K @(`xh9** f}s/ei \:k!-˒M!svgV7r1|^f3G`Yi]No{ o5>mxrvo[Q>SwXM ?F;ϳn+'7g=nnWԨ\N\s+iE2g/9d's)=~ýMW*tnyp#qoU߰obgFt|BaIrYKZZHRtY Ǵ-vm]ˌݳ+~o٧ ouʢ-$%g$CMn}qxoe#NOɺ.:@TPÍ]lȑ}盬"}%o?q#:\l=~ӞR4-W;ά>v7Op6SiՉ}OY}p7߶[]87e{2D!2MO0Oׯ?(oN*R^.~lɔ_6ob%7Mdžoj3y}W=f*y֨XI0Ą(N(0PhEV:G$& H Ma;la4_b"S<Њ:E#5^&\K~pjܱpn33X+iV^ap¹>O}uաKOE 5qxA=߸&GUUxdҹlfלF||8.y>G4q WڱP[]<`׽3;UHIm^mۻ}>3 7K;U4ky|UngB -LV }hFY=a#2҆]5g_/ɾ^}X0p#RLJ7g{?xdWC䛥4b[32]$JFuǼ;:VqfEs옫:,1Gz;{㿾GkiG7[qj)w5K;+^zMOaTn^8E-?,Xl3'S>^QB_NN8 Fk> stream X |U?>sιoޛf7Kv$!BeEQqh뮭U+V*hkRm]Xm*̙3IX|9s<33s !| hFU˔i9"_]Q5["|yhx%@H寭aQq- )5k[Z+-9[Kޒ[uaվ]Pv" ^/jʏK:׭Fq(\o\b<-tv{<8"t?x\iR8_ߖ=^.BY+Vuu*ȿ 򋟵s@ih.\?\xx6wի֭]PM=? #TO4"[_ϑK߷L'_J2*!zur4a_;v#1q%cHA eL}/DpF)EYSɿvqH88w7C"4GZŝ\؏]LOj JwIDq'P>B>=$Ӣw|zN8N>^wL| odlF0v~j'N?=xOnG6=4*9!Lw=tZ9qb嚁.A+No3MseR/kw'V.09Al?;?x)^Vq|נNqC( /CĿ2TuBh)i&;,~39*4Gv y:Δ7;5($E!a/$^BgsK#*G 8E Q)yTW)o* 0ek;,Dq{|j4s y†&7YP@oNO@yLP+'J߁d!%wSQ=4Qq?hBx G+Y}:™2R(ۅ|\&>Q5%*k_wsǹqox%'83oށ0 u0xqh2p1t)`7;桫Mz.gw{%?BMB+J(d`r@YD%Z]\h0u)(?'Q33zŀ%N|@IsJκ|:%)r7l(Ŀ~7$Zh.rwB9Q)7q5M(+D lk*}F}A;sǹqqky97kWC sѵ>t]m~' v or ck4Xoߪ߹q8w;sǹq8w;d)z3E L1 7ŵtFwП8 to7[-Vگ4$EQj|;q&Lo-wG>y.ϑ.{_×Tlj?-z?]GKFtR`W'&Z_??'2!3rBQ TPmVR6`#vxg9/+*_+z|+>gse BP *A-hGq:Ņb8*߶pz?'~;Yh`q6 @5"^q AS<_\5se_2֦5?`goBtwhͳ/v/1o֙-M3OP?brlRiIqQaA~^FzZjR8L9&AQ L9R5 ᅽB8XWFNQ5'/OLOJ)c)_JRA+UA`wPSE.ŀ\v.ޚ ^XiԕuZ*Skj&W2,.CJm/V] 8T)+Uy2}v_=`DFym|'\޽^S79X՛NrOoj7Go{e!cпs~tbL#?G* 3lPB_ @r@ -@6E~ˈr əC쌭Ό^0 MUP`w"Z*h_ ᅋٳ;XUE67V$)յ/3w.J,#jhj+h6X&^"]kE z3HջVMmQȻ}~ϾI9z(m݋{} =?#y2H6#Yd2H:#i2e$dF0f$H"#AF 0gH<#^F0fň#vFlX0bfĈ#zFth0fDň#rFdp`FD#Ì 1r9W|ȿ1OF>eFnj 2#go #f=FQFeFf-F=#o2;F`uF~F0kF^cW+K DTTlo]HŖ~[7MTl*6Pu45TuXE3;\I *SquKXBK^CE7ME"*:XH*JwВͣb.u;Qiqg\fRBE3MVrVҽ[woMH4PQoO:*jidMu;~ Qo1Ta~Ǔh~ETjA@ȣr7Ȧ)Mb&263H;RPL3K"BEPh) 3i.>*u^*Po77.aF fz^`*TҔRM#UT(PP!)e4@#y*8*0(6bX#6t ݾ|q_Bܿ_>|} O| s_>_~πwAxN.:V¾uQk_^@˺RnYab#iSiԮ=]{\w0x s>zh6lTfofAO&w/~nr]~vA^B^@^?n=z4ukK|רZ}2>仔/ąKZw^wGEZ֪ن5<]m?l꭭[Z/ܻusM{7>Bb*lnXl޻Wm0677k[]ۊXcmZwk9F[뉯ۺVgYӺuU/^zpY֥{..nUpaŽ{;ZiwNk{a[lH?pfkޙ-M{ZNkS Z6ֵN[Z[XZ Gq8o$%A\y|sÛ nK6pt^u78bWwp#9ٍv٧άeyYyb]ڃ l>Wadz􉉷=m30bbHn1}VAAqkDc:!9F3f4> Zbʚ&-؏1F|50ٱ |7%mP^匹P 5_ыZm>U쵒'bkAކ^oK[@bA>;h_a]4~>|_>*Ao ($C|6a=AX,r C%#ܥ p1`"v6V-̀M kVV,,,,]ENB|@``.` hMiF@0PUJ@`2 (&J%b@Pr9l@ HRQ@ € $?xq p 0@ @ P@#8 ԍ!_| 7 )?ீg{?x?~x;7_^ *ˀ/^<%9À_~xp4)O<8<xp< )!^c~p7.;n 7n\ p% ]P?ac?ac?ac?ac?`l`l`l`l`l`l`l`lac?ac>ac>aoGvR܉'B=֡مA7"-nt EϠgV7Ûe+ ɑc#dq17B"bF##kuo _xh̯'arOw?2|I:hBs\4uO_YV|1t>[ߋ!R-XUh5`-Z6 :)DέFlBt!ڊIŘpf؎.]"2&iNt) Zrt+GntZti5' {/nC}1Vt' 9w%2rI:FGE]v֨F^:\ : 59TGN[&dHz$)wBJ m˶4q=ԁMbbkLLmbcOoFwV !p;G-E?_dLҘߏ ڋϨ|Tl^ԇ>ZQtn}R|hA8zzSXÇ ➖bq4s T4%XKe+,^k7X=^ddoG# X)PO"LvTUU)OT!?8Jqe pcykxӔ\q Co1(cguO_5e=r4+&V=PXt./.r='9oe1e c7Ӈ`Y`e\ӜV2 {B˔ W6׬TvפL2וŠyJN❮YQX&Ra6i őܯ5D#0s2ocI8DNj`8Vu&xj Z5jGOڠm6ZQyy(#(25M9h Q4#|p8S=;A> lPbc YTªՖ`7dJ/\x[/\?d^UT: {BFyAsЅ~nm"`QJ釈*! .EQ!z>9xh _:rj: ώcIn[ bpfӤĩ$q*IJĩZ:sAJ3HR'/iE> 1[sHiܑϲnuS)fr?ጎ2D)hrPU/ 3;%Ӈ*n+ 4#:G>x݋šh%*i%ȉ3PqjEx{鳮.~uMZ?ftg潟qG)mYTHg^&3rS1-` 9s,V 8'HAncRqKq? t7ypOF{ #:;K(uf??w4]G>Lz>eفK돛vEEEEE}@E^Tm} M.b8*㰩hvʰYU S PxǔVۙ`UBUkÖ8EY<&_:L_ä^R# d~T~:IuTk Z8I" #| d4 R \ EeO`5j_b}H{h6QuHvHGQC'ќ_`"vQ[&bƿ lZp9zOzJ/>b2 *;njsEY7Y?jZoZOz*oNH5*8&8}c`;ah`yj%i%i.VR(7Α!k5Db4dp &|M {󳳜eVXeiݢm%u7hy0)AH =۵#cSOB kdPP@V+PVYguR5T~vj$^RnS㥉4^H%?.`4Ȓ:8a*z}|`^UU=@dV]s$;-}wr~ͼ%k]5uuOJjW俁p%86%ʥ ʥ ʥ(\t K%j:%k+/yBC˵P}>[v E;D/*x$s_6tӍ*KEMR.[٘|dvG]M[RyQ>oꇾJj,h 7 PRV K&+rQ0y7.^c8sL 49$#dx H=;?E%vGhIJD ƅ7ъ^aXc4h~N(QX 쁑} iFpn?e8ߞ&1?&1֮ÿ&&Zq҂R-ԢҪKrhrSRyU9^;:;  U]#UizeJe5Xd~ړV:HwkAZ9 SDy߉"\YL-rބl)w1?+3Jy}edcP=atN;wJGjjw[1ĭB.լkJ͘qʤٓtr7Yj|ᒋ_pfIK/XrsǢsr&Ķ:mEv}Dlr֘JJJ9#)p?>e|-j޴UIŻS9/L\}ۛ^R|㬞Jʠ2,? 7&;_#_zZ |R8ά(+% y|?xBJA 0zfA9趘\FF)1(qL8ƃ17r-)V>|B&@!?_itYn(L%1 ]XF1T/>$CI0 ~'SM~P ]/sWQ7n28@r X?)T!qeݝ]W6wF>b ~)0c^z_rmkU_mސݼ$nj~7e*n\m>G|0@}A- #QCr$:ŀsJߪw0d*tJ'tlJh5.fhgw0hq݆,a$Z=b) mtZEn!/9er&w269lg'.[n^}Ill8:.\PL-?W)VO;>ɡ;%NuTF{I5L%1MVD5PB;iiœIk8+#5!{ROcm?b4h#-ϸIfr 5JKɆҒN`o+Sc'¦(Op~by+Mu*^,&In!Ra]FRܛFðϚ8V<Nο~b}E*DSmihڑ*ANKKU %u57]jT:m.D\0_m?ɱ8Ӷ&QX߬I8S.Ϭ;WRNNpH[J_B[_9?垏Oqk RZ7`&?@2Ka{4)b}%; r2yM9+}sRu,v#'k :_8aVN/VjRG[gCns8&yE4 6&7' =52J8tOsRk$$-XM"O#+.,of7,`4^OϴuV5'lyҊOnp`k?PmsCrKcW7L]_~ZծkqEilՍMso^YR&e=Ž3H[ ^j_X^\&ӆukbݩ]dsG1~G?/뺞=lXύ%(eؿwgɔ,Kf 0^r6gZO}"L6WJ{;6Ig\p8⢦KJE_^DKfϴf'2ըpQȌ%F]2b2L;5D@87N0lt1UQWJYt1 ӣ~KЉ]Mt[ bO?Sa;^ږyFeѤt55s:ԦZ\ϫI9X3v98R~zgmFתpPJNuزdeИF 8nF#IUAqe~C4>A0=V/6p,sNmSfU.Ϫ>\HC.B㗌v 4{L b1K0ZD~Y=.?yxaxw.ZpbMNw V/(*_PZNϢœ.VcΞXqybq4H/ N@9~fLqx{21Wty*MOc n/a_BS+ & ~_ +l 5 E<}[J埵{tTuҦF# (c)Se43S=?K. j8{dɶǘsH=X]dU4Rn.R5 @,9i DbjΝujw#Nn, 3#^ix K*9Te;6$N|FGbu{)q#FE$J %q(vd_t8f i6'z,-WFN (dQG7 r4(U/6d/lWEXn_2sRЛ`S4hj 89a\3^۩0AmN%ً9-C>n7Ov)zujO%։{,@:oD'"6^89Ԑs9:Ni[T ~NTq3^7 NwRį)5rA0HoUolQ2;\~+|P_4JnuX K + wq/m]H)9}ҨVh-Z94hͰ v½ (.`,CY 0{ٳ77T*2*xʑ⩹d9l6jwL"ZDQXz[,/]NϢ\c.Wr(\>9e{bpB[z?j (u%ӱf~{x8:Hz+F䤋޹ɓ%)F NZvˍqO_rCS,jϚV4sJVU OŬŹW {MUw}UZ\) ,ܸ>T;#, .;赤nyؑV\RQWԮ, cN\):r Vg>|[/iE-/c[<ۊU@(ȩc*dSGcc>Tq:Foirt??b;un .=麾#:&4{l8V 1+]5;a[,VZYVlxS8|% Q < q ՗tO2Td2BWs@c~qޕp?y-b?>9MLzZWK~K=,H#[|>T+EůWxҋrOs2-枼kni6U9Urά3DJ[7^u*j?4L:Wk]oeOo)1z=<{g[41TZgEdyߒMYЄW"'WH &^\U[^977Oo2c\swso[@j~RS@Ae͗=ŭ[ȻH`}Dݨ1NqM%H;=1:/urvkKZZ5G'~A#1Φ)Bv7̂JJHNHwgdY Ff[Ch(SX՜> ے_@VNs|NQ-Tԗ.eפ6eͮK-u -Yw!!V0*BW|%X)"My^D("3iXD(0Ē!M,ϓ!M,dFS|, Ső9(N'/ν{r\cka)6Tg%?ĩenճݰ`Θ#mU0;90)VqvYSw-ZĥՕS6T 좭Kz`ޭ"m~a墇c)y <,~%J_I%ڢ?B=D7:P7ʑW I MԂ4a((!\/p!.zW9oqSwVN/QDg UD\C5bS2X9Vݿt]ݴ0>~I86Jm ˬRe`WWrɞƞ27Fq既~8+<<<:̔k13y:̯u3:g8z8S>x0;fnXaOrlxl08X_DWV+"`qe*ʙTgF1Y:!