%PDF-1.3 1 0 obj [/PDF /Text /ImageB /ImageC /ImageI] endobj 7 0 obj << /Length 3001 /Filter /FlateDecode >> stream X [[o8~/p35#$m)ii,JL[rF̏KCEK˗E8yn߹:}7p¸^@A0 \!UH]o$_7'uKV. F`p˘}H:C:W"K ˈPpC$@9> ZFT(p/8DJ !Pd"=f,Qo8z[(gW0ˢa4 h_8?~e' i'ǎtKB֫7ؠ3VMSF5t |B8jL"O4 G*v*Ui's{;2`ihڣ8=jsUTRF Zpp:")QJp ]L )˜mDqf<ɈvX#UOzhL ,%CxfQf \D bim_O(>OYrF_0 nF*O#uP(Q9d7H6yp9sLs@oJa> *Fz_FO0]#\o)h_NKe Ci:2)PZ@ymF%uP6Dq&fu]Lzts%J' ΋kO8?ET F(T4%WӔ2K<_q`QG5=X)KrliR_FH'zyn}O8A|T?RTW˓dj#r44侈ᣊ"Ԇ,Y t>DY 'yQSJILiE7ip:R'jzpG ȿvlir na]Y~`sa䧭; 3}kdeFfI()0YMuB&1iuE@1M:Sߦ{! > 51zjJ7KZmiIW 4fcϰOIHb~f{ن#'HecUXu܈"D0"AXhAtC 2t71`궉0i׳V0q3mfn $m5>]?uA;0/̋m|E8c=IYd)yZ=@0<Ѐ1v\<ҧ&_ ȕ3 endstream endobj 2 0 obj << /Type /Page /Parent 8 0 R /MediaBox [0 0 595.276 841.89] /Contents 7 0 R /Resources << /ProcSet 1 0 R /XObject << /Im3 3 0 R >> /Font << /F4 4 0 R /F5 5 0 R /F6 6 0 R >> >> >> endobj 3 0 obj << /Type /XObject /Subtype /Image /BitsPerComponent 8 /Filter /DCTDecode /ColorSpace /DeviceRGB /Width 838 /Height 351 /Length 727730 >> stream JFIF,,JExifMM* C(12ևi"-'-'Adobe Photoshop 22.3 (Windows)2021:08:11 07:17:510231C^px(HHC    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222C! }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?(& rx5K@,Ωǰw푰&WKB8ET?J>$Oqx#OaY_6)Կ? [Cdgǘ=??qZy~!2&Wa~2ea_s'Ҫ~mylw2]ƛwlIAԫsc)-[tnta\ =xJw"_MG4Uܯ}rZ}14#kD 85d:Б '_Ekĥ.ײrZ<濕{p)2yQ5_K4M4p~UAK4LDGQʋDMtTf4i!4/d3[‘=_@ju KOgfˉB:};~rkc@ 5GǿI̓<OS%=˾9ů|>֗W?fHM@wy_* ?%+JkD~O?iQV>XaRA='u} 5($y Ӄ뢽Y}oڭ~ʥfi4ƍ6}Sfk+|v?O*5A{WN_ȷc7SאVD =;}qںҼLӹG1o>_$ݷqVqIt^2nVV:$'?e$N7c p>u%(EAr24/- 5aҵ{x#4L@<8=sT0²]ԓ ==q՟@j{}y{?N 8`*Tk"0s|1CG>LJͽٻiLMӶ8D&i:r4u U2pEx_A+Ӵ hаǽgH2\p%)lo"n#.F֫<I赭25]9&"*Pw5(`؈vVy$xu7Q#Ŏ?byK\/}9cdȵ[O"򣑝[_e|\sОNkj)ԩ &"0D>m4-VKȦ6䲞qkcK<Ԥgi,NI_SJ:W_@R"я)t:I; 3Tk6{bɿ 8=pslHmOd6+<ДbH|䌟JZI<9䃒0Ab#n7Wknr=SLx2{++뺄rI'NJڕ N:傱gy=՟Euמ֯5R[-2x~ d"qreg!B|v_ŭƳgwJkM.yϷjHbH]GZn7mo"QPwH}aGwoR9spssS 9RvW_#̢LĘ~vؑVAl?]M|ؚy]4)Va-cGa+L@=Myv-eXZL3,F4a!@8w3i΍R+^>>qy^G=9/Bw3[<jeA$ 2 ;V9mP-ګn  =piߑkВKkh1Ra%W#AԃPn'aWVEehAc=*.-zcU,d@"sGy#kduOSGbdaxiAϝ~>_QKFegqjE֮нu}fcdAe Wq"FVz~f jt[c-$ s#1d1#WE]T w1 *.QW03ƲFʰ8Vf)մ`I]9wJnxkyLl @ߧjΌa5dѤ:ԚZ`mD񷣩YލHT4V; ƶzOl a${psyBTQxNnV1ĈUT[Z:/l㎁4˙52XEՙ'u X#SGA9l0:Oamhm[\ !t~(NIn%Pެm{ 9,+(\rM.mE9nm[r ՛"ԑs4YE2qq r7`nc9?+g8Z/m5;]FLkfAHctb 8-'݃P4QƚL`-,'?>S`'d4'y vf :zWzd3E#Kq#dăW9Vm+SisSZ[c"Bw>M[$0mvSX7o$A YYbHTԚwF5߂.v+1 a?+Γm#5Q\.#pqw=1bxbyHf`(mS~uG3iV}OُwZ.Yv#!Ot?Qj8sE..̉[}2K,aD%TV?0W.)u)K{|6 r+j6L7je#|UθѲi  2eղkf _>;us{|՝(AҢ*KSeb룂X@#ɷvIEP(k;kaGk*šm"=EFN.