(3_1hmB+3oR'&h1TUV^z ['fU?X_^Sfp$;mV*obTiS<'\).i_@{T3IlNX65AAȀÀLY^qrWI[^ZaSS69ΎfV؋Fn_hk*:ڕZI_zd߄Cg:QڄDbҵvI|3 fTSR7}&h,KnkԊFLjxb& #>ґFҿSƢCD>P|[~Ob6ux$9'S.KߟS@)~N||%v+ @<:2'Ҷ~AMdrpjݤƴ: dJ}A+)tl!5\NhUGiZS 3,SkH}17_qEמnbVMM檮rEW-(ً_5ݳWn;qj]j̄z]o1G6%OgN5v'۶o^d׌\^W߾!4Mg̲ oBĉ/;ٵ=s";vs0hjw4hdϢ)NEqGUH7Po|Į2A˪쩉\@&w(S]qaC8..R\Τ!:(Uji) 0s'>?cF&+!X:>E>bKIE 2YyumSjEu9LsWپū8g+L05s٧*x;D|x7j.qƨ&I B8Nav=%$nu`)siZlF_/AfK: Lܒ%]٤uee] N.+lK'S -5)'+`?wvS;{W8Zr%i^wǎ[ߒ4F1*TjKڔ)|7J:y%̿v@۫@MNo&_7V-sõu/Yм|pATX1_Y0dHKD'/yX+N[ӄo'#ԑ2#=ޙS\|Ǔ'~GM7|A%'7k7:ֺ\!g|FQV2_ƅ%EA~=gS@"AeOΰvǼ|i@~Hyz<԰n=zt24~ 2on^ݛw[s'rʊF6׭[.k`k}d0.hmx ZE򥜮=;yq?#w&jo`TF;&Ga@pI%:Ҫ*O@JBتVhU0w|3y4Oijw\>;Y1-O~++Qb6sZ-yW—h9#_.3=>JN+ f8#2<2ht@r"'M ubNEb!C/Cma!ҺśsO~SNAF4@}We_to4ȼpD!p~{Jlx{8lxg^r׀p+; {' j(RdUKVd;K$[EJ$%t[ˑDZ>'cqlY<~3{{XD%~-pw3̼3oyFq?HjIPq>䶤&֛9}[Wgv>.8d<{=vlq2o\wG ;|V3m,_(bq1;SeEuzI[ZvHZw}QYfG/b={~uSÚhcpd?M|kX6V/Ra( X|_u&rSTp;Et~EV^;wkr.b(3 ܎H_Hv5D V#Ei;_sZ%h(T6M-7=mGy[URem \# Y0j^숙ty\XP Ks@ARкPH)k" K*DS(CPytqʳ>"8͠.Ǡ$%6yǧ&Kmfx6wgߚEH+b} ;)y~ι%ֻ[~2(Y>7ח:u{[jKrHR/qIe ʼn߷[ziqscK R{(\(N=QV*55:o697TEwMk:whyIMh/ͮ (3-Vvyʛs]^a5MhF_bM}ZoP>PUKb8d O|Rϻr f\ h[Tec>e܋8XN4&#:w\B95"+k%~ܴ]=_̭F vFzu::}@k?w[ojL…lj7 v_xam(3TuqU]8`ʬh9L ^\⢏lť ..1w._p@g[S74Z3' EQsycG늜 /ørkUG!>Іf5AXyMş֟-hRW-ȐFꈨ0$ hO; J7kڞ>yRˉˤRգ5&2MhU:=V:dRMl0wmN?MH)Jo.ÿ {܇}Fn82@֑@Ư6T^@Ǔ7 ) we~OI!(>+*(pEsԯQv-;bBn_TVM tD]uns{JaÉe] %Bm|3eFަVB|ϕ틇JAm4dQT];x] ѕaY/­K3S}eA,:NNXj^,܍==*?6bPbm4 OPvnh#mcmECsۺ~5>:v|zƗ5|÷/n{BxRVY r4p/ WIEd~܅"=S^QuEܑ;qDaQ~C\r7c@GJ2cpno59>1q~YwXzSRa5]y蛦|b׾{l^q#&%cEa6,.)乞AՍ=LgWGCCCeyW>`_rDrlm0/VDJlB"VJeIJ.%͋|t¡bͪ;VDVksգh:,c"2FM[}?hͦݝuz7>hQ kZˆ9+bHtd=S_;E_ŚAuGYTgQ!DCzeת7*TPdҫ;'6#o>VNE>x!x֕kr"ܽ;\(ў`7Ʈ%I=2YQ'{YQCd%KCdEYyx~Mδ6XA;Vp[/>W]qRsj^ӼOrTz}ѦVW)> }U /ܔJ 2po[oMUs^[LhΠ ]΋Ǽ8jKbފ)e+qV')жe^zM0NlO-ndT :)VT^NT=.Z¼%k 8vغHƫ}_;cBng|:/>Fb[Vߵܝ=zvMmAcˇPZLE񊭯 Sêj.=Kz X-'Y+"ebZ]"uN%S8?t4[(ms)?2*MpZa"^kBU"nl혽uW$RT&'0PhO"1y CpؑOf>؊4?pGPY`cȰ褹;5P׍%b v_IyJIe,=X@G?㮟z޽Begp]'~vad>4yy\X ٹi g꭬xQRu㽉]e5uK7ߵwռY]W Y{_I< ']QLr`?=/GF;[ kf_ߔr> +oa XN᥍'yM! '!0]@i#ƆNs ZyCWo >;ـ    QC !% Nc߁ZR 7MYdF-)q^@D"hOϨu#E.xW?ȣ$'g$+#POWU-ɹJS)Ed=B!xǏJSfg?C}Qp브I\v V4, =7(}2=sCDk$29!LGe\ gM 1+qKBr$013t[: C5b5ȻAVE"'>57n;^F2^JvtI:or'k]2`('jPQlrJ )F**p a>UVeFM&`#H6 whu\_إ$k$xd`qM2(*e<6K## $f]O2,Ш@ AERZy>Ȗ0{),Nc q3(iY yY7~ށ,QK` *K,SN՞ުCQ |lWeWDh+^l3 ’E fSbƤј22oҞxぞ;eggFÔmhV(Qf a! QF8WbQ{1pH# wY]g#OK֟6uPqe~\$q,qwx`K&b-d (:{m>DRi% G3YRq*DNکnkmQRdK`9QpWa;2"n&)Ej&Fthq|}UѶHh^;=m(l)/kEmd|dksbTD@Obtӝq3h&삫ƋŰ1?v̲f,XVcf*, "v0t1쭲9k:!cpwOprRT 'sGo8cNwڣEo BmU #3á@,=mJy7b '8Sf򹤏&v=m٣#Ul:3W}S.K/"1!ߧP)׉UfŰa}?Oje$Np \##B^7X-ln3%<7#QttVF~wQ T_xC.?^b]?SbuJ/+}~$d.;A1;v6cc>/JGnhŚY4 :688Ӝ {ua6W\* Aej8-QG'+˳g#Lwy-PK@K:ǣ="}͒ox2Pxɽ㓗 Ţh~xMG<G!fW R"7j+c)[$'oHb1D\n4kpWpoqRJ UJF4Y,Ecn njԻÏK*,_v_{n?̓hc#bJgskrŐXg{!O,8 N&V|7RR$?n&SH3kRmf]PXva2"8v<_N"/9UF7W N Ȉs`Uv)^AqeHv[j0?psg'NZ%t*M=tE!cd@FCXu=|nטi)!z4.ŭHRX4: '&ĉ;q)c&5hZYVIQݚT.S )^VJb7;l)35Qܩ ESDVN[490mSAh!9OB^e$Gw!q !!U;MfVFBA49!aM7@ZJLk@NdQ(jN"*F^B>[F<)A}[Ÿ@eN`,f_^rjxr:/ tm'_8-S}\LHQ0L Z29W?/dRbBJ&;z @9(KXB7"(eAs6>:V^8.RYpI!if=%LkeZϧs~:a"[i l&{;p1k5l4 qZ)IQ\Gk"\> '\`~T81/4 s͂2'q7~zBr0 vלp(=8IytlPnJrr-0,E)RZ94U97- oňSS C|o@')(A1L+-iЋ9yR@6í$XW}t~\Z~}ȁNVSNU> }`.rpK0 y"|3sISrss$\Xǩݡ|>3\0k ·|0#eE1AgF͜ cV U}D0@>>23i̇p$E8eP`̌Qz ƼuR$!˩ TjVOrdӱhƣP4;.āz҅}#|(ln I^-CCWvsp;pvdsመrsኢk|YtFM )c=`EӾ:VF b)+D+C;{.NP@+=ʐJH *?$_)5VɉHiNDVIKEZ)ޯePZNmƏ޾Fzߛ%gIbF3;C|vv/U p6IUjkq <`4:ID^%Ȋ8J }>5]2]:& kpn(c {~VxlF䲽m&Kk Lg{%Kw =y\%-BZJ%orȲn8}+؊LYEș ";-:u(x{o(X9 6̏~"S޿EN4Ub͜'Q8i9]ia8U;vhˤqXPMɪիE8ck-߼7DJ8)g|7d ['-@s S3PK1(0 ^)mΨkI ͧHϗxhM9>1y//T`{^> MǴ4AL'üc#H{spmJ UQ ݉G?J `#`e*$m?r n 8M7?߂MBv ZS$;*niČ XOizS#ͻwT%r׵d0`zFC5vr/>X,+y|+3%1shgriټaYUX3]j+f&\j;k.eD suup;JHetS쵹c  x[4w$w~+oYty˖=: bQRQ|7X|"Wñ<?W"W9̂KZ( MB" WeKa9Z'U_IJ[]PBXiLo} Y h%Y8 '-Kc#P&.8E\MH")ZvQSIE2Z =+Ԇ@C\,țe״/9*nܳWxRJSd/gdf:j/׎v9wT%q^µ:V.7ޮĖrtI`=0:h'9j[Oa*uŐ5$v"& x`52ޥQI&˕2b;F7yvwמey܍ D-Oj_,aF-Z>ݾoʌf S"\$,seѺkQ=[uv\FZ9\Kˋ. cҪ]\ ed:ZǪ4^>x_w'Sjr]D) a1X~)]q@֊&1$IWZ'S.U7pRj[4S-9?+bDjQ;iS}֕(x}*CBzba6'RZnA03[љ9𽓁T 0=0c`Ǜ,( zê{ZZT@t\eGl7e43G~b[qL%'5r׳s[Nn<5hN sk_qF"gڢʏԝp\8Gt`)k:l;O(L&E,u S.vzE,V5\'!)p<ɂrj13iclR V(_p; SĶW7W{{&giMmm <3wՋ{67Tkx/N6ݸ-kJ;ܶhrt#Fڱ :kqX1=΂㦕рx-OR&.'*1@ ~q-#5kV.&&/gѲ~Jm^1gq=Nh}2X2Í2pcn~?Ne_;Y*%P +:׆,ym6*WD5S |Ytz%K|嚧r%8yLn||Ӻ'cζՅl۾ܸe㮰ksWqmo .me48vH˦.{D㺕 񱝭5{%kS;Zm 66Pju:Z"S۶ga,Ծ &ѬD$8+_.$&e[QIi^ /7eA$v:8ڙTS"B* .Lݻ2&v>ҟZ8*nV+O޻bj53p ڪS6mwl駯^=xdG<11]FQ#.ytC_A<'w|/m&v~/m >oh:ֿjh6! ?XbӶ Wd6IQji,J4kc 39 \)gB0 -|/@ SJ B.C% T g NKJFvz1t&;gbexg \Z|p5vi(&a/ 7b#*CL Jwѡqs$\3*--!(Z +)%)rOq+"ν+ihhgh#ɩ󸍁fL}[I/)Ka_PA "[`uY-\p8Ⱦ GF&&0yuf7R1R2vwot0-aIz,45P$AJTMts%+ G?9hƪ>uICv(qV䂽Y ڬcB@$=3G$ & bʹovB@ }HB T9-"LpNqD΄~ѕfĦL%1(Q)@8^|$]sޓ ٗ@`M; hd0T`Eb_<}3 :I*Գcz,iirMZpe/ݍǶ|vwg4(̬h3۷) gF(r;Ԍ@lzOc^+i|hm?+MEQ"Aq(i ؖД +i MWFN ~OM W:[|5yG)BM-^\.`)H2/;Ԁh9 SVg!৸XZj_ ɕZV5xKkmӚv?MmD3i=\ GkG 㘖1\Ո#@3Epi,@Xt%|\PYNz']i@~+ 5>Bӥ$Iyi5W,n(EdBdyoBkCyMx]x8ps kP(Bўo^mt{BѴg)MeZ(]PV(0uh&ca߇jbb7ծ 1z{vo/ qc!W߶2~HcCܸذzqǍkB #B͍ 8Cݨ_ %bZ jkKK;J_vq}m~5&%")dd&XK>JΚԌ^%au#?] O-+ Lñu?-pMo9j^S_iJjLY,&= O .,<%EMn wo)Hq1%7u2vjrcp^sWN[%$r1Pt*t,;:YTos p'TsM@o-=ya|[z>zS!:>J6:, {,1(zH*xb(P `/c Vx*ƨAoo$b2qS€XUValf|rݺ%5msYyxYؐ^T( ^)[0V/IB|cEF mޮͱޒXp{biYzv[*1FW_>0Yső- HJcXH'0hrAX<Il=/Ϊ"BAcCBí~X$)5%v{q]ϻ"bkw/j_5Ci㺍4Xmg #hN5DJV[{G 'fl|owf̮ظ]OnhҪ#(z,\[)ﱛ$]&ֵkq zxO ~ՔG93+XF醇F{Zk2xx @4Bȫŝ,fᾧ{c`Q\ .