ğeer\bKE(] G7EsU)>jLFjD6^ m-# R(ö>e su& .!v4:U*j=`m6eg(?P:ŶchCmck0Ue''v[DQ@Q@Q@`((Photoshop 3.08BIM!Z%G AVENO-Logo_4c8BIM%,7tzSҷ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTprintProofSetupObjcProof-Einstellung proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM 8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIM]^CAVENO-Logo_4c+RahmenC^nullboundsObjcRct1Top longLeftlongBtomlong^RghtlongCslicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong^RghtlongCurlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM ?C}# Adobe_CMAdobed            C" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?T/c][rqeUvnunncd㡁p;0Cx4{qɹjw:4IsnC >Gk]\Yy bә?,zMytONQ"+8O6a3&|F<_/qŌxB5uߏ?+(hOZcc&q i+?И=h-ֳp/?y!&> ڇ;7(?>>y_&XV'??>~0zc~OFXݵ9==WNֱj|f'9}8Q?[p-N00ZO>v֏}/l.!p?[?o~<?Z_~ tlx,|9ۆ[2]cfEFf5y8UiQ4K-^agt1c{Kàw~2ǐ㔸"wù@kwВ\O:Ak]:7FhFkVQEJ:G~-}z% p ?/2u޵7 1hQASmKҔrh\e 8e_TɿS:NٙW[V㽯f?Cv{{*}uzk|=/^²*X4 qEݿYf ' \cbŔfFQӤHje1$Om?K9OU*Wv8'" YΣِ?U+㫮:m>u얇h#mlߤnǽ,oY,5M{]{?5O)2%^8|21GB|q\&>Gݗeu^oNv;˿uJe&w5he>b,~3^1[8Kѯou\q0ie9V<1λ#eu? Oˏjs^TϧRҭhǽCXF[f=VUnO:Oq캍@5ÃzeY[|C.)O?6(G,c`qā # %oѴt˺~8kXNvKwouƮrh>zhkQmUc-fFC$/c>_]nYAyc[ '!N;?Nj3<%+5?vӈ j۴6ѳKf_ֆ%fgi~j"bӿ]²,ɸƍB?Λ?'k\ EˊU tfcc2cw"7?HǷ?\F,،6W{4~&ؽa hkD4pL)̓! Lc0.F pǰoUձdְGkecI&XjCr*u7Y[s$;r1# Dg(Ke] plb :\ߦϤ9qZN=HnΛlVznloCΧԱ܌lkC>g9xĈɔO)#ؐ')6bidiJn|I?\f.$J=t.H(m^M³OHypN,tW/GFeō2[WPeyN.dV7Oh`lsmkl;Cߤı(ޟMtPnshwM]c+ݑ=5_eϠ~&D(!~QrvdX3fܭֲ7ퟤ`߽Vm&y`cܠg֭}_?'װ6>k}MObf^Nn;v5PWs!1JcC# [0?75f=WzX=ҫ%B555uy,SN߶9tG~S}l9<_?Ied~G{/z_kKqm.sU]PVe]K˟,Gl:Ks멢{2*lُ3k/Zލ]uܶi~o8GU+8db2GT߼oxWY{}_LZ>^.-cbeёUN-WF30]C϶kHN5YYcp褘+77 Xdy|lFDDY4;.߮}< Ջz@'\ȻF]k[㾋+\g=c~^.57s[=оtc1ԇ9kϛ/\"$OQl@b]yָZk}= 27_[jdmh'p8aS9%2e)˩1N\R$ TI%)f}^y6:Kѹ]e$O;dnZI @:~j~YM3CC呙]ӫ ]IAc<j2EJ;Hq>][Ϥ@e"̿{gв I_2 (w< -j>R?5 /8xpߕA9XsNuHp#UWs v-Ň,?5?ꓬ$bӐ}zo؜ۊha?xKo3LWCD:"t'a>7;mM=zՏL]nwWQ>jiʰiδѭЗ=3#짃dx 149Z>KHEb+֞?ԞYk~CO^qz=Wpk/v7}5~ts]`]Ek1cCZ4pxh,&RI$Tʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$8BIM!WAdobe PhotoshopAdobe Photoshop 20218BIM1http://ns.adobe.com/xap/1.0/ AVENO-Logo_4c ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$C {/o.s^4?SL}_=/±Y>_q,|{3??Dߥ ?g~(Y>_pa?K׿H[ort?_zX?+9zXd?—ωhZ\Mgo++{'4vZ54Wrt? _˦ۯHbEzF)/a"/+'uC᤿vTC5f/N)s"}}ύয়?-ƧA" 2w1ۉ]~yt>ӗ?]F~5H6Pq۷هN_~>#u4qI56$&OڛA_-o |T2kG͘w/=O41YCw,_)I|471#c/M?L|M?|w~aG~?dFs~>p' e⩧׎O$Gώx?Tu㾞'_?nl4㧍_x߹h--G-7Lo'IAf!1'CftG͏Xo?WgWfk+sm{O[,?3k'Y ?\ГmWx}Gˏk35M>-[}͘w/<'V(cq1dx>ojMa4l~!bq1P~~kSO/i.ҟYg|4֩z ^o?_F#0nC [~yտ W >ZVꢚ֑7X/ ?x?7,WX_ơ 1>,SNh*|_tnvS[:suBϊa?JGk׫uMjZzˋ 6く_šY?Bn:m>5'/'5ij𿈴j-m $y}@Z~V蚿 zwY0JTQ_O(|t[Dg-[j?xvb%(_|/T!|Oŗ+I`]ş_c saWe}B ?>!|b|_'7)/!IU0xu+?@xG?7_&+5h#)1??{"L/϶źktv/?ξ&DR8SƵp? ?L'ϷX2ԩy O>O_" *_\/ϸQZC*dƾ_TC%*~"?//§!ge,z巑 /r)_ گ_wŗSG_|^|0/T2zN7??ԣӮWq5h~u'TpkQǎ5/?§!oɿȯ?|*MN Fu|Ÿ?Gƥ~(?o?zԿOC<38p90k??=?†>9('O!mɿ?3c'`()GSOO5O?y&!/gދ;ŭ0+>_(ǡ~!j/_~2~?w3ߍȻ}6W EA &|'R)WQ?MA_~2ޣ|SoΥ|W??FGĝk(S)~ĭo(kVe?f?N_ًºz>&k_4h)4ɿ?֜/H3~?ȫߪp>"zϟz$Tu??럴 mN_~/!Q?8~ȿdcW~j|G??4]jC"֊="3V?O?!~%??~z?U?&?Vim{!c?!ɟdck~?ȥe_ LL+70OM{oRj?Cg|'ߪo2º~v?#J|O^ ▽|oRl??emSO+9 IZQ?_?T5?_3?Y0?FKs?-_~r7Sn5?¢*kgT9?oɆY~~=>?c||WRh?kGQoGC~C&"<73?e p _-A/ZS*6ЇjV|Q3ɿ?,73 xGi/DkVO)zH? টm`S*7a_`4"*?F? य़[][O!iɿ? 73&&«U_g MFR?Y);?7Y~~Zc|9qWKG<ZM?QB? ?7`,?MZ>ڤzaWKE~9 [O|poXS(wdU$y~'RU¢ۋ|Q_~UF'p+mOZPgV @*Bޣ3 d*Vi+l?MŷP]|Nn*W({x?Կ~7t5b6ӭ".|Qy|T2~ۯO!3oSW|ԣU곈!CAK~_;_m6Ǟ1ԭuI'BmGjV+ "sVQ!Rj =O{:"COCf(!$yr t06s)`ij)kp% QkEJ 3j#$YC,ȮW UtZBуϰ_7j#ף+KVmeEhfQEQEQEQEQEQEQ\犾+kmkNq"D̾ӭLF*v*1rvGGEq?0C9xoU֨2~Ƨ'C9xoTHx/ /*Qe5?mEq?0C9xoT}j/;j+^_U0T}=OqQ\O4?r "^_UZAj+ڑW !7 9xoT}j/Ixb<}ڍ3~tR Pq# &>7g?ZS!cERG=/Q7~LTeaKRW9`}ac"N1Q`ioFOʚ|;ҷ5/cQMS$VZcgzcOh&)nʣu旱jl: u* G[mTn0*=Kf!З2M ?EQ43Q6smc"co?wj7{s3M =P=m0u Σľfd>hֻ ƢnTd̖jLnḑң:2 Ȩ.JfW:~4ZD`\T83)*?Jʵ.KMmiK֤/8\m)qңMRzsZp*&5>%ͦ/Q9@5Gq*kiK\?J i*}M TTm:~u'5OF}<~i;~ ~>˟L{ySOJ\Q6 L:z^#8-bbݫvJf)5W/f(5_ʘlqW{_Mf3֨o7jiSʆQk|E,~Z-ӏ^OڭvW+/k֜􏶨}e N?H_?OĿ:&ֽJݢ#Yz<^g<4Qש֦[.粧7'd{`Eq#?r "?<CaW?̾G;j+^_U0?̾Ƨ'C9xoTHx/ /*Qe5?mEq?0C9xoT}j/;j+^_U0T}=OqQ\O4?r "kŸ,͡nKFOL'GNNђoN֭3rD9VbȿV#$^ mK6? O_]V ohWmK5MX`0~=?]ѭ.4]KO@?,@lV\eI$rAJOQؾYOvk9zdF Vݷ#5y[߶Ե{_fNrdZ#k}94[$νoyX75@O?_?ΏIGG_~E~/?skIG$[#/}M o?S?Ək}95$A?k߂>G5@OgA VaoJMMĢ4ve魎_|9;E7ޖN୏KoX5A6NiuqخzHzGSB6j7j74F?S?Oơ} H߯Q??J5TFSTF?OʢT2)74ק74ר4ҡ0_L4}Ƥo(5 o֧c.߅J~Qv+24:iRY xm?*Oj6r7QJToҦEߥ4?JiRRiܨߥ">ҝ'A/pJR4"_\7jiNoyJq<_ Cj>IQi1?J?7G[B W\@տ?w?U[Gn?M-,cv7ݯpW鹲_\/!g|= O)_ʹeļϸ|Y_W[k|k{4,P. Y_j :,VHU|iWOծsW˄.k?<XN=;_O o?S?ƾY|~tH??:oW/}M o?S?Ək}95$AVaoS[E~| |~tx{07_ o?S?ƾY|~tH??:?ռ?mbG/?sh_,H??:Miij%j#P>_j[_>EM> c' 5  +rV/W׏)p6'ʸ5oV𬖫%\jZ ?S_,.pLE\U%h&]K98Q ɫEWڟ2QEy/ YTQVEYW.>*| Ő[$?>gce>@ |bތ^+ڧ_juQ=ƽgp矽GC<#ۃ/w}Qp{4no渿GCP;O|=ۿ@?GkhTn?5> jiɠ.~W7]7M:?S7_<4J<m Ѝ~wƎ!Si^"ĝ/ݳ㦿5*Y_Nͷ5kSJ׺׭dl_x/=r uv_՘Oៈb> [ }fD:Oԣe߉5[ RAfcd=X+"iؐ<֧?iGOqē:U0_n#'QWn앚ڿT~G0¼^1&4T_Q Q'? _af#F}G8zO~)|<־$jD2$Ո3X0η1V㨯jO楣G!_iru>>m>Z+G0pE~< /vZ+=MOTςY]dӖ]ξNZN M!ZN1 'U񧈴{;+[đ:)k?br>OqGCU0!Nw喱{??Z8G)0pBSZU|E>&}&ݣ`8+! #aNy3\h9.-QAIkL ,RȽ8' z0gJf`ɫ5{nگFyM԰8u6Ҿ^q0~%[#tvkzWS<7kl2Xai'\" |5Na {%q_Noivq61FT`W~!\T%U(kVLnf*uqPZ+iw=φ~$ O ZcIU$W"zѿ~ >Am ?O}+8 |vevlgxZRRU_vO.cQ٤lcmH88=м,⇅ִ]>Q!%NZχz|GHs5G q:i?wq./'(9(ɵfnSCt+7e}>eo_[֙ #4g"wGK_~7?+sZ4V-hY[T`ο/H?|?:W.gkONWEkVJS%?_?N}}_v:h6';7,9+*K^:tK-+=3)2L//c'44֌i,{w1kϷ}V*]O[WšyͲ}+~Ϋ]Ɵ?i#Qfo[r7K0$pz5 {qo }|@ԭ +BD~Z'Vb&ͱd=O8KMl /4 O2W|k8bhwW|mR|geCWIpO~&I&'Z[IZ5/ A9?Jusqs6ï5uĸ NEJϙ7ѣxʲK诧g7_\_'_׉UZX$rʗ#c{Wޡ_&a5C/?.K1x8j,䓲w}=pux]>G.JNn+KÞl:g[{xSJ<N0}q0$HR8г1s^*9'ugk0ܓ_F.J?bo ~|]4a ?d@M{-ަų*Ye5$ԯUo}yO;?$ bnnIB+vk Tb_"xx_IO aI|H#??W("~wU^w#'?šH@?_D?!`忉|=lGjJ;m/x~ᎦmKg̥Z9 W=S+XBicFQr8VM?ppj3޽fش^ =>h QC OS~U;R*\)uWK5iz>F8:Y/񧉼/kjjZIpcc|W=JVl WL[6=u$)5K9?j |F>&z~k޵1Bmx;M<+`k_tKǪI|!2` 8$WU*nrUbis])+9E)4HUBP3I;wJjSQjާe][-x"wk61^A?xSҽ1_;ş*/Io$ƾjb;ek]b1p:6 ;|I R/ί&R؏>q9e_k__ u#/m|/˨FjmlMz" i:\Gn5U2phQ]91Z> (P()ËAUɠE+y" _{V?a\C-6 ExZ~H|QiS[_ V~O%H [ }fD:Kku;դwƃ18װ 5Eumc 8yOVJ&ϩdm\}o]r\cH᷂,ǜ\?