ϊ2q)UFR8*m㌴DB9HUhr@@ՎbpF,wd:hcʋ7eHMPoUx {O_`5}Hv v\3I&79[ĎXT)Y XBN盒7IbX :NVl|ۼg Zhz Cid[XO].2Ǐl.t͗ڈv>1ռ;$GEz$NW󪶦v}S=t#f@Gܓ35 x*F`MZhO HD`0hX3'+'GZa 98~a%S-#}gUUye50?[_?=wҌcSޮO!&Fđ q;?&ڟ2g2,FT⪙:% R-jDJy㺃P|X_7cm#ӶKI QqUحKl0YC*r1ߢCpYjrD0]U^cPCPn,!0@S/i%'J4՜?8R} %Nj|n[.MThi8ʦ].;݇U6} w-σt"_ƴx(,Z(TMgލ_b8գxo:ym˷ B#{_ Xv?f';f=x Cw2#\k-1'ΖdzV[%p]نw=2QrBas|bL(#ˬWV9orxqVU${PJ9As8Ob۴tW&c;qM,j46^ _5\~jUzVx=č]7=;2\$n"*+"*r>{m^Ox|C̗gڦ5RP]DݵDsVgn[u\6vP)56l_AK\9 :QRќc/ӲuQB"qGsw(/u|< LԒ+B:˦z47>"=Z7I3fs'o(cx R=8ŌU[,Gd{s~@Hh|=Rs$a1(nP!\Tcc>Xk@y? Ebpulo]b!ʣ8@fݝG x sP }^" GK7"Dg8٨˷ JFڢĜOȊ[ypox!RNEpLdG%$E_yrFYMZ3#`,( q> ?s$Of0˒qYJE|A^Ո:n=A[tУ(pU;BP!p; .x/}g6;?^WC%Zt%- ::K={+SO\$gx`c5WuaVxlc p*,Ye[9Kf42՗T-.NJ  XrxÕaI%lZZǨ%?r K9AKy[ EfA"[ R($ZI^nI$$T% a ьհ4W) N$O'J*4pj8 :P D.?\ xj1J=,ƹF7SpTݴdw>1\M9ծ3S,/QKR:"@>3S 9x$QL@K E?<~+(x>-ip=$@ xmUUTgtF8rjONS,3{გf(dDT¼UtD<H_ ja :bu:ZH#JT؎nHTWKm3icdV@WM@l3Q< }n7UkBӊ^Rs xBEaCx9Px7E@5ڝ%EHV$^+hY_0 `KOg6>H))"MpJY8'+& wsfIs{GOm&hP)XǢѹ3>+= =}䣼ONc,],S ojY^Ž<%3[}ThW1«_>-@鬎%d|O D7=''k`arsNnY>n/H3J&kHQqjH^$iJѬDFB( {G%8_pP+.dP6Y,rJ'ΨkKL 7Vҍ2I$4rHR%xE B!Ą z5velY60D Ԭp)k7kt1gtfΨU9Qwג-y68+`QI|t=ݞ<2΂ߗL?TҙzCGc m7VzD?<8eR j 2L+#{9kQ #7${R x(Iע-b 7.8A*"^_dux(Еh˛ i=p9g; pB^ez2^{½&KHz/$xg] |E ,t=rK!& RWQ2NJ ck?Л,WRFxO K>UF.8"7?|,ј7{ j SLI=O!Kb AiMց=T?c-]di][b) Мve]%t`H*%ptV=m +aţ,xe0PYp(,ͤߤAPtj]/'gcjuJ\K'<;z*>r(H[H5?`5ͦU/:dS{r^Erkzw&6N-iRBeJR*xۖ%5VOiE+V4]+zñLٸ#ΎUr@Љc=uW" |-AHE +ߧTbJ ~ QTZL*C{Ry APv,5c/c>U%$%BcGKi8E`nƍ _@7ٛ M+}&o5]Wjj'xޜOٹhkJ;S޽F%͸>}'Yd32]'8:bDPvؘ|R>P,jA9p&|P钽_(s W%'b-[^y#+\ A#.W776/`j6{vjzx3oMi_xMkyܥ+(oiiJ*e =;V:řvOfm%Fa1hH!7=At_xIO7N 9tZP0XMoRr9j~Q~ۊ>wmX; b_>c3u;BSs^-e;f9O J=~o/7}$."Ey-EBQY[3ƃp niUi"=:RWO03.BFT:(46p\aP:2vv@+l 7_lV/r0 7VpZ`61;\qG[ᔃ NzS}[}#K{gN;5lk=CVbnie:ƾ&%(߹*A)%/n8͊pڑ,Qof-"F(M{I$Sj&YL#z? K).GGipdX^@(-`= ܢCSq8Txͤ4boll̕ ' Rϴl/XUʌrFw:1SVa4œ :CQE837cj׎C&Oo@{o" 2 x/iZc5@ea*h%ΜK7osAz7i/-ɤPsȝӜ5.*m=Fk:h Iyxάv7-Ah*SdhV,3+<8E JN+U-^k*hL>ނǣ n)q:g w:4fɩ\B> JE$H"Bw,~#5@)7fMEi3"P`HR,Ճwy[\ cm$'(̳p g &g>ٮgk٘O̓tyNZ ,pbLk>]o_Qj X,W*?Ld&LD,JsȚJKi 0YjcٌPDQoؔNG2&Ӂ8 K"_a\վsmw*MgU :ځMɎ؇- {6 mZaeM*Ҷ:K=w@{A,a (A1! DBI82Έ::::ND#"f€Dӝ.u}},Uu멧P}iyY0ҠXNgMVc )!a æ 624h𔁑!4` `K㫷Oہl 78C]t$Kp^7eеj[ 6Xl<8fIP]5zCМԵl&+,MwC,F}>DI/6^? \Mw{ pqk )I!1_;~^f ?5jа1`gҐԄ`sk:aplDZv،~)Π>qI2\iNK%&' GtbB#idy9*m«fcøF&&`ll [/wڽWw wp%\%+FSrҕHJx8+.` 5S(J R$ <13WqMW&!0M_Y@,.Tws&t0D[ K];0 M ذd116d25FIqѷ]ʥ,~ Wl}]k1wŋFԵ#b4Z&a)8.o# fƄ[oӢk8 wCbѴĽp^=_|W|Ɔ!0W }Ơ[}1H3obcvqݶ&O# Ok_|aT7~Ж}|_Ai>_o\^yCR7}찚7d XY7b`o3lI7lJdd_޺7#IaxRޓnp:ݩXlԪ}wԪ'ΥxW,lUmaffhۃFv񞗃iG[Kp;NxxKpwnw}R#`ak\ĸGhCܙ`}R;\t~,n7I_=L t `ޓb |q5. :o"}2a|kPA½vf4$rYц"M A< z/I|>c7Y:BR5fM7zRdʐ^F}Ma齬S-6va}2mMcb.+32zhth[pʰCǚB-7,%:%! OjPcKW]EHh5_c_I0G[^ ij5wb#] UFƇX&- 2KwJJPtdLՠ'Cm\6]zUED$+QD@hV&Ӊ,- Ab8Gc,{(Wiȇ|%pfwEQ"㎼mpXesGŚ҄qhwhò/ް$֛Wcr=ſuaĞ1)X1x+i:%"2\ V XD3^"- {, Ÿe]d T̲(殏F{,aU- y[ìx߀?YS6n Fi4Uuʚ#?sre#CY>1nGtj;3=[ݩ^SOK ^5vpJ=% ;0vHZZ[5$[lZ\G\_Y<[,T-ܴh等n4Vk` hL~7%[11WK,@̨9损3:^^XX`7W_0'"".|CDuӌuPW2-o 7g ӃkwuxWFC^! QLAxqma6d$EL\ZZu#U2_ŝ)9B>< iSQ|u7F;O"_ E!\MS:PNf gg, _z];i-}GL◰h}-lq@t8tVD `bcؠC 72&5Ma6L}#2ooAЇoU " 3?)!1.W>gPAFˡgńY t"GJpKXԮyoY[\FGTh׾XH 6AxO|׉,V-gy^-,3k"71_|YyC3fde.ݺQsˣwJs V2bB/ZX֗ |{p0C ^F-1/lkݑ)r mu &`ro R?q`qi"OM"_[4OWDɎ)zq)]{g6)DZ,;WlF,`g;pp[!88rl{{yoxĂuizBX*_є{ΰߊճX!"Bq1vKd\LaȘ 4;39,!elhJc8+q;HB،ЮmouH)iXN>2zL129Y%i0_s3{ |7r\ƐƸn҇W* }߃CC0:1 bo٠ R߶1.nbڮx soXR{$-Fwq>G_[/籁ۋ(lȴ)}F4GbqI3tp7N=x`awX|wŒd#`V?ƌdtٔ8oaww^+c CʗqV^-!q 8+ AQQqy7KF+(>.=*#ےxl[bD߱W֢lV.3V)/^.+f/$LN'$ їĊԪ%iURЗ ѴϰϘ W`2dӑdOlIzZO쒽, =%|4/PuYAO;]Hi?m)4QOiU@(l?O5ZH#w'sQRL?= eLW$|Ó]ZJI9S|o?_~KkoEz7i:SӠ݃v.GFKC~5ȡ= #w@:/G_eVzѿRI~Lؤn9qe_ 7\f.r0)d,o9o~N39g&pOLwM}z:7Rt]/JK/M4LAi[̏4){ݓ.L~lS*שi}9}f6㥼3̯f8a N87μ9sszn7 _䟝d^ͼ{7Yf^\+3 oZ fA _0n3/(ZP.(bܒK]<- ]8o Y4ce^mu.^سxu\i񓋟[m[]T>i|~/Z/Ҡ%#_2y%7!.9%mC*FSZs9~N?㊏ [/*gUZy貜e+i;<5?s9~N?K,01 6̖&;p\8X-/R?=KL6 x,6֞gO$%O'ޡnR_fc1^Y.L\ʥ1Oנl.t>nF/䢏B<*GelͣyT6Q<*GelL\C<dsG S }栏>b҈Ӊ3'u| KDܮ#*u''·|CWcF=:8x<*:,l>L\ z8{:ޡayѯ8b.8WmχnH!'tTg-Űs 8j{/'^Ew7ЕBktq4xI}K=YbP5Vchxu38O}\/'^FFzmoB,F^dհr=s.q1l+X!vb$z`vp8O}\6ks=d6+a670:<ͩ`p`3q]Cs9أ~Bk`xxùp qo ""gO$%ެf,R ՠP ՠP ՠP ՠP ՠP ΀ӈӉ3'׫yp nR?f+ M΀Uux<[pq:q&D\j;Oǣ#])!b'4L'88x"q.q^~ #WLOԁ窵*u7x CKȒ4$,I#KȒ4$,I#KȒ4$,I#KȒ4$,I#KȒ4$,I#KȒ4$,Ƀ% 1̓%gy, p U1Hp9,ÆbWRףT9jіmB PC6Ԑ 5dC PC6Ԑ 5dC PC6Ԑ ˩Tra9հjXN5,S ˩TraP;MUnFB婣`I+X!vx}*Đ&Ϲ & 5+Nwjw-pq:q&D\<*JTEmEmE^ڲ mUW\D DEͰs*<98x"q.qjn%lq=<wp3WRE|[+VQ;j أ&͆}ժl`3qz܇pquE e`Z)ͅ-4tLĹy,YnPwowq3HsσW3wGcNx<ƜHRG75NUu| T#bK8pQ(\6𲲑~]6񲲙-lee/+)eFNI<8 V$H\IRyNpz|I=,uY8[_RHqs:Vyj'z|I#u~lQ_OUGK>{\眪Z fv/O.@+f~ucq*e;p9p'={~P'a'CAۑ_6ѱ<x?Nj.beng\S?* |Q6<yP3byP'a_wGY2^w 5o K%|9]#,-('̽%.E(+xY^6OR%;k 6\͸"J(#p5WQꠤ"?๸RJjWli`xl%w (0< ãd{¯sãd"ĽH6sC%0zc9` ul-y=-{ poso-[d+0< C0=RKzE_?? ᄰ\8'TNHaK Qfqx8_h ;BxK|Xh9i4G.wJnBT%~#)~+Kk$k)\'R[)[:#Mڤ|;itVHIHoVSzY^zC#?|SSi@mд9> h :i4MAөt4-Ut4> M/CӿCfh MO@rQVvhꂦ`h:N7B"hZM鯡S hM߃@@{hJ%4uAThMGBд.w@{#Ih"4} M?zji$4 Mthz34 Buh4} M?_BCb! |hZMBBv'(4NEdBa.@b4.ˡ=!h[h4}6A0474Uf-͖4W&KYR4] ;enh+h;hh4 MA/iho,#vt^"uBy&-=5hM3Dhz#4-hz74}> M_{) -_( cTh:MW@Ӈ Shz ~'ċ |?4͂S`12)GF+tR*7{nNRWtd]^랒=%{&FPlrjׯG+y,Xϟnxd•;ZLrFv[6 X[__GM/Njh1M"$7[@ z[{l4 F7CҟOnĨh$Z-hې0WrlLާAsP+ɜSONE,T;[f`Vڨjak6~{QFƵr6˂6͂`+?<*p&ئ?mn *BƨsƷtotoډ>q=q=o~?TƷAdY>!)4f33M, ;!܋H2ӉqiVpu IsM?3wcxwz}Iuuz9^SOb_u-րϓOf?Li#$-;| n:˺.&j^NSSad2_PfVo2W0:qj&f f; a&Q ] jD>V"t{#,j3jtKeFQ0ޕY ַՉ&z$&(,C.E,=Ûbƚ)j % [Tq#\y=qy ,p:M[lZv;}_2vnj3kNvNv?