<+(;Ub';m=ҍ JъI/$b.7b?{-?Q[~l@~;Cn'bhۉ.r<}}2So?4Tmo~c"o~87hfs/徱z.(q0Km緑࠿$O^\>^I6^_ ԟ?Pk|hScᖫQ JW& G(~뗄xy6e Z]^tg\s }c&u+(VEM'S\~>գ0ZLm*N2=\Z#5B%Vj?Q*<;KxVs֟2ʄwQ>4?X#ɾ>J~?[׺~|Cq;Umu"g,~( Ů\ w_u>Q6Oot'ςWFon!겦N0s^)ӁUb!(4g츜<+ҕIYƺkyQцXpAʺۯuLzh۾k[uz_=R4񔶒OC6΄?nԍWal&i;[j}"Skc)a0Wvm#zI^Ri/w3+ȊvybSl#XB"PW^U11v[%V?2,,0WdEWR,6H ('+sO~˷igC~k*O>2rljnJPyn<}|WÂH<'Zo4Wzz/36:^lt.*;W]ц#j 夷Uцl 2<=e"g5W%kO:M\.:zKi8;s>(DE}ӥSiJ)6?UTp)t'pQB+xͧ??9_kATG Tе?j~d2Wve'ޖXq?r[f~~k?}~϶M1Tu_??/˲O8?嬼g|ro~ |m~mzxVG iA1{V7 ?d_/ ּDzs~ܾ S16\mZBaϚ!۷k6նzv4?Msy$2 tuè#ظ2zf8L5#{_WoVx8]LMWZ7 >#qS$-?F<[//ZWAfO1_}1/?DO2^JF 77ʫ{UǸ? {7G[S^AZuW qH?57)hOYG52z؜le U+s.wm~* 54潽WCTs'+n[跤m.q7C} \~jUXҋ/GZQh[е/xDlm.fvR)+ F]*aݫZDQ-uJyIEC8E=${?{f9}LgJ{t}+6<#kcju/+X 禋n?_ %EןYH _-ZkymRM|QcmBǸcFo>6 W>*dծUZ? Iu#?b#_3_0XZ[aZGa28*"qv|MG?;j2_{7ޠfցHqڟ|Cm?:Lc̓ʱFRx(ࠟk4fSM2P [SA^SG]or;J`+N' N:lwmυ8+ʎ vz4~> /t> /uZbu'ʿO?ȸ$~/g̎|e[ mCx'_Mu]}|cžc@%Ze7r a*ÑȮlOM^Ժ_I?֏bԿ{tR0|Uo_;9U[tW~Zxz[O;yFjAT_<+ 3Vu2?6>H/_o>|_Wg\᥄'5L">YC+iSM~2Jb:[QWGCtOC|7½~{W]&*b y'׭i>/_/^զ[gLvT^W@?b4}O+ :{_u>M"(o5\m!#8S]{h<3ϭM?e؃?WYO**8}oI:uEf~)f ( G?x_mS~6Z9%|?(|?+3G/ 5_s3/y_2'<  gl#y?¿x\ό?Ѡp# [ ]s2m@NkکkI?_fx/V𵞗j)oא~ȿ -lj a}?u+c.(`t~/9g_V ?W~?5-R_C6bəozѯn??i˦~VdeQ;6 袿?<S2q8ri'ms3MZ8I<<\VMt2_\ny$bf'$a 40\6/Xm>O O8-9heJf;jeU>Y?~:vk]]*]׺knCl`/\uWx캥y|ۼм+"+t+·2+j;uMt{=okJ5,vjy?4|q+(&|H’ZAE)Iv{jtr+g#ֿDo^Դ=N%TkyT0G>/ Lռ!gf)QDZ\~}c ާzzX_eYci-%tǖ4Z_h դ4.:/"N} %tSMn}oMŏ~ dɲ<p+ػ Bn#btP+kώ8rY.k<4WC/?8k7Y5Ĵ=9>Ʃ| 1}?4m:9nN?ղH?ࡿG+_i+O700Ȓ???igkYi{@EhX?w> xMKW6算5т?2Mj_Tʤ ۲]('/i!Z:kw=C(*4H_9ZV\n=4 sy20?_XlcW]P? !hZ}gGR <}e󝣧e_#E|M<ŏq#K1ym_#onߋvu#n\84уVhV??jH[|M NMwV_+_Le %8OuTm7 v? +3Tq^aQJ@|Ay'?LOxv0~:|.|-G!㑫wsXZm鸶R+5@x;Xqڿ$XF41#iQ~~_e9*,:Š8z qC^g5M㾻7|RU;6<$qk ǽkC5~"=Fc^?~__o-:kpltG]ﯵS>iG?v|1OJMon#ǥ~ƹi>2[Ey4H7,Ðǵ| |4Qn+iCGE`$zW~E~h:KXķҮx}z{?| E~vaGqXgxWO껟3”*QUUZIk`y৓._PUq5MZ?*,aY {Zz~=־=un?^oڏRT}cҽ.\bxCҽ(1_;ş*x]]BN¼gz,sԧ+ .0W}i~Xvki֨ȾS0_{|0!_Fx?WOs^(Eٍ{'5GlpF%<#sJ0M=~8SOx?)l E.10F^kt*@<}ioOioO_^hq>0FdOۯy#y?y#y?¿x\ό?ѣ}?LO?nl ?l Eq>0Fo>$>(Cg fYdRN?LOe8slxLR}V~|6_񕮃xjo* 08^I٭=6FH>a~?A_tGk|UlNWmvcƅ:5:}?1QEzǞQEQEQEfÖ+w&#ov~W AgQ۽U3b> Z) =gTY.7{3ʾ72kX>Âʹnc WOg\Q߭z?]gG-27M=Tג_FSaቤ٤ףW4ZY&i3놟~}Yk?M>iAYk?M>iZocUayg7kK~#_?-0UviV6Cʜ7N#GէOgK@5[J~~v>xҮ?_8?k? e/{5SoWP+_{'J Chx+:eoH>9h 'PݾG)y?#z8XyMLg~y=KVK, ?ZuoOU[F#A=jCXx̍Xw濵r–7 Mx&?19ʍEf,[3G,,$FSʰ_TPf_@>zeP2~>~?ůV#n' _gW*ui+գyG_i|֫#3974~O='AkỀKKGהaC]qF2kS BkvZiO+RX:sWMY/aW[|?{B&MofҞEiZig[fyl~*xCDcBVNGOtoj,V:=O!'8QN$u>+j&75ƫr'"$=p++ i [dG>b=Ҿp}ѥ+0zW_yG߿̸7mvij9J*66C_K;>t5Ӿhm{MM~U!_#H. vǿesk?nMa+dl.FXlѰ~lDRHHmduʑ 8{k;wL;iNPf{~Һs9q ϧ+D~iQIWj[tÏ _Sz1VOڟ.39mS w Fj}/MOPxFҴnF'OڐEJo̿ v 6OKo?¿JIK4޿X:cMq^ p$I%p*3"WOHt)--mmo[+T$}O^媳s_G9}mCV{d|iak;~omڕ%}kyWD߲|,Z%}}'?DOҸnKl_k's.Sw`^I񾭟 }~C_7묟}xG BjvhUmCO5 lFA^y֯ߵxS~"=.$o2ݽ }8=k7vO2elGc 2~8ߏuGp"c*O8IHGOxU֊]ᾦ)s%zŇtZ[xMZ?*ɢ_^ 8gq[/?1?k$&v^c=l ߭|ga^?GKa#iM(O=kSS䘊4- dU,]9kz~(IxsKwC(S=Ou׎'˫Xꈭ[[A0,zF_'7e8*l%h3JV?"tq=O%zvsWYˏ/k+@f19x\4=tm߭f}G53Ϯm߭f}G4{0߭mg4}G_mzCm-}œ+B vg>4wnQݪO ʄ|?jmcˏ6UoN"x_W~,_zg[|7ڪvP8yNki]qleRNRr(Ѐ(((wo5>ib&#+F5`ff8IN;? XcggxޏVOg?(Oҽk2/&dȿc_y/~}^  pߓG2d_1~MD<#~?Jdȿc?c4y/eGs׭ke f4u?[WFן(E i~ɞovo nX\3|$ּKF\v`o_*z?ik׍t{%\ײxY#7b^<uU7J+'#7>x){KM<7py_Z[jzfmwv0 DmP0Z3C"F1b+|!sK;&]qW~~Y[>=?ֵnxW+|g'$N_iik_u9ʯ9emuFE(}`} L~F޾ȟl~?PǪi8$ ρ??JRw :_O]_MѶd${%kb#7ڮV76n|]JjmGK-/h~tZ4wcTGNA {\U]h-K\Lx<56~5 <$HpLJ]BeSk]UO9)Yw0GPP3jO#sctJ !bڠf_\:MB*?~KIJɫnK}B溶GIa]?7Ol@_hk??4N5vKڟ-??5-q4OK?K`j?t6'Iƿ3ᛅL>?/?C}OIGm.c|QXi=?=CfAƗi5?yió|5uOI.4&~wy6{[{t>o5~_蕯}>!~xn.r[F꺞WV]Wuu?c4!B!?ƿr۾s[j3/W_ƿ3?Q_'l}?/?g?%!Bx'Yui ,r1Ɔu?u[j9`t"4<-.+ܒR-mw0qdНend$r11)ҿ[+f~_SK hv.+U[k#zx~#}ό`/}B&}Fs_}ڎ"֒y$2CFHLUIғդ;yMlM(M)G?n"g]Ѳ=UyM_|QG ^*ѪF ?m7 %"%/Qqz4yf/K1^I_W~J?_0Wgz~)д{ i?}9Y׼શWcb͇c}W~)ˏ/kдKܭW׼S}1գͺc2׮{XO$0^>?c^2ʰc l/ZdXhL8ɯ/C!%KiW&EC?  pߓF%,_(Oҽk613_ 'hC"K?Y_K.&K.$t^ >hϱ_^ t z78?AWGl>8 YG"Ä GWl`ھmZ( ʛeGc')6*zۗ[]}w*ZZ{5j-;|pޚ-5|U?k mV?ٟgG!w*Wfo/<^4w/Tv RJr RJUa?~+^ }{}j>R~u&b1?Rɍ*l\H~z3GCe$,E'AdSI}jYYGr3GRi4~)2To֤= 4D-Tr}ڑ OPh5M7iCP\v = Fr=*6CQH oRkЍC񩟧Pk>mJR*#1 }1 EDd?*ROʢTȤD|^x^#GJåBuj^#oԒTr}E~'o֧**S*YG,駭;YgIdr}QVߏ_Akr7QJToҦFr7MnM=*J[ 5*C*7H78xI}iK"40 j1ґdD~Cšzӛ4JqM~ 5%GƆ?+S5?J'!тw?U[Gn?Y,xh_4\l-FqV5}i5>?WXeSՇ>ҤxWm>x/ĺV=t^FtI?g»"3'tfb:gkdtφ˖%pOOjSCD43Qb_/_KF T佯 DR ''GU/P ?? zV97O2F ''GT ''GU>G/P ?? zQwS̼/'џ¿ IN?Iѿ|K?-†d/P ?o?y_򨝠M@OMvJ0+I5|$|PtR0;i{"v}]{uO٧IZ/Uem*;U7((((((+ /4|iCr1m}t+ ~W?ZL<"*%KUc>Kgg_ c/˪Gs"As8=k֮vs]#fݴ+U^!qdl%Px&h}(/2}˓*)ǹ~Wmgڸ(U?C㮏 {Bj祳m_ gYe+UVjIے{y(W]D7^:]k%\ײ=}s5f>*WAw_|?+`;O_u ҹ_u ҿ?|A/APߩ*̈u5{GSQI:TC j#U,娏TKbG/CQ|1Nk2OyyA@X/o#Nş_Mowg#WrxrQWXSZa>?G /Fog ?p,j~̷6?c?3> xU7︿?@*ch6{|fb?"t??AxQ7__-*+\Oʗf##E> ߲owN#__*kvSS?ȯQh ?g GG︿߲_q0j:Oʚ 1Uٵ)bh"?CN'_Mo'#WymBOʣmدͯ?kG% '/F OW?︿:EE~_)"?DAq54O7//FΗUh'S["?G~Ox;}q5~r6n[R~Tg?j??G?Cn;?_M7|q5~po1TҭOʧ>Eo 8q57 G!/F4䟕DU'S[K!j~ G!?/Fe?r3j:]oKSJKRo/j~ O︿߱K___GJKTO[RT[K"H)Pb'#S,x"ifDdկS_CVb'?憎?N7'O/E?VDt;էK5+C\߱7S_L?'xkDГ*q*_Q?e\~;?m}Eȵ1*R?eWG~Nli?"_ʘ֑S:_~ 91'//E[ Ǐ9Q-~_8g}N@ 8'1/ES G1/E׵5cTS~!qn?ދk_~~>"~^ 7V/.K `d$d3@W4T(iG8;z3i wƚ𮢐M=iZz`Fz_8J@}cC~?O㏉Cx3ҽ %/Pp_;ş*//dJb+-yG px["}_C)<{OZw-?jhe8A }?Ob=?J#ZA[xgñ&s| I&-DX2eJ)k> .kzŇ uvxVT35Υ6b(gS䖿žt=>`*Ҵ)ikf1IYIŠ(QEQEQEQEQEPFEPct xO2|Ta7ּkCڽ۫U-w:?/_+ǩDz㏤G)f47rO__g!Ԕ$>lUߝh>'>gkʲ}[:G{oۏ3Yrtu^y_gCjo bbdRg5kZ|;U@ޟ..N=Ӟ=5/WJe/:w?/q-%\ײ73^;O_u ҹ_kNY# z M/AP߮dCߝJ:OԚQd-D[9zGI/Cwj"¤¥Ȥ> MM'Adk3HF~Yvooo&Hwsc?~h?m牼=cE9c[t)Ӿ{ka;0Zȶ?/~{{' Hλ z5wkHh|l~  dg޿IO_5GǦƚ_M[;뻈I *̙#R+* _"~+U;V,5%NzKo1ƌPZW {h'OuT/֥y>_[vrsӥ{'_~+i;ltF᝹=k9feMVr^4g{OQ>5SVcSK\K=3&:><~Ⱦ.je`[ LRxu `)]RG7CQZzSKX_0́:g K<i)kK4uD>Pq!anOBM Z|v_<8¿U:o^a#`~P8\˿U%x hf7ZA{R߷qXoҺut29:4I}i'D*Cң4;MPc}֦M=k0#=iҜz_ Cj>IQi1?JJV\т^|I_0Wgz~Cu h6?0x_9Uٕ?)