/OXkq3/o% +F=ɣBٸ3(a(⥯zFf5r@$qUp@}YiNthB0ET-;{dFvFqN+&-P΋J=-h*kEfVax]zY^Nҗ3UַXO{*X  [r?A}n-X̂:Vo3v`078WMOB_Ģk]|8yviA2oc۷VIZ}<$i1IJ '}]:+ QIѣݓEqI<x\ٳ40Y 6dk@OWBSwěZKAIID0n_ O<<9$xXKIPV_RF\Dh1!JKƸ/Ok*zQNWQwuNq*%6Eb6Y/6(^w'LzZbc!kxt7aa6xV}R s|dva<-<:iqn]'9[z>'LZX7azFP YU_>E]5\[RO'{LLz޵HuHwiŲQlUe/m`Ⱥx">wx]fw.cu+/o4?%K%0 lFFQ6AdL64$z5={2Fj;'Cz=áWSJ2y@{q>c;fc'^796]uHh ̎{-vhUBI X`lt(̦/:x$HDGC`t }#G⋏Z`Mn3uڵpz+>GEMlaarr֪t_ "Z쮿Ko Z~F\7 DwGJnGJHi2, oA)ʂCxYl&fxiΝMmf\H` p%,vzwx>;;]_]|T<[սK/^Pِज़uh{gSssK[KKsSN0S@.C9mۿ͍wmiinhkЂԌԄNΆ 6`'eDTа! Av!c?EהԌ^dMl'&Ə^R)pmhlͬ?))cڳyi{$؂www+Xo=eܬZW+f ^l2xߨV6,+\ZX`p?i(%J辄thv65dٍ笂cV6F՗?bN( 8en`,swm-Mz&:GQƢ&qWl׵þgFޱTOKˡ=v~ dG/ r4 ;ukMC_js g6,-re]: hs2EEtlI.;ig s(F͆b..;%M c1^ħɃV@to-fᡜ"8. |`dֶJV6`}eզ4 ,E@VʮpTFm ܫys MSUn[﷩ sq8nE'VCK0r0oaC>loN=;v,u&*ga J兞 x&^3z7s^?7O3ϩ‚X~&MӉD%YҮH|w yyXY3Y rXiyBNVx8KXPTY]"~==^\RU">KIY-NgBq?ijK ~%,^'~xω˪M_" I5}koc?:0{a/jJb|IZ\N΀2oq..t:3B01ԭiIey$Li3E[_OO  zKW˽xs|MͳN\a/&;ƾQlt&x;6ׯ"NiU9G?"BAҦ˓})ǫG% =UJ}SBbґmHOk\^ {ϟF:S|y_@z;WM{#/+O9zrՔGFgՙkߟҟڢEG.j+OՒV{z:םS.гqSGYTېɷ;wNm祿sH}S=ڷ8ڷ{iѴN/wHyۃCR|3CƎpQl?Ru1Rc}AOƶY8q8q~k|HO\4^ˍmZcyS$Mɘ2vJyQ]86}SJG W=>ďN?5 /gg4S|)y?w(Lóά;ftjַnl;[boIY(/_زHT8+*k+**VX&/,gYew,[e/,{}Y㲏*ZuUTO^PVP57֬yr˯[~6ڂڪk_mYhYqwdqw<{G˝̹s|Cwv^yʷVWeZҪUWG^է֌ZSEoޏĪ/G=wywq~'-؛r9N4OjE3vxI <:s5E>8|pl&`xQ^Db^cSwTBtΡJr?9gI+œD3ONruhԏ.teu?-i:1)Ic.Uzb+:@=$2Ic??VGsiePmch}SOӳ3 =sg :ʯ /7]Oy^Dgj "e!Zw)UM?~ + [GGHNJͿ^'"3=cXY>͟z{+{4Θ,MS<=lH)YTE2leϫYzQ(`B!%,`QBKYvr]cXF^# y-T1,q6~2ꍺ޾wٕVŽU_`(KW,C:K_4鄺O:]^^Wiδ/m- bS@sףc5rvXlcv'XF=:^`=]:qc,zXZ\&Ȳy$ |WG.fIcW| >ZVOTlS8>  l/~a}\g\TKkrl%/y6Z4VW)ˀ*`R<<<ɮQ@p8@CSP 5,hsK =N;o8vv-6Vo޶6ޖwJ7w|]%lWnTgꟄ u?;o-w#s3 jq> D-QKjvEM|g/-onPQQGpznE=CQgP~ (&QrXV:Caݨ~zֽ/}z N#6CeujZ{T-ߑ#oZ9Ys G)X 6N |>O@ OUe_#QKp 8cځ<Љ=_~..آa7gY?VOɟOg@   |v'Si[ | `%[T&S\`r~q0U= Ÿ ?oj8_^ X{ ~C/q+Qר \ Oyo#}Ҫ!}reGrBmUNB[NսʷkCgs8G)y#SP D KbwgÇeٟp6gG, rVxf+< lg3[᙭V O넧u:iNx)xL<-  AEVxM+^ i״kZ5VxM+^ӊ@Ov';ЋV\z֊@OuZ+V ;z'TPT=E;h퀊P*BVJ# Sxd޿a}Mڋvf!6IpZx]3 з5|bL s`"DgYPALBe Z r`|@](1~(B)(nbF}AOs?rN?PM%?6K>jʠu"!(KJ`Px0|k5HM6Lځ?ʒ1k_UbfhoN/6 y%"Ls:ʗɘdi>&3,e1,Xb`Y ,e1((TҎv%(iGI;JQҎvLAA( %m(iCIJP҆6 %mzɡzɡh<GHmF8w3Y ̂k7 n,f~eO49X_i4RaiO@? `00 #H`0cq@60&|Id` w L3oǁO['O^x xx ~|w@#.;W>{|u.VM.=`7> |~*>R?5G a@8D. J=j|x ߩǍϪg^զ]U?5~-8P*q@<D$@HU*}_P`q% ?ggLz$2`3`  ph)nmBMh 6ݦh ` ` $ R``i0R4 kuDV[em@ Vk/ [Ճ?9,GCOh9\=nvÇʡu#@گ(!@Pv0BP "HD|sy$ R> @  Cap`wL FY`,09:> LSit`_ nf9\&XxKZ`p/0KWoǁO['O?/b2 x#kv|t=`7>py}1!gaB߆OFēdD<OFēdD<OFēdD<O~(^^^_77o;N=GffC pQjܨ6B=e|Ǐx1If[pm1>{و(m%(:oo-va'E]8>f\|e6'x6x3)6FYOk#V3Yxg1otmկzZ @0R+Q@4q̢ Ha6 ``U0jQL"$@ E X+`@0ab "HD@  N4N4%I@2 QO+ "PFHc0f\h nRϛnwy ﻦہUa5"<㟢 >l~m|Qy\CQ_OSfe-F39\@xl志#]_W@kw+wQz[f'7KԝXZp4/f'š`0I'NV?siXV?V,s,Iz`pp?w9˃@=0KWMcf7oO['O'miI&q.މ=vqz x]_1 @zrPTWmGѶvmkGѶvmkGѶvmkGѶvmkGѶvmkGѶvmkGѶvmkGڭS#\`*0 }8B =,R?ohVqX ,6 ЀcA}+ھmߊoEmo@Kep'pp"j] v5`W(C/e<<<iv9inW;f;zf f;zg::Z`] ku-ֵg3e2Lz =S)Cϔg3e2Lz =S)Cϔg3e2Lz =S)Cϔg3e2Lz =SZ@ h-P @(Ђ)cBP  I,Oz>*D@!P!* K|j7j7j7j7Ԙ5CPc:Ԙ5CQ5 F(Pj@Q5 F(Pj@Q5 F(Pj@Q5 F(Pc:Ԙ5CPc:Ԙ5CP)sh -~-^Y4j>9BAoDF?@hqv`qv`2Żsl81n.P8wbb@ݰ?֭BX~`S=i] Vk/pP VF+bъhEl"6ZVF+qъhE\".ZVEV<O0Əan==w?={ c1cva{;lova{;loԽ|u3Y:7)嬨y<ˉr (H0 ( *`$bA4 , !!$Y6Bʒ|ϙ,Jy23z͆W1*^ܫ{sbU̽W1*^ܫ{sbϺEn`}>YQ8p=5Hi#zK[?cb)>V{jH ճV*SXe La)2UV*SXe La)2UV*SXe La)2UV*SXe La)2Uq6+IF6j|VX@5+y?i-3,R'9@֩o:? t]@W ~ A0 `0<a`8FG(0Zֹej,d-eJ'nSAۇ}Ud8Or:ve xŬo_?50 X hZh AAiá 6phá 6ep!\ zK2g\ }Y` `x p0Q`\,t4g+,f6u,GI;R!Em#TqiQ 1Xa0Dj"L5S 1؏~ c`?1؏~ c`?1؏~ c`?1دZدZدZدZ\5Q(WM&U媉rDj؍n vc`71؍n vc`71؍n vc`7͍@[Lӱh lvlp ǩhz-Wu>\竣9NUG(EarHEȡ\}Y6bXFl'|( e!TdRQ*2JEF("TdRQ*2JEF("TdRQ*2JEF("TdRQ*2JEF(#|dQ>2GF( b!Q,$D(BXH b!Q,$D(BXH"TdSq*2NEƩ8g!,dq2BY8 g!,dq2BY8 g!,dq2BY?,@Hp)"0ۉl$g#9B ^E8 ?AEH !"$XѓH1) (R"(R"(R"X bR,@H) X bR,@H) X bR,@H) d#%)HFJ6Rld#%)HFJ6RlEJQEJQEJQEJQrRRAJ9H)) rRRAJ9H)) rRRAJ9H))ӑR5RvQ H)#j$M[[[հ[ հ[ հ[ հ[ հ[ հ[ հ[ հ[ հ[ հ[ հ[ հ[ հS;S;S;S;$|hog l͢y[,;TW+*\G 2Z H$Xj9n5P 嚐 i2_;Cgjg#2z#OưMb;C[ɀiJk_Ϛ0>f\]֧`!R8^̖5YFC v%2jdnA": Pzp~L WYxI 3-FN1X%ZVCVwFXհY0Y0Ya ` K`0 ap# ap# `0a 0 ` `0,W{%W{U0WcU0VcU0USU0US0US0US0US0US01TJ` ` *qrH.TtfNu쇞 W fL{=^ ͐/k|mZnZSCNLrtnv]*o:+G|GEX|7D*w XZFyX-]-]DE!Ffpc/?6R$:sz;3槇kg w~#9wm/Uk]S8>Mn\fBtBvw@Vh̏ܽ Ef юhv4c ؆VB+vЈC#bh64!&ЄHn;ۅ_$0bKֺ> Ge5WWXor sW%3;'_|'9fGeF(na ~wKIY0QK0!a2nW0Q,$ 01&&`] ۵] aka+ +a,O4,Cli`-` rn<94 0 q C|Y$. ?Y6!?}}} s=X,}VGtD, ˸GQ嬽WJ]ƺXwk-cerK9Ro)G-̵y+rLjрIHk*U]DS7r3т:u=VHW7ejd` *Qs|ζ"1mIQ#Q4 JP _vtٷ ן5e 4-@+yzzziuZGEܪuc{z;^~"8?SY>Ajx6mvmOh=\ i\,*.aRqs`!#D[._ÿ~l0Xa%uXȫXHZ2-s ,x<^Ke0opn&Lm3 ]0̒O[ˑDqև>˱ˉphx򃧉r"9sn)햱r~ǫ8~pGZN_`=ȤFچ&^nm˰ˉ+˭|Ρ:hUzhVV)(x P~L.vZtB лz#%%'=| X@4a)hhV2DC6ז6@{thۅ]A7?sxXq2 xF$uYu"xkɑXxKϹ\s.l$=^/ x x f l=l=~~9hۜ-}NOē z[LL rz9 .kyZn[Uz^ ѩDE\"z"cQ~A.GR7dh0萁.\7ߌ7ߌ>x0OfWjtc'o7g#@Gjal]لYix4t& o /sf3ַv<`0fv^^/OG x0^,KËBxMxMxMx0)w x4S) +^) oFHg5e3e3RZV]]A-6-6666#t$ [T:J7#X~g`X|ŧaiX{kca= kc훑b:V+ߌo7S;yY^9uփX,j -r~ٍ\g#䚂Dk>rL!yXD +!ǑX@ y<)h| x-1| Z>m _iڼU>\ջ+M ?)?)6FwQ <7NAsw| a9ܫVў⨀bVVƪVҘ.fҘ.fƬv1]̨3bfb6̦٤1 -]61R#0R:5j:U2Z:3Z3Z:U1Z:\TEVE#W1r#0r\T0zW1z0z:;a5V.UcJF܌/[݈u/\kЪ2^CEtv8e.+9]ˣ'~WGQ@d!r( ײNL!'5 q LeՕL"+E/Xɕ/ᯂbލ7b/%zVs+*UT9OJn72znܿZ +={ %l&[sت"c*&crN2# #Gԑ-#OG:YO1YO1즘즘즘즘ll|N&SLc3(((&l>e]c]~dEwnB渉9neu$t60Ka-BΥpR2UlFC`&yrRL\X˅\ʅ\& #0    0 +ڳ-q kKYc5fL֘Ih]&$UFX2KG3YK&k$L֑:-!5dL(kwb+P-_cc r @mvˉԁzGNTNʉ$p28 N3,p68  "p1 .Ap9+ \ Wk:_Q_)/ow`X VjX~.Hx-XXi&SͳQl[@ Pƹ=ra$h ځЎ9Yla{ۿ;]np(9Мih44g,3`Exvt*x l# `H`=AB _.',',' vJPA -''''E2]/DՉnRPAb+s_r>ؾغn.9|a`8 3{3Ȅ#L8žﱝv>ۥLx0lm![[-~~0w((Jv7_9U袹?HwXWL&|(.}t| :>@1FA |z>=$ES$x < ς"X,:% _Fh$:D 9Ht#o-jRMBIH5IyKf)S46L0 f0|>O<0, |&ES Ŷ7BQ&W9/ǫ@A0P$gJ]#oJ0F.3t2D+-7|ir\@`[|7۝>L4ׇ`$xHc80C_ _ ׋z&,l! A6 Dۓ$|Os֏ > Ohnh2Z;8Q2Nb{Hħ 2e`Kh.o,-/N33r6K%CDS8^9?3֔d~~.ƇKe0L*x d0 S40 xfY x $`[?طc~<<<<<:Y4m|PuXJ>s{:of,_ wT?rr] @ L&da20@ L$ D"d2@L B&! D"x~x~x~ `0Ce<`<`<`<`<`iiiiioÛ>oÛ>o#n&n&n&n&n&n&n9`.,툿6&_kmM6&_k㭇େେBj"P "`'`RPAgggggWWWWWEN"ӇC!r9}>DN"ӇC!r9}>DN"ӇC!r9}>DN"ӇC!r9}>DN"ӇC!r9}>]$*׃-$DA"QH$DA"QH$DA"QH$DA"QH$DA"QH$DA"QH$%R%QK,XF-ZbD D D D D)i`-X'|D1(f,|oTrZٵn4]Fվ?mQ"EDDl'hC'R*hQgPg6DQN6R7F:$ Q"YD9(g,ErQ"YD9L:B&!IGȤ#d2tL:B&!IGȤ#diS-0L`CCCݕBݕBݕBE}DQQGE}DQQGE}DQQGig6yMig6yMig6yMiU2WA- 2"2"2#2CB!_/DJS%"T a"xviS)D~D~aND>Dt!iXJ@*ЄE(Ta*0Eo-*0EHN;zr k2d} ,td-:d},*0G#LSy9#sGQ?j pٟl?`d}gCdA2LLJ2,#h KސQ#8dA2 GZ8Z8Zx22 2&N. l.L2.V 1QNpE}`Ǧ̇`0BEvl2¦i6Yz¦'l ,hY,uM&4LGmaS[6MmaS[dHCȐ! !CbnM|=YddMɚf-"[B4liْZ?DQ뇨C!j~Z?DQ뇨C!j~Z?D" uɺd]A YW+H$ uɺd]A YW+H$ ug2?d|p7}q_p?xs2B$C s@9rw.*J" .ZʔAn7[dv`QcLo뀌xY^%Q7(G( YI^"/ՖZF˓?pV$WiŢ)Erw#^C'~_V[ j&y>\(õer6D"bF[RNO2rL+~>O`tfW[+gỉJ^[/2b-]d6Qq yG{=-o%vdZ74]Z8;Fr[w;l杈S!Շ~HJNQ*"r+T;M-Q4V)#մԚY3XQH=&xMBUE8S(\,<&~`hʥ8_f @\ O3Yx^/b! Eيt0$h%hZD@gtq;z^xwEnI`, < Og`ܤ^`,7Y7^~>'2߄TY=:IDѱбzH"bv7h Z4Bm5p^vH7e)MP'4d>iBݒn\#H(F11Ƃq=`6s#1)XRg`Rn%`)XT|߁`\g F@d`\੓ G.5Zm 28r1 Luz c9,) KR 0wk~X ց `dVvrPvJPj h 栭dA%s|<ƃW 0?b[#x['llOg{-[&}\ q~ o#P'7%%9[+Jh:l}2`0 `>݇w}/00_߫5:xL&x Lt6`w=0̒ Wʰ*p5\ ׃1Kc `SGh"M։.\"؋pSRMRE)L~ S3L65MdS3L65T꠩)SIRCL6u@: j$qF\>L& Ɂ6Mk6Mk6Mk6Mk6M%_Qp~oM6MMh="cN!$̴d5EVr[5H]@W036U>&iKyRq8KZ/oɤkkŵp}-ubjZP 9ds8/N"_|V$.oϲOfoGsU,M8GSlC۞_;)8u7+lŵάַ[d6L/"_S9iMl"',h GEZV.z 0 X 0Mv9]` kZJ5y72C&z0< F` x $`M-ߛ75{oj轩{SMJF*vh_!I翙|#?'ڇ浜VD %]tW20sƇglgl[GG~aZi)E7wkη%jCѪĻ̻[.m>{YJX}e<"m.0tZ%;`9S_Fe'q"L{D x #I9Lam(Chv,]-~On-ކ1:W_Ly+l^Nb襆^y/=lsc~u̯1:W)ZE1<Xч2YYB^BO^}(_aM?!z5Ά̦l:z~ 3Di&䲍-eq"8 WCaˬzFue0X, ݧxxDmL DD36|G-XBKWBmP l9[ʙRy1lتUswȵGPtZZ^ W38{2^YԘ z0VYԒ _ذQR+YTͶQ;괒Gu/[szVP  KHz(r6ݥݒ;s8a"sܝZ-̾=ރ5'H[wz˦j=AU%Q)GysĉRآ5bEhXGBs Ӣ>Q?ҏˉ#+F7ze~gY/^9$ϢJ$譙_[[HЉ\µփ\ŵڕmOdb80~{FHN_9߅8߃=9O?Hi!RZ'r h+:3,Oe~*w] ɹ^Wrz\z;^x8woa U;zpnѽDܖ~۳H#cur.\ރs=ދdz>VlZo"gۀrsh<#Ě;Ӧ mr86iӃ6hs<͑Vbc1ъyr{=\c̡s;Rqgﰧn4>kU4=Vjm^`w._-/?c>A4B/9+}IqxL:ƆOЪq:ծjJj"xxxuOC1QG5zBC)^/!gWW;_oP #ȉ0rޖv0҄Y+`ޙ]hו6qw]]/$PY\5|'Z"AV'rd{M-DK\#.W/(b{Mrv3?2i;WZt[9i{vт}G*|\9.Tɧ!Χ&=I\*q8C,[./+CX"R9WA*B[N8Wt)"SZF+)76S[[ʽJ_Q TQO{e?U>T:)_+.iYʙ9jo\j\>P>>S}N}INP'))0u2BMQW*O d5+N%E-U˔ FRݭ)ԄjfjeTkZ)Z^кi)ZO%?h([ӴӔ L%W;K;G.P BXLLh}>N:%ݨݢji)@mҠ=TjhcM&^m6Oii~ kߩmQmi;jM=z~z~~z>LFY^_пSIzN w"]y|Xj֓٤fx6{rՐ'ߓnPz+ޫWz{>{V}>o?!!Phh}7ɛ>}B9}XqWIީsgy?ҟ_Vxw/zUޘ7OH]5L%X m 3:$tg%tMMwo_=A}o!s``K}oooc+׾z/˷Y}[}zoeTu ihlųź'f=h 6GaFSkm6Z[YOֳFWk58zz8dclggcͲ>6ε[X_XK˭r*++jkq޸ ZAk2Vq*3vY1cUkY a x" #9 Ƌk΁@@/8cF`|)^3> d xXj|xXڤI&mthXפI^>w!˚] %|C.>d9UT>ܳ"QA;W#\31.a;,?VFHtF6:-""qsܻC̕L|s^^+gtx'2];;Exofh<R*t*#Ĺb(WBE((TÜZ^px1RC"IVXH-Ϩux֩jZ#^T:S Nm.^6״.Z1ECSݣ+ mO O X$ҌFXkdE! );5tj:2n^/85ȡuj:tȩDĩNN4PӽW|͜$85ԩfNM47gNMvj:5]r ՜Tj^r)wy-o^osoKQ vT{/VRݯ :{VyeS)cHy̩$DeS(fV[eʷʔNd:ɩ5N8JSk(N9RJSk(uN;uǩ#TIBj6iݤkkR:)lt5Fq5FEc&QQLoS,μϏ)fROO [V\U?p~ GE6Uoɮ™P2A#4?63|D^=yBgyN0'pf9^1_k$L6'3)`'m]3iΤY,Z~d~ęy;ߜ `fy.1Rs)\l7 4Lth-]\3NEUlFqN3 %-zf)#̹ҬeYj5f 3֬:zca{)N77ބx~M77ބx~M7 ~?}VOSaSwohxY6˿&hx9^F䋖vkheX"`vD*jU$ZVhEm˦}UJ26]WZUUmUӦƊѦ֪jU/V%EۀSZtoO-b^&OK+k-9*(;M$C#m:V-pi#Ѓ}|}xQfw,|?hxC9P4sh4 'Ѓ7TA/1ė^,6Jcnj{5v`}llJSPnSn@eV0eWBud^//wd%>U[~G#kh|vv~}\EKwns`'v':BV /^\zS[RR22>kbn ׻534~hDKwKtnn/~gGoy]O{a0 Q;Mn> 3}y]Ogh]//sz^Yq*u}_{ix=-1a]]<{{wA^}23>//̾Z^/z>q^[s^{Y.sw9/}m]>q,U|F~'7SDT7zVV UnUizVxcnҀ;>y@ h)M\?# -w%?ȱVk$esSuwp{,wv<s!ff9\%=Tlwu4?S0e/σg9vf{uZѿдղ:ϺR6/97C'N@;^up}O]zCg0m_(S w1 fNLl?րdg+? 0WL{>ؘEhz3=h1T~ߙr$sGs_:vwyB#k,u>8q 7/Aߟ}8k}y6n 9w-'gg߲\ʻFhaqA}AI% ϱ]ƫ=}߯ܛ8c{渹!k}ס^?g]!>/}~X<+rHqy{mo~߉/G+|>sV%fx~&J._l<ٺarӾ6goo]٘G??# #)\A~%wMSu#X*GlI=9od??D4z俉{ʖyƑQg} T{x)w73t}ߧRnWo?qqꁟXo|Sg_7^VOW:[{46w1Cu>)Cb qܞNo$o#_ @܍ReezcȹF2ŏrƞ2Pݣ$9o}OcF 1^Cy;~,9R c5]|>yw{ߡG{74zuۃ^ϓ/f͹~o&kˑCkT?Jv,A};M{:Ϫ:۱ܽkP=Ϻ߱m"DqtWN;qp};Gm{'gy;3s\:hV_eKs,U&g%,dg㌃;;c\+f߱ M;ɇgʉ/pV`{kQ5q|!{KՍS_tt {_|ߔsފuǞ.λ dmWOĵ?kGٶc5zTHDa7$Ii)wgQ{vu- (pIG:?[VyOX1Tj?^Bb=lM?ʻUR6ߡ"/7_6ri b#Ĥmdq9Ov[ӍC]9s/qj>Yqc|v'q=1=+װ^jHL>(S&dg^?`π=x (f^~3ٍȲ/pdeVq5!.>|pW\m^^~5qj*.d<'Ui-NtϺNrrW?,̙FDBAB  !%xqOgCjXck^K,ZC^kXcZZRK޵9hM?ϽwvgSfi!0/[YM60df##4;>NGt̏9BrcNGge%'iv:K%|Y9öm,;~m?ȿOg_Ǝ{fecL/4+{fecFɘyQɲM6;*5*C *[6?*7*WPSQORzFpRYzTYT,+U*^J3;TVYIf2 aT$!HrkVG=< OKF?|P*3c.^2 `DGJ|sCݠ=}:>=}z<ѧ?>}zo!v<Ⱦ~<OE/^>~OF_A 8xc~?#,:z O yyd,QHJuX <!{d*?#{.-.CXam[rX'X" dMz9 d+ͤP\V7<$V\Muut]UĒB\X]N◊_))2S"WV(`9 -VZD7WS#(~-A$C$yIqRA+ӇQ\Qo8Ul552Up?)D77bşk_>_%Ŋ)#Or,89)0) ,Ob(.fp38$p1\ Y̩8Ul86{MADn>㒸ad. r0##?Krqq22}ȹ,.'lII86ˁr O. .p+pE\ Qpq/@r(_>Uǽ WpZ838&FJ8;L㜜k{pm\;upp\%ȅ`. Fsa&3B> ̧ xqkdd耷anI}qMp[JriXZFx{x'V sp췸]ܷaw`^n/={оCraC$h  :w Z~ zr?c\/}}“/Oqi4wGs0oQ~].Cp>74ẉ:,urS)gx\LP&*SBP9"eq2S z@QA/_"y ?G"@Wy:~U /pUZJDS J 0(-?A,8HU]P[QD1dU`d>(0%0œ$'*:*B xfQQ$?jVT̎Mɢ DͅyQH^TbT"y"j~|'E%Yz&G%C h;+m 0h;`vAm ڎ< ]]OW_%P-5/n TA˪mPu 3yI@R *uuLXFR/_ r(4G! a Zu`&}̂BI4 Nܰ#xI2(hoZ%p R$!(BB7z2 AY k,>녷7`U _cn6wwca y*WuY ϤL.|CyWx~K.$K-솽 H0--wAH8DU8 }~,!O@ϣQ8˨shNaS)op0!y ΓǨV&ɠ$);SOb*f f<1-oƬ% beRF4&YTOx K40i`$i ʮt9i#cc(*T+Qǡ2V2x.*TQ`(0DcQ`ߣ= ߣ=31= =1O5=/cZߓJ}&5<$Jˤ+̫?@;0F L;NPO"'Ao0o@ȟE6)-<*|wRf/CKUkŸG^*P9D*\6M@?%Ui!9ffa0,G9jRL3zIS]-8t#EE3g=_~=5(߰0[&{wh={`-3 u(:i m\G$3 u(])Nb4 h ?u.1x#% A'*I*TQaXc()E_6-'s2ĜL1'S-F <0(x}a T bc%*TJT /*~-TsD?< `Q+Qǡ/GMrhz%y%yQ+QǡRuuyrr٠9q%A|.S-^*\JJ+Q[ǡVz.jP=Д#I Q1qNS6sAGRm\Zy>jvntJ~bn*9U+VZb_0CQ%G\*y12"TϡJGUr P%?5XTOqWkBqBǯp$(TP/e<T&~NQRʸ kGP|Z40U/.S>|Ƥfb.1Yfb1f,b5ELY:eS`.E ,bE,%b1fS`1fYfO"6EcE,)0L"ELYfb1fY1,bӲ)0L"VY?L1-`?LjS`?Lfb0S`?L^aU?l6a5?eV1UaV;-%b00I!D,0>) _@ , 7lhs%0z`Ô84)+*MWC<ſ b55KoZ8JH#2pp.xq<><·@J>wABmc|p5`缀qN^|p@iSk7!8w"8;g3<gɄxf3yQ!1 a^ ^f`"D/RBc4`IJ,zu8mGہ`gfa.YE梛fa#3H%Q9x~F;Lurv,(0 0y\0@ `i0F, biSpABcGZV ARh|(' 0>yD)c%KП' mO+0ODL$['ៀ.|F&y ߀d!D&;0d!F&02Ƀ;вG.yB+셞 A;OC|-`L1IpLC;L CO @ALb_h$cd#yi|ɓx0 f +B3 WkP1_`* |/!G,M0%|, i Ab07i2f|s&cNt)I3cT13L3Zh 2PLBL"쥹0`:\i11fLnjq0-c%c$(Db]=ĬYZ?D_b:ނ $E1c6Bf.L̅b,\ 1s0'@ 7hZ@`5`~j8Ov`+``088..nn6tAV64A.u)t@ P(aEVcaV:f `#+xxAW8^@.m.8A]jH,$dJ o '+B>9zbzGVlllaH:_t{ Fh; 8spe^{w " :`\FOJ9_{j  l;Ӗ?O{WpoZ5N|m[jڥyЖv\<\rӜhn46H㜦PӜn G6&5ͅfw@6 4[װ~ 7{o7ĭ`8zTpZg4m$P5oo ؼ#@ۃ6W47 nkkH[<|p pA(pq 4zTphEm¦@%͗%M9˛W,kmȧ-bƺCSpR/Ҧ^'nzLpuOgVЊM5+9 58Z2,0m o7 4,Ci{dL@b6Fs ԝMːSCN3Q ||z_H k7] ;+9s xqڀ1t=t au65M[Ρ)t 9!]{vv@m;̷ УzYUmgz7:8bsmi=J`ո1'cMoӻWƝzkn-I`]\ \ \>'ջ8M%ISB{5sdZyG8;B]X/no/ڗm_A=nЮ=xX#ۭc]5cu[x-gvO9:ԁ#]S= s{I|QoG^3U?ԾhF[Oo>Ӿ\ދ֋\r, ^i?{G;-\o? |2mxձ<0nl?<[7TNڢ'e[,A:ezl_8kܴvpIG\Fptnk k+H@N;҂&muS#'kk*ܹy?p4c8'9:Og8Uxm\&ͱ.tl &j K˝W&DZ%q^LZV@L9')ԗb9VWR09v4\ӕ wewî`±/XG^* 55b:W r9:XqA}k)r.=mwEkwв je}.?WgL8o84G{%i41#h\k(;BbFǩ`8 6Z| k#<hjϻuq>Xڎsvpp00:,B8שP6s)DS: lw\nu\灓)΀c"Lt7P.uFqjzIPwM*EYuE8Rwp;Ɲ\npñpBЬYt4{. :4^`6 .b"خќ Z5w=jwCjZ7ր>mӭwqMn;V[\CK:Zn T݁@]Bzw]ܫa Yu#Fwн>%qovF[Òu {{>~ALG;>l+N_myG>>E6kG)B}I5d:;.SOҗm w{w؃,Pth{};]wBکOBY>}'1t@_I}bOV谾̓:ZXc,tq2Pxy΋zChCf(U{=^<푕] !&}.k=8f϶6PWiWdyvug/ oh]5$:PaH4 ҮzCwyW0 y^}PvJNPջ"ʽ~QwNre5A @a?Luzr y+_];' zky޻kD#4XEw aP]G ~vQwNT7j ޝaTv-*ծq@a0CFaQw]l=ZiMv(OХ] ;޳As^m %̊lj 3x'`TJS BI1_r8pʗN1e }9,ɷùK"[}*ņpa W>\+iuXp1rokQiKq>cx1dV=ZavkiɰY{,3f2i] 9TK*co=]}`"`Է 7L/@cok|w$R}aw DWQ;wq'v vcl8Dשp10nWn7ތl3q>D!|q_2nsAU&~?QR`-^7|Ҹǟ"4a:IAVxğ tEq_ ;>OˀO+rq_++ %ee-Zq_Ʒ:D>D[n7 +xw+5ݱ& zMX* 3$>S 5%`)ݿ92eutl:Z{Zm;[:z#}gױvc=1Wn;ֱOmhX۩#}u:F;lg;N-8ݷvcO+jݶ}N1:hq;pN:>i:=SջWľ~{rg :ӻ3;s:s; 6ڋ:K;+:+vY 1F:bLa\ҷ[вй b.u5vcoăгq_g{`;&Y˝}S,Ƙv7ƕ^[,:"g\ sCd@yL2Z͝am}c՝CW;e%j{M}k硾G΋}x%Γ}WQܰt" ʫ`9X5 xG91*eU#F!d?y%ƿ;Kd4VeJOU9UʷwZ/֑:'W!zvUh1b]U1kWrm4 EnbW&q&~ej`I2ڡ%~ecjV"7%̃U'B)}eIvSrܕ TU}+Jh*^prz֮tzL p=B1;T۝*2ѵTIǻKLgx\ڴΤrŘd_^jrw/7yvdTF'P)"'RoDkwDM}-ݝ9a%)mZےoВѽy {isKvv12mkij)mRҽϴiPK]a3!,>k:b>+)3-s-K-WMWZ7L[EsMZM-'=ݲӬotc[v9- EG-Df(l9gNj9ܓl9֓lNmI3g0-i9ۭ6g^jkԓi.lړc.iѓo.oC=EwVJzJK[ VƬo7[[zߚc4wf֜5ռx]kiO[+*֚y{k}NֆVMjVcϠ@gpgXkkV~{v4[{ͧZ={g[W|uR>M=G7ZOuOXn"k=sڒ:3nIn=֢`l=-9K~녞˖=,-7{nZjZoܶԷ1ehnئ-mޖثnK鍷&,DM.biM mŽ,\&\M Vgֶ%ږCmbp̲[ii֚).~P2ˑ^-U/fRz+JWqTcJ_*o◁vh@w]{C4; ~!j9?n[4նmNJ_oeܱw9ms1\hֻN’5?a$,3șYpH; 6Eb9d&'T2`'_cF*d/EEp+<$I#ŏH yH&)Z2RjTUo~Hª+۪\I,ROf%DK^&zYF!=dO/o1;&|L <0 On40&&0}L&Ϭc* טW2?g^}SM/}L<$3m~LMLH+Lי|E^{̀2¼\'?!y[>.?|E~Qf?2['Wt6ll_+&KcNrq17ǹlO\!W cys\5q/sXӳI l 5 ]̽mg+/':n w;κ14rgw~]fWҿblwdDþS>|2]KTzk+ʷoMal*'KR($K$KWRyZ<(+PAg |:[V췪*k%ہI]z\Bʩz_Ʊ2K7j{g+&8ƥյ ie2rJ*7׽q }oL n@S S_C{a'?f>&2X"W}N9P-V-&~N&M²oC? ;U9sĢٓ$BUMaRgdsi1SBƑ92O K we f,YV$+") e%H*f& Q#JIܦٖږ6i:ma~:FvNط۶vvv6f;e;k;odja;gq{= iϱۋ {pW9m؍v=UZ{}2h_odkqW=FA(0-'`no7M| ߔؔҔD%B> II"'1 YPI(<)EDb(3Hy |ULĒP+lbO<ċl_bͻI"x7|6W$ a2 %}(iP%JV4̖_C"=lr|~,$P1,$yL4xBg3ƒ"b&y<<Z]߃-]`+r2[qN}\ķ%_qed׺L#Sv2N32O=[k >3V9*ɵޝ IĞٮ qR;阈3jqگxN-OH5>IX'IyMўԦXO?iJõ'N{GScRHkJd-DƦTFzmM-SwG=˰{klmMyAk|qq]5pZLzotKT"t4("k$8}kawkMjW-]JDL,@Sg'nzv7-9I9dnrz5=cs8oa9s}4"~5"s/[wn;"ejnQ;ٴs F[ύ zM;i>}}^74$]WaяO]?GI׌z?]_wi1i;Υ't_IcGN8M N;Bjq |;,/ڿyKяp)9rvE4sߊ>T7P_kSQ 8wv8u~FdǢ6&y"%׸οK0hI{бsnzǹſ{xڟo{sn6#t]W J.H^]7"WE4}sOfT{M_TsEttEKDɽs _Yo'yorDc5]5]fR_4nxs]7Mxў"Ї+j8o doHjpdzh^'t QmE=R<ƻ:2p4x;4MSJp{=t{v#Acާ1uplvlS_^v^sxohAmKcS;kO8wy]8.i˥qW@7fW֬UR H77j}K(xx(ŷ>t9gv֜s\b_;Q Q_\k 4/m^Ьmn65;|C^.|}{ї7|q;Dywyx;3msCͻ|W]{}כnl>7GOj$(Zo>鏥}6Fէ$Fro%v&V~~D>iU*[\6ޠ2 )tC!>P`(/1* A) K bkh7 }Zf6Ðaaaᨾ'RqI9j.C[x}hO@ m;h5̍qt6~}!fb%sJ"~ _Cį0~ }Gkc54>_C3ksndP\>_CC(M&>DKsMy&I&eM&ZD_oM%&ZD𛨚YI t7:& ~}.=io7/7FjDy}b_aބgI[-%:ΪsB:ua]nnnn K B^4}>vNn>,ƀOB]vd7qx~j1,zP[V`)/ oQ` `C>f}<D!lM'jq`ēoCy-`Z\xnyF||I AxI2&vS>o4id4Q|u o4r/`-f[|b6~~N,{y1X*))}};}z:̝e0so20A3Db怽Ot=T8m!U!섃نe>k>od>UcyXo!XS8K%ْfd/z"F8kFIMפCɂ JLSؠRŶ%PAmZ(f(pRRūyXUe8G,F4#cj^92 b8ԼJbxb0rWw&jXYfa20XS28l|VEFςFa ;(Ҹψr>M.lda\^UKq[H$*`,C=,;3.{ﳡ>D,Q1q p>8/K 5^pC„{IԀ $|:jq >ȼ9R@}Ps?*Ͱm}*ail[?*`iY+m76C}sMG6>g`}@ ۭ/mz.v=ݨXxg}N9 fxZ8mY֭1GIUUSuIj$8o ֙/EdH~mzߢO{=jʿD?Zܪ9񝫅iM k:An5Iji$5H#i^?~>k?i{4'=w|t ;,}t ONTf>u$RH*2x5Զ8џ鳧K5$_FQ5ƫp5TP]vVC{H3/s$mM7hSwƠ^DI~@M`3 PS2V#q@dzMاF-ѿƈ9kNQeoL@mP XX h}Zf6]C〓3s9ui{K?I/h@tmW-?HۧlZ;J8_'_ XKV;a@?` ``#` `;`=mp@n;0ma1,-}.%6,n&g_3y:>'7 Q@wyNH7G%F2ɷ*UU<[yjʉ*RU UqU UUiUU9UUEUUU5UP4U*{*PSjj}&֪PTV:QuF.T]Yu[ͪyJNTY\uL]U/Q/SkfCUC>zzzzzHKW_}H}T}oPTQS_T_Q_WROV)cIթW~B(%jIeir_YG^k¼c R>1Dc>10C,c| acRT |"UyBSɳ*E^PyUmJPU=^MɫC |e 8UF5Z,fBjZ K)j:g ^ mSۦMoVAO6OmvH®i+~LriJ[N(pe+UnRZwBݕ0'Yy9VyLA08d\U.^P%U5Qb6Aը{lA[!)vJ Ijj?PPC xtfu ` Gc}!b}8Ov-\ŷ^u؅Xc<ǡ(+^hzC7x ala}a=OZۑ]o IwWw*ޗLXq/-Mxlxl 6Yd>F`=W^V؎ާPVJ '/]>shX{R~R\\}8^ yzv W3cY 7paX䷰?^3K(ˌ-x;90:}x#sB3hg?gub\DJ L=_q^;M"gb"!bSWߢ6rB}3Z1r 6!*D(rqD$<ր&\ǸwN=coɗw}y*ee+O|سTX9F!~dz\y–-{uCWig'EDV|Z+ߎRr?U2~"3e<oJy&>/> _ks^3b򇊯!;W`nasȗ%B8Dm[&qIaGD8{cyeX0(Ή6F`it_`C- R6 [% gw#h;Eđߔƒ6?p!;|y=Oc GGbu~^IGY4oY}|N|tGX[L@|K9͎an#)2{E7&̿O!D+Lћ ŧ1}p.G!@XkUR~A>} r }&>Zh]v m{I.Z(O+ƫ{?\@IS'q(Ľ.ݣLjǾFq>) J֏c~$1~8,G, oSK@2\Z7C=mؒ|O/wО_CzQ 1S{*m̝;6B$Y19 M2`A`L2d09drNl9K{~w?{3553scG>Jwf7r,::Jw` B:j{Z1*ݨU"ʊNT1t`B5g$_Z=8hk?F+ ZǍ?!IWL+j`EJtmOv6ObZ;VC~kbZr< peMAJ $EJB=^Uh&i(Y e9b4O#hп,4WB;A5} _# :/T:OhG>MzAqF=5~!k ۝wcDE@C+a&bPFAnk%s:Ն y m7Ea=qԪM-hg՚aW-?M.Г:˄0ʴ;G.Yo4dN`Rc;Ժ< lKYbe"ښcNz#n=ғ|<~'$I ,l:Bt9' g삞3oV) NU'k%=h<~h8-AQ"u@qhңq#4आ ߀ĠFg'|F,Y-FLq*Di!3AzQ0 #%FJ_π ;/\U@Ǘk.bAq<8*a+a }eU&=l!qL=r 2d;FKr/|̘yS^VF^ $~EQZb(F鏨5J~2hx \&>4r%V]12" uМ00w@CiVgX*`Vrd1y+H,bv;)?34aop# =Gǀ ֦SXg[@Et}5h(oFvdq\zp0xJieބ+B,H#Quq0HC'j$FT'^n`e`gd]Þ ׂXjzq3  ̬'e&ӵlh lE?UEXR>#[x#eHA.!;z8 _ø r͌.M3h.v6&CNpv3r]Pr=[cTkd#Q=#)GПam;9cTFH4`g`c ͯ*=z;>O3B\68B?̣PӀ; i[FYZkAOa"̅T vhj Zb}?1 ۼQpvhA^q臶2k(uh1mjd4^fJO M&|K)l@,_wFD-<zگt-s3e'tb*BshzJ;Crw#ya5qr>nb1CobX.ƌYMm3pX-Jpx.(f]QGM+^S :hz#c%Ƚ!a3P+XxP4|_<%J9V*ɀy5ǡ>ZOe6?D jyF7K'7.{jc{Bi*`a]kZk菱PJ XYfljp: p);?= vWqv^2G܏?`=k$h\cXLq=ݛ%#FKF^dSa4D *u:d'W^65RiEhߣg0:!Sו$NZPĴG,]Iv#&;ƸľxK S"!Cf;C,Q#% 0.3o (fW+7 WDA{\vt)_y#ʵFrZsg7]P}-7~'=`/BcfDi͞fOY2󎍈f&ʮzah\wӠn]F.Ou}ID-11FJ͙4-r¦[׽=]]$uin~DI Tj5}L zJ=?22,z1`c=0[Ҫ]B;w9I¦Ja4j{5F;'c3XܡC6;1ҥz'bfFF+D+`e24T򐼋^v9dC8G]8Z/.w^I{m y WL3'夺F?iӸ`2];C T,N?n?z١3;zz=K2fOp y4| tء lEX Ӵ׽Bq*AgUՊZ##F_S0`jp4٠H|@( T̅$Ί9 Ÿ;PijvUa} 5hN``w`qI`B.cplzZ>0HtYQ(}ZBG??z:g- V:Dqso(԰Vo/Aw@wnJbYvR&O-!6{`0 +jrh#lſ:~pԝ=$:t!di I4ơ>pN:VAJS#)Ү( ehgDV8[BCKh>Zh'Ǽގz X8 𷄼dI{L@\g1~;@?K(#m"ˁzF$AgBfpiJwCf3bT 2GN܀ ڪzO!1|`+'<3k& 8kGC#fΚ)c|9+zK=hX XVz :ҍ+?:G׹y.xS̈:o] ߁72rDr-SD㠗_W1E`@D'D:hʄ D55IA%}q֩P7÷)2(WQ)a{%$+HtXwÆh'ťpLd  mi-3hqx@>@(ђ,!oZE2zӌ6eChxMڨUFY~NIhяc"be 3?NZD,21@pyu1ŸK$1h :HWXLxֶwJ K(YXeƬxzFSXxP.%4&+p@cB HfVAifA8 3'cpptKIZQ {@_D{<\|Hơm?p -$A_)hqMpU{Ozi=3YQ7&@( }F`;`iڌF l`QEGbbq <q_}}7tbE&@@f1tƺ(&E;%dCj`(JǃgG!aQ =( ὦmpW1 [(m8@ayQ+:C9ZЃ#ghJ`fs݁u \3Q )qN@Xx+߉^Ùy38!@)q&9(CuBZg:9nEwlITNoI"#~$7 NCB Ǩ7=]@V$[Ͻ= Ng{#FwQ*K Ž%ϡ08P:軟Pjw-AGTdXW$q݉_I=5Q &ObLd%c>U{Aף8L4/ >Jˀ$${.muG8i2! l4 K~  ~~PP DSNPړ O'dRiӉO ŀy z$/G .A?} ylA(6 \dzލ9n˩%Yp z*+T/~=:iOwá⟥1Y] m!SdLXq1} DGw ͳ 4l$frO78&)sڟ*n vjїkτZOw;;a$ZBr'4=~3c9 mc){:`?D/  '^]yX 쇑z xhȅkFi$" u|q^Î]kPˠ/ad ޽k̋G얖h$8 õ yvBf2p J7m^>?5'#vtzMڋpq:^ kexh8 ^H%s"jEGBr<3hOKO[Ouf;GH[CQ`Rbw$]3IЪ3Fns|}z<ˆ:/Mok~gnLom.Dwgtu;3G;xZb:Bz{1vy|(}">=Ό՟~g踍Dߙ~B3ߺhG0/$[/P.:mLlNhc3Lh@rPh_p<80p^{azIHfG] :g7Ag -tVA B8àm- 4(QҷԵϠVY9 < =}R3(M1s5+@ZH}[K~Oe\h؍_GFXn͡_,pÁ Qq!qu4Wsw CTt{pmԞ)PAPkgeEoyfՌo,2V^| b I&;y72.Yh.-?a+7nLV+תY*%!%eY,eT4+J6k(+>e=Y_6Mq1/KDzd,{bX>dYdž|0 b,Kb4>d-Y{&X#6J]Y/֟Ųi?Nҳ,+2zuZLl4blƦVȊիW`jV 5]r8-YY+LAV}jz5먯ɚ1Zl,' cX9V}ĢLS$2Hb%˳j:RgmX'f굽)˾alr[,3{fYVUgXVfk6`}`6f6ӵ< <  | |Mh͛1dp`6`4B][5-퀝ݛ7 \ < <ߢ}M};u0^*`(0 ԪKf`~` `%`m`#``}fo`,pd:〓3K?7ԼxxxQt1o = d``.`40D.-:zkv&~=`#` `;`g`w`ozd= 9Eʳ xxxk=O -Civ#%Ձ4汚;{c5&gnm^>ڭYW%=@?0k]ـR 1ު&V.~ 9Q87)O+hhd1Cs?R6~a:9S(GLuObSHmYߝco_DWd,ſL%%t/ӳ 1#/^*U rULO`bt2a+vv]aCyڼ8>Q~?H+^b,ub8-n'd6YXVe;K"=Z^g6Ȫ7{|;#87)rYs_oWOZmIC9|wsN~&C&IURd*JAȲKTs[Y#f.}L墨=Nv䡺 ^ݪP &55VH 1vzGXT`R6NuS[8TǙg'5T5}% cnf]+;%}ܪ/ +UW+yݕ*hh%UQR %,Q{hA(9(-h',UjJ9ymj36mՖr .qPe^ Чx"֗4_ ^7dy{ށ%·Q|6?OƑk#YT7MfU=TM}>U_WPUS Ve.ben5\ +R(GUce^5Nj Ij̯&ɲʂj. j,fٲȢj'W YL-RdqD-%2LTrYJ~JRQjYVUke9^&IVP[YQmSd%C퐕.KVQ{ڧɪ: Cꐬ~V?c:N:%3P]Pd]uGݑ}u_~zz&jm8_(t0`g3K0"," :f3-,`2[1e1۰Df 6cnvg!*\$*BE9Ae`IU&%SYT\eSX C`)U.HVT>FPXZUHb" WY:U\ъoz *2,j̪jɲ֪5˪ګ,:쪳rr;˥z,HOcQjj(˫a,ZP#X>5Rd5P_YA5^gD5VߨoX5EMzW3 VLRXqPs\VRWY)P-dbQKRVV}gV^P+XJbUR:VYmTYĿعUӱs'vYCѶگm-uPG갎ue?TGu5:׌ifWyPSzGk'K'6-?얼%jc58Obb:xz}alm3qyz,5+7k^:Ʋl6[~`Va%v=ԙ=dPנp A# }Tc-݃#h>vrp c!8vca] 1&K{W8=hc-h,݃ƱGPo&t݂b5vǿayנ e&Z2]Lq-2յ4"3\t-2˵l"ߺZdkEYZdk%EYZ;"tME"M,w-k]p-ҵj"k\_YZfke6Zfk\lq-յ6"]p-˵n"{\u-ϵ*xfXdiE9Zk]ZkcE9ZkӮEθrֵ92]\p-sѵ̯E.ZkkEENS.͵M"\v-rǵ="]c$O? L^ʲ2ʤl![2CmGv]W$:){2[_Y@NSXN`|||FZ=#HgD FF#z[w|%{o";:l.!ŕAd{]ŒP~U-osj$5ɍFJ#~OPe`#a2F3lo e$2 eՍ:x(FI$S,?K!rNn;NK{^OtLΕsuX.^&uՖۦwIC\-XQn?r*C<9Ok_ rYN Xj~f\Q]Gޠ 6 b6Ųaz^F࿷b=˿fx6Md7zOaS46`3,zas<6-` uuE=/cH4MDSL4-DKJmD[N|"ڋ$:OLqRqVqQ*.⊸*Mmw]i{x Gx"gx!^Wⵈ"A .4GZ+d YS֒eCl"S9HCPFNGBkAyH?#yT yRyVyQj15nj q8m1qɸl\1׌ 7q˸m1xl<1ό xmF0CV)U*k[V%UjU[5V-UЪkճ>[ V#jj5OKi?mv'V{du>X]a>zOo gXA`k5ԊYí/WHk5cY Dk5ٚbMYӭLk5֚c-XKewrGkZE[Zk[&'kjm[;.kk[!u:j[')u:k[֯%uźj][7߬-uǺkݳ[szex+˼ܚkͳ[ "zb=z>}77777ma{=bcapK{=e'S4{=Þiϲgs<{^h/KewrG{lo{gڇ}>n/Wo-~d?Ogs~e?sK7eU5u o[;{G'gW8?!< 2`̀'`/`@@!$@@@@@@X U u M m@x ] ">!1)0%050-0=0#030+0;m`N`n`^`~`R>3s>KV1^O;% Vs? ʱ천$'+Xٯbݺu:֭X~jv+mQ3܁H3 QǞaEZ.? M7H{.{3oW,`zͯ3zؤ= P&%c][){3?dOhj |"K3l#34/hOcJ~5]D Bt_~b@1})h1Je1Ah=t!l lL&26(YmƊ+1ގC즙LSOͧ<|̗KʣS{yi<<_x$33g,=K<+x*N^Ƴs<o)o)[[VVUU!omom~[[Ϗx{_mm ||i_K_~/[zou'Dy-²?{KodyEFǼYtN2ő6g9lkr\z+ jyyT教'Ixf7kjf3n3#f3lf1f3mFQf3/q~i~y~_K2¯k:7-~ې!g|!_W򵌓2+H{?)Gche=轴V-ĢcfeXYgG}џP֕Ű3֋%g}'D/:_ft uVHXao":cD ^/t_Ҿ՗BIQ]e D<:,˫OYCW[^* } G#|}L[{_\iz=-׿z0_2ez]z*U)NLGE;+}zkb޳?8 2oK6ϡB3OlQTն cv.]t1:6F|>bJDz5V8ZV 5X~NJ::la4륳%l^Wz?Ŧa`W <`^-zu>m빇9N v\5ydctVb:H5>Lt$;O$+EwX zoղ?eu4(6" ƈDmDXmV`%<9oofnm/l_>iO:$ҽW W"q!q!8d C! qȋ88CC q(P0PPġPġC[[u\-?=Ct+#x6x%^So;:wcH>N_u&Ǘo{am7]#"DiEM[7?Ϧ{E"'GǏy!86Epl‹ؔc3^ 8-̣cK^V my9x5'h2SLIGkL3qWɛ8o08&xC訳$8Oqv<:/YjOu46y46y56:}˧ϯ%//E~?e5н3S^Ic^EdƩ)f(I56+Sպƍ^o>zm&1՘ bBMg?,U z^ 6cS`:eg ˣbNO_KIA&-<T$:L zO i)0^zCWO>¢#bx9Y.?*Nū_ffffѱvooooooozP(Ky}/|/}|}qx_Þ=km${^c F{}>k/ڗ+5}Ӿmߵ???????////////* QITz^*Jd&vz*5hW/.o+ ƽr\BQPKּjP|$:VuQ zgzGkyS?=#Ow> [jio~t_Go}t|g~VzxZO?o';?nBM{gQWYvmV_VzӅd}g8&l-ul3۩w@GImHZ5"sI=;mxSUcXWIЖ,FÝbPfNyDΟdL. iŨ5399@.)"I^mE_m 4x[drS)$N$ěWi6m;1*8RJbl٢C-F&/I6ҩkV1;uܩKӘF\ℑY+iKL<?Pd 拪O qH>*ȒJGe蜥Xm6-U6lɛ?geJ,T TTNRijҽmxě'6@);|oѨ ei9+j߬S%g:}kaVe\^l7kjM>2,ɺhVEk|4xhp4~~fξ;%^uc1Qdmx rdřgRMLL¹s7>W)WNrw-qswҩE1]s14D픹Hd=WKӴ87DVyRԽ@=-_4D&f4]|%.=y]+儦MTt蜃 z5?婰fقO2\;IÂ6kh[cvɼ5ǭcˆ?ZnѾOg9|wQNt^kLJU!_j +.=O/|KfZ[NH9C[}zRU>{-mO?=bp G|kQ _DweP-HwUdlމ*y5læZ{vڠ=Z;}hO[n2RcaTFw٠CM LhޖdRdM*NlX4|d٨@,-ժ׌CfyFFF޼`dt|-.,:gts̛?Ozk4O|ѭ+tlqˀE Xanb?:u(Eb俍 rFY!!NNVe /SÓЏHtǓ3uVߝ=Oyw`^Nm˛Ƕ}7 7N\0fl?jDO߳dezÓS\87ٮu<Q lN^ݣ2̩J3X-skŏgy4_xLM(;?bխ#_&#{MX0' Y:=ؾƲ7e#'c3NB{qMk;pVKضfbCL ]y{,trőiS vm2Ķ)pW{Ui7]aj'*-82!