^_C?WT+;oE?ֿƏUn6Q+?,o9g?}f~v/V{Yawʗ_ʲqտ:>}[~>!VꮵGs]J,KOS[a׫&]*J1{ZG \5'_I[Bú (!^޾Wg}Nef~9xW4(/(s)ƺ܇QEEPEPEPEPEPEPEP}F=Bh&UxC ~S|n/e?XeVh&i V<?ҿXk |@\ދ]"yk5ݢJ}2GJ%9mgtMYsI`9魏n\pJ~Ѝo.8-+?>z+@? Aq__˿?F b ]pn ( Ϙ0^k5V/?֏?l8rvEn{Iy>_w?g _bjOt6<{(=o%_n_W#)Gi_kN7J+N[# z M/AP߮dCߝJ:OԚQd-D[9z3>^LQlE7}*3I7}*3K*;I}j:NPfܓI;|A?3"4" jCt_=6z_}x%յhجMzunҾ+im~Gd Gt[-bןjp:ю_Z^78|&º:ʸ a~RB=|Y 94X#m'FVf"+b N4{^`]GqC; f=5y/ 0JbxRCqlE(=-uoO"pg_ xj|AxoZV/l&0̪Ҁ˸sW̞/>94<-x᯵/x&9/w>䟭xXŏG?J$CrBK~fk}O?5ŏhwhDYU?//:7xA<7İio)@X/|8L:J[ ?b|#kڶi˨C5 $E@,9S+T̜9ݖ!E{?SZ/爯n kR[,ŽW$Bcz ƾ(+rGHAQ@koQ0G_?K{TOIW/pg )V)(zE_jo/SGOn&~ZE~&^ U8)Uxq|; \qw">ic;]?xVemZĭKy #ԃ۰[_]#X >W ȏ :5)Fg'BvWOKAo_6aÆu?'6s,?o_9[1_{~Hq[(,eT"Mt\@_Wzno?G'm.Zk{yVG WO3-x'_j~}]glA _jLda `uYRJ}kc l3n?~%gɬ kH l.* OK??MOu /n%'΅^W#o_ؓ=|7zVx.nH.A˱#J~?]x@ޚ7[D*aF{J Mlc{+kW߈0G4Y~oQ$F:riw4n,~FV"3_Z*¯(< gAY;wPBk%$!~%~Nk? /Q h']?ߍsWgߌ~֟h/[Ev:C"?PWY/eV;/\Uj>8!gz]0j+5Dϙmdǡ-~W ~ è8kګzefC}gTC| |G{)ojD..*$&} >'/m+qOO_9Zٛ~O[["5@ (s0}*`AVmj,ą5pr@#q_D7iiGK3J1zTRVm??:l|3f[8BO1צx3|u!/Eu5-х:öM O/_u\tY_х~R>(’?d5spLwPs ^iZ5/߲„5QK{xJMj؞F2 ʾue}Kkh:_[MG$w%Շ"N>%|[,WOFڗm&[I>~=l/CMڳK( =qXzqSwSjԋgs>|~]KVO>`\eW>T#DW:fa0*+JGR[QEtQ@Q@Q@Q@Q@Q@Q@Q@Q@#|xq҈gF~߰tg?*Lߢ8 :I <+ο8KH%e~:]7⁑Λ8 ~5|V~F}j6oFq_?~#ӵo$ #j^6E>0n5;&27 oҺgGry2hmՌB>xU濨~*qqQ^7ݟs BMԤ_zb^oQw`Cڃpө'<{1SQI:0?7A 娏T?Q-֙ޟ/Cwj"¤¥Ȥ> MM'Adk3HIs ?~cTƟѰᡙfhЃ^ axxWR{Ae G5[WVHZwexRRR~>O_e[+K{b~!D&U3xgKgA?d?5O ykQ70oek81ňMp_-w5|A*b MyC w(xVVjVש~Zw> څڼC,?]сkO &nIqIrѼۀ +o/?QCr#v~OU=W#w-wn&A#jdBբ{wR!?Q_w^ ?=ݹ<د?_ qV%m*M #ŌQ:iVj﵋tvYSFqVşύ>~ÝjR<Ѭ/\2/UUE|T6AlmmdX##'֫q# ̝)fNj/. a0݂z?* qn_k|PG c޼uUe67>f=*#e|N*2޸Lj<;Cat-/)RC"pĞkUX+Z qY"Epz"A]B}3_5#|&M+M֠qbH8|xx/M[7j,q̣<2Z _z7|3㯰Z8$ dߵy$4oEs[':o@Vh%sf\/~"|? m$=(x5叅?m^>4Y$Mt ka1 q"JAoeյ]}DF]۰Ee+nϊ߰3?ђc7g=k9+s~ I#ˋ:Z"4paqAj̷:/2:aOPi-ֹ(_;ҊJ+c (((((((((((((k_GQ/Y+y-n#=7R?#_kg~_ufWT3iO+PE~jt ?쭡zvb mExySm.O=LϘlu;8線;y7 =Aw{W3~(~ZxRMkEWȶ~Xt<WPXA_ ZJ=сVֿ/dx<(_|΅exߵ >)R,oכx77w5LǣZɅ?ߵS. XC?WK<+[ EyK:w>OWmY^DZ8(3-FѼWf;oz0Ͱ/woo?-~J׺|E<2~uFx.[ɌQ(|!MGMS̄1^}o3[CsO9[6gKLT#5g?q' 8+3`_VxTcc}c|B\FyccC,ϦvCr@2&2%?|_kE/<}V޺mSྱf̰ ) W:ƋZuk݂n_q_yFU ^2}g;?NOKNoTg ݫq*˚qtZNwϵFͺ;,j۫j棤ˉXFGݨ~?S$:j~jGQ?ZMDmXnQjK+fڣ}>5nL>\d+3E'bJU23sVJ+&F8ZG#t54 %cҢ=jjfZخIF)SVQ??J\HJtbSڂG2nSUw}ڳ'OʢTHJB:T5Yq *i `T/ZiGjJ}ƂZB)X= FjZ4D>H EFb_JYBЮ3izTΚzԖ@(n6HͽO(!Q14XԳWi٣^9 >X[ \'?a*[{='M@9[KU-}5zF+zYVկd^ txQVVI_qS_&5SSRb~h,k1W|3GZMuu1B42HRTp#n*Ѹ+q}bttOVI\DQir;,-FV2鍨ȿw!~}qһ9oUg~.|9jvks4|lv"&z0҂>a< +[5 JUpO^; ~ ^\jrᶈձږ_2cp$?JQb&OSѬd;kxWs#UNGō$AXyOߎ ǟA}pr-Gq׹|)R95y UlNt>o4 ՞#x>Kqmv_{8.Z<0n1ھt٪W>F;J0(B(((((((((((((NGUOZu"<]IeŴoҼ\u\}jb{kI$-&{7sV35M'OVpuށFiR׫GA|#'=9 Z4 7[L^XqF+~~nYoI6iƍ^ f] wqO9V}IUNCnNw˓#kͼO [:ݶszђ?&8Zc{?