׹dOC2j`]ݜjƹ^ӡj˗nv&|8W}!IwuQZ-ЩIˌ6rSzOwIwשsn won/dY><'M_;^mU]ADR\z{fFoGfm?s!FVxq8$gEҋ=g5MoQMe[OB"Rp C/Pw) J(E+Jņ4u E.8{|xYuϹdosV7 aCNEc-H;CwrRވ K#n(U7香(zz8]4< 9ZAP0uץWɒǼ;GZ3MLJ̳%]Z2їX:e&GcrxONc/Qį>8TQE}C9뙗Ew!Ŋ1RILJ|c9ǟWN_B,nacVٿϕULrh7-qQIQ3yMz37jX5Q!TN`ռז* ,|iiE̛CP_[|2SS z  f|fb@dg*&ְKAI1ͣ8Ib!pRK Z/!.W(`CdmfśR-@-@P79{h'apYOQ(MVj'AˑGl}E a5q>5VXIf_ưUmy!^htq-~LǴ tv!-^xޜϸ(yt~"9[}y/6N<@>g1PXxxGkߩvV[^]U ^>$PD' 6P@}@<b4| H o ĆPP b!:;` ;+_ `A^%Zn-Kkj 75VD #_lyLڲ6PvVwvsޥ0ٓ+[J_\J_<4h3Q6m&O*unAR/>YkG\һ5\묀/ ;1tk[Ԏ@F4}a70ȶP̌/*¢wP+5^MR&gzC3J4YxWN;YAe_[%;.ݢ_v0kK-(%~H~'ʓ^q{crN w ݩR }*4olR+^樬s`\<)9;:0.<Ш:cD(,J-]+snJ'<1H" "_v;TF=ʶk ;"(ǸiNz֞|me4py5cev_.鑽3d <XܼF1A!ͿroPZ셡o` :bp[A5& 1j[0j`,J94zs` 0[0s&xvsTt0(?Y~NG7"}`<ZbqApocS!p>B s[ p#{vgX3»IM.HiN'4riSnt{3z&zuq,uƬ׈R"jސI:PEDxAR0=,yWhfWݑdIuI/k?MF艥ۉzRk* s"Jf:J33T b񷠹[em/Ta24-6V)S]k%1%~c} oh@%H#WJwC<~ẅc.Z[xӣ^.,pR΋ =OwˎQ -goa@lt{]Z/Ebz>>Kf$D<+_]7OnŋWS>|waA <ԞLgBAKWμGNy3Ԇ A>NgU;s,ƍV)xV`&Cˏ(Xbuok eDmov=1D]aP(@Lvෳ2κT(ƭ/S|(&`k/ Fj(m!mz4-1('ITcy-(K,)10n\pXtn`;r(5-~n8wwl&A!e$kc~;cgt<{ͦ 9 mmi#+a9V*W& {Wc]t엹zO>k4#L7QIGS`r΢2 1Xm;juZg( AZ a3LjyRHL흡'^~FD() ӳt y{u 6ޭKY-Up,) 5V$Ob-[:X!7eBzL% 8=a] e!/qS䖣9Xz  endstream endobj 4 0 obj << /Type /Font /Subtype /TrueType /FirstChar 0 /LastChar 255 /Widths [ 0 506 506 506 506 506 506 506 506 506 506 506 506 0 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 226 325 438 498 506 729 704 233 311 311 498 498 257 306 267 429 506 506 506 506 506 506 506 506 506 506 275 275 498 498 498 463 898 605 560 529 630 487 458 637 630 266 331 546 422 874 658 676 532 686 562 472 495 652 591 906 550 519 478 324 429 324 498 498 300 493 536 418 536 503 316 474 536 245 255 479 245 813 536 537 536 536 355 398 346 536 473 745 459 473 397 343 475 343 498 506 506 506 257 316 435 711 498 498 401 1061 472 344 874 506 478 506 506 257 257 435 435 498 498 905 444 720 398 344 842 506 397 519 226 325 498 506 498 506 498 498 414 834 416 538 498 306 506 390 342 498 337 335 300 563 597 267 303 252 435 538 657 690 701 463 605 605 605 605 605 605 775 529 487 487 487 487 266 266 266 266 639 658 676 676 676 676 676 498 680 652 652 652 652 519 532 554 493 493 493 493 493 493 774 418 503 503 503 503 245 245 245 245 536 536 537 537 537 537 537 498 543 536 536 536 536 473 536 473 ] /Encoding /WinAnsiEncoding /BaseFont /ABCDEE+Calibri,Bold /FontDescriptor 11 0 R >> endobj 11 0 obj << /Type /FontDescriptor /Ascent 750 /CapHeight 0 /Descent -250 /Flags 32 /FontBBox [ -519 -306 1240 1039 ] /FontName /ABCDEE+Calibri,Bold /ItalicAngle 0 /StemV 0 /FontFile2 9 0 R >> endobj 5 0 obj << /Type /Font /Subtype /Type0 /BaseFont /ABCDEE+Calibri /Encoding /Identity-H /DescendantFonts [12 0 R] >> endobj 12 0 obj << /Type /Font /Subtype /CIDFontType2 /BaseFont /ABCDEE+Calibri /CIDSystemInfo << /Registry (Adobe) /Ordering (Identity) /Supplement 0 >> /W [3 [226.074] 891 [498.047] ] /FontDescriptor 13 0 R >> endobj 13 0 obj << /Type /FontDescriptor /Ascent 750 /CapHeight 0 /Descent -250 /Flags 32 /FontBBox [ -503 -307 1240 1026 ] /FontName /ABCDEE+Calibri /ItalicAngle 0 /StemV 0 /FontFile2 10 0 R >> endobj 6 0 obj << /Type /Font /Subtype /TrueType /FirstChar 0 /LastChar 255 /Widths [ 0 506 506 506 506 506 506 506 506 506 506 506 506 0 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 226 325 400 498 506 714 682 220 303 303 498 498 249 306 252 386 506 506 506 506 506 506 506 506 506 506 267 267 498 498 498 463 894 578 543 533 615 488 459 630 623 251 318 519 420 854 645 662 516 672 542 459 487 641 567 889 519 487 468 306 386 306 498 498 291 479 525 422 525 497 305 470 525 229 239 454 229 798 525 527 525 525 348 391 334 525 451 714 433 452 395 314 460 314 498 506 506 506 249 305 418 690 498 498 395 1038 459 338 866 506 468 506 506 249 249 418 418 498 498 905 450 705 391 338 849 506 395 487 226 325 498 506 498 506 498 498 392 834 402 512 498 306 506 394 338 498 335 334 291 549 585 252 307 246 422 512 636 671 675 463 578 578 578 578 578 578 763 533 488 488 488 488 251 251 251 251 624 645 662 662 662 662 662 498 663 641 641 641 641 487 516 527 479 479 479 479 479 479 772 422 497 497 497 497 229 229 229 229 525 525 527 527 527 527 527 498 529 525 525 525 525 452 525 452 ] /Encoding /WinAnsiEncoding /BaseFont /ABCDEE+Calibri /FontDescriptor 14 0 R >> endobj 14 0 obj << /Type /FontDescriptor /Ascent 750 /CapHeight 0 /Descent -250 /Flags 32 /FontBBox [ -503 -307 1240 1026 ] /FontName /ABCDEE+Calibri /ItalicAngle 0 /StemV 0 /FontFile2 10 0 R >> endobj 8 0 obj << /Type /Pages /Kids [ 2 0 R ] /Count 1 >> endobj 15 0 obj << /Type /Catalog /Pages 8 0 R >> endobj 16 0 obj << /Title <> /Author /Subject <> /Creator (Microsoft Reporting Services 12.0.0.0) /Producer (Microsoft Reporting Services PDF Rendering Extension 12.0.0.0) /CreationDate (D:20211028105936+02'00') >> endobj xref 0 17 0000000000 65535 f 0000000010 00000 n 0000003714 00000 n 0000003911 00000 n 0000963438 00000 n 0000964838 00000 n 0000965379 00000 n 0000000065 00000 n 0000966770 00000 n 0000731817 00000 n 0000841143 00000 n 0000964634 00000 n 0000964964 00000 n 0000965179 00000 n 0000966570 00000 n 0000966832 00000 n 0000966885 00000 n trailer << /Size 17 /Root 15 0 R /Info 16 0 R >> startxref 967128 %%EOF