>L^ 䅊o*L}?Bk|gş\ZѤmx*b#'s>wpǤםև>zwv=7Z.pAQisck}ƛ'QNod+2\5}ʐ5}:CQH F&ߧPjg=ϡj'R_Ƣ~ccTO ~U¦E"&ƚƚ:T/V*S-"G%Fw$4#= FjCo֧c.߅J~Qv+24:iRY xm?*C_ӥF%ToҤ}$O]ÏCG obfϫkFP ?ѿ &m|&Rz/ :_qx{|KW[| ? ӧMZ /Dy7sɋmg4 WڽM] փL]:#Jv8ֺ`U1KM l(dQ@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@P0=RQ@\6JϽmT^}rRWKgxW/q^Fj9-Aҋ0eg u|k FAN· Y CY?/|k ZhX6S ͧ]&οX56w߹^}mt+ҼFQ|8M/oxm?"d&庵Ͼ+~ϻ5~-}-+nzћ^Q*$o󍯈 lǃS z}jNf0 N64G+% W ckqzI4c㚱:%9tT&{7h;Vh)W$5n{swu 2H3zՇKNS[0+5#+`<ꍹ7>|0>)G䲟QA/_(]/U,OdqeQ`tff+eG&V>]gΕKuͬ\=I|:h :dumF_id5~۲+}%-l+f  }]kKL](]U#q\d'^`sM8wŸ?{V7RuO%~U+Qxg.4[[߁*lƾ/k'%JW_|o|#qד 1o_I|CQ|\XM6M=k+?q_ n^?xsY37?Xr q+F~IqXw5nzhW5OơԮxQ_Ƣ~+j'H?AO?AH~D_Q?*dR"oiNoiPiBujaҡ2$rTmJ"CQZsȪw qo!ռϺ2l|E:1%ݻ/ڝ9M* MB_d/$|\G?.4?Yk{|rC˗^7N;?xʛBO')`͵yf8 ]Ïw7<9j@h_> dzF>yG>LWK|vծ6ojhasv3ZGwĚ;vK7&2$W'dG\ -y0W+\Ĭzc\}b_OfK/3wM_ F-pD&>1]UKڌ'`r9)=mdrkqjח''M8 I/- in[2Jg[3je5;ߘ[K!W°R@Mcw-bvw73Ad>u>U-GumS+O^M.OSέa)SMj_2H{GdDB=[5xǝq$jǔvlN42J|k0Q^^I_v"GjP3̮ln[eK9 &AzTψ%-]CHԾm zehm_澃 :?7+MlSgoC {u_9!h%#$F{v-2k~ζs ,~*ѥIZRV<ڕ*MmS ~*ч^fvn_澖5F}+VC aG^ٝmmrF=kd/^Rats j[B>oJEFʝO-D(((((((((((((((((((((( FEIERaWץf_"ƼJ(+cs \W?gkkBݣ)Z$QQ]$xU[oRZ6t&#i+k _ʲ mu5]ZKA>~ELt{Q,> ־݃|A:[]bڼO:i>O(昺_ ݼς|mO#8QT. :o^7>k~ʐAfƞ־t-ء"GzNMiV igZO+ǘV1ܭ1_G>/wyr}5貦^Fχc]1LμEƑ3tVbCY:Ūiz`fc ]EX)֧Q^g7L|>Gص+UO25ޡ=ִ3\VhFqJ|CĞ o4ōz?Ȯq6d4wٝNJ~ b'ùXܴx?y4rɒ=֟?V1V/+vo}ҹ2S^G7  XzomTMf>ӟa |Qzև(8HJ';o~} /HO2?+mJѭ1*$r^ȷfz%@$ǀX3iZv2)>p E f5aLuov ٦59]#ᖿ1ƍS~5I[DYxKXY'= `%]F!,Oֽ?ז(+.Ǘ[)/A]v[xy^u8A`Ӈ};dA^Sn~ݯR !w[9aOOY7Ec̭bZ_>J.c:hccۏl?ekNE{.Kfmjt+ǵvz'K=zq{p(+QHVUޤg~0^?V(vn-m@UmCWos;X6֡r=+ ٪}DK4H.oNc^m(r1Y]vB(((((((((((((((((((((((((((((Q@ hՇJTQ`FCa*U-AkWGGZR9־ޫ~*G:Z)½ƭQ?5 ?~ʐ܆G_Zo4iՁO־3'Q}kwƼT*KJ94c/cS>:~F4 f Wݚ[rW/x*?T}֟G4N_Qw2p~Q~Z׿bz8]Suhs+ WGV5j_~KlB~+ptwkJ)}"x<KC5T2Frt>VV^W{lZk3džoej"ωG۳Ipb8s0T_Ju4xѶܤngW>y9m=\ψ*uM'^%܏ǃWV;UV=*uQ^ ?MOvm[GW]2y]fo&1lWhO}bn $,1+uGO 5-b74PeoKI,> {kk"#~f >S:Ous,5?kxτxƻZ:K8cڽH/II/IeF~'}SO߈i[XB?* 7p4*eTѨhs:ok0?vl[hEh(bqRv:p((((((((((((((((((((((((((((((((((((((7NSQ@\θ3U~C6}b_SW1:kK߹_^xo |BKh.N72_k߀:τi4Bŗ!:W޷~6Q*Z~U2dfʋi, Zކʟ¸͖[y8VϺb;|qo}j[ a%9>kk ^R5Sq~z Qi+'{J;cj*J ֹbyo'D FVSo|iP7f;qG_S-m@}+fP(Һ9yOonWt wZ [@_ʽ>->8ԫj5 >Z*5mZxrp>EZ@`QG(sacB()h&EPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPAi[E%rSEvQD~Tش(VԫjuB1EP (((((((((((((((((((((((( endstream endobj 9 0 obj << /Filter /FlateDecode /Length 108746 /Length1 221236 >> stream X }|[}C%Z޶eKmǖ _g^A^R "QQ'DyA{\M Gҋ8FD<ȏҐʰSĻ*wihfX7=Fߞ EjEV n+i̳<).j 3"-0_O<=y{Qݬ8`Hyf^i|&UA흝* 1Wgq E󉛖^2/%s} T4zB{Q׬*O+]f2ٹ#pΝƾ:'.~05ɺfa3e0ogs8.>ϟiD7 rEJEAe$6L++@NCzٟ&oF)?v~i {x8r7,?'j|x3Jtyfin͛?.7egh|NM_>H>s #0Ώ@{wчYqml</~%t*,3h -= 痢%F)P!.ǥD4;CXc(B9`Zc ¡]9Fԟ{p\8.Ah_6T^{0W?LduyZz5zÅn?S員*~ 7K2D|)T0| pk@iG8j_yo}chC&ztKP\wGʺ-(] Ŵ됙7\p\8.o ɝ_vONf-9!5{7Aԉ0r`]5Ht#}oqp\8. Džqp\8.{^r֙\Cr_g^Xc^8. Džqp\8.&,\Q5K "+# T*P5Vԁh @;nz=ѓ:Ke2M>S)Td*1¦ ºźݺzjg؉ , P9BEhm=GSȔ?}P3j&>xn><5&T=60=rz̿7Wy!7 FBKfj {ܗ@k2]̇Gb"%cȃ2Q *TmnhJN)TLQ-HmKԵQ Y|T-U@5 >1wgt %A~;J}1obICq"W݆ьY4*Up}Ksg J=wKϻ9<dce] (t>|Aw0Q5-t0QU=u@e m7y.z#w7=fE,R|)$ =~mB͆rh]ڊVQpʳu'NO,aVU]N75+s?H2a\QUE5X_~ȿ:k2  Šy++6R9VJ pՇHq]֮'Qh⍡H&n܎AM%0]}kAKa5k6u;17v6\)ی̸W60ݘ[aGE $(]%hE2x6K,>V\0Nbpʈm#9dLJKm"i$7nP**mvҘC$Hh*1pmmk؍oL=CPP:ԾIBC]4EWUt9!I+v.Ʊ8_X .'RY.^5J!..)GU4ShcI\0IH ںgO}xp! Q Ҏ!KEAǗ2 JCqN:=Յ EWi貝4u@ԖAX5(!_-}]; م \uAlBA! 9j2X* 0+.wv{MwsDGs';؄ r]AmC]$pnB$ZI@mjQ'Td 1Yw?DX"b\bhP >ݤ5 poŠZN ePp[5TQ 7IɃRW PbIXGcu s НquN|ñ˖pde:F݇gF .fe&͌rч'I.@$DDCBftl6{>6g|L#No$H_ K!6!go o?)aa5 {#Y^%W%& _8E~A^&3?%8I%/ I! x nK}D~H> ;#x;Bmr8La &? k HaM%Ú*5J~C5WHe""K {I/x ~DC/`XSpx9ʞ% |S.IR( R1G !0L`vC~ `ŽFһXw$T t('&PFe5* O2 C-_}\Fp@  4h$@@Z5 T[ X  Бnj hC8 > '>!@x@3 O= %/B CBx S\xk&ec`NA#'щg5nS FGIJ푭nJzc+ER-[ҐVgZ ΝUZ\ܹ͝ 7o޼o۷pF7 5G6uBOHYzbm>NGNGE@ @]۹Ʒ՝|+;W:{}=\[ҹ%ݾŐюv_kgۣ }͝kl|{4j}5Lfd[Yqibzb|H3P}72rɏޢIq=OΝ0--J: +_Vd%-I~q9P+|B>.=#Y(m1rfa/F.Hõ~)S◖IJTX քNOMdW/wzE":, 'B e(D)$#Jmyt| {ѣ(.> %'%B}zE30L2RtUMHt:Aе@}p~݀nD7ї-Vt݁D_Fw=@W4|K)oo>oq$\?1!so atuj='nGOgpLzyt~~~ "z D?E?B)?W/_BB_ߢߡ 'fr yGg${./\ -* }D 3̽;8ss1?k̡oL1cO|q;w(Ti;OAL r2F8yz\0WZ(Jz>FQPNQx `*:OPPepګphqcco#}'D>\͎ }NϢ)( U1Yp"H pXZJ~ O2x1 *DMu<}VGO%ԋ( w_XȒ˿iU֕ ;Pkx~N&OR?2AY;56%Rd@;>: tna\\N^~) i&%SJkمLe+nQ^֢JJb,f+d749Ryl% Pb1WMyʞ-زlT]RUz{Ӣ*KSi.Z| uuEi*O&.ӓֺ^n^kYڬJ<Y% }:-HtnF)_X(k5p4`DM c-AhBO /|oG_?(]x۪lHW[e_^~K7I0[rʪBRuRhQwNuO嘔jr8C\q 3ԋ "Q+'fDE(gBDr6ALdhF(rat |TIA'ZPyn(zX&e9QQG~ `SM:)`<#v{8BhZp=NQScX}j Ή1 ĥ J)f4򕠥 ѩ)BiQ߁_XT%\%`rSGzH]޷v}=}kIwu^[eզ ș,ZBefZXcI7gSD-[-lG?2Qc(!tH>S z\~hGsYE.~j)P5V[ ِ~HfZ8Jf) mbj@O )ƃXɅsegl*TѰbK^zy^5 RAOZEG]zJ1_[>/&vK"bEJ'"ӅT)5}ȆPަmDOr]7t55D:@e!tНqXNxÿ4u -i]X, ~ȧӥҫGN@μVD;Ne&Q8la+>*jlߒjIl`QJ0H$\Re( Ag2M6< ҁ-\KĦ0Jl%`,LZlCIm_E*t,eZ \C~j`3o40<,#3oN_ʓ; 3Ύ3TFS.R(6FFyh:Jp#{  sA[:&DM7>Qj0[>@eRZSp^+ uiLH cϡѨgXef!wȲ KO4ˊ >×*OTxH>ݧ-ӂʂtOMKEd0~9x[j\MOzF-<R!ϔB?~EH?e,,>ޢ,-0K59<}W޹?x)iߊ+[l+0w<YG;3OƎ/͝e=_ E:L0F1?*XLBtqE/qNO(HX*7cI^` /6dR%iT}X)}˥eyFGDWM~wʪ qξ㻆w+݃ 1JdKN[/s#64+,Ls)I^,M0 :̇?MI%TVXRnॷk8 hՄՇWIw$Βc)U;58a'Ǐ]Q>s}YU8Û. l 4M+׭l T[R"ь@*j{^uk^S}T-ͦ(uge{ :)2#Ք*1 jWKҷ%waQgl"(}C2#aS° R'&{S;zx[KT?F&+e -2CMFdgfka$&s%I#VژߨtR+եMc~Jy<ZV|6xZ[:JEa b7XEn)ߊ/X!^+EZشwrlyf:X4F1[][Y*j+T_Dzij#Kdؙ*KRh#̣\x_y*?p~; ~u<^Cqz## }ߤpJ8url*;[{CTҐ`-*+뙞Kz $.n>=J=Oż([Կ&:lNO7S_ZN+t[&oؕA#t UY<ɜn\&.̐$yQ|VY]i 9U0"L-FhyӿDrG&dvGcl:;shH~9c} Nh E|`g{k ^4I,j+ΞV_TD|Q':5~qcLk6fMn`5d/qUIIǶp-.b{m VF!R;_}@э'o~ll袮Mn~Wbxښ]A/%6 i43] ;W$?4iER"z$cp13 9?9yc]%?D7_  /Α#!}+5lW_u+d*$>R\-Ń羜_D1FqYqcoKEYi\~W}y`uߴ(59G+:EI+%y^*P"Ê7 }iln[Rx~k4/R\9X+TNd_P듨sԝΑ+H8N="0U+GM<6ȰyWg{Gbwl)T%i&I"kJ]Eڴ׷BqƂ-LNH.+dڢDFAa4ڳ=P-2^!$mVah]1,,Xe`Y(İZ Ǹ[ uLsN)xdIRiC'I`Z~A'(AwPIK{O VB&('+d1?b%7o?G1} i&F2Jq2E̲bb* n5TXt$R8fM?PYA WܣTYZ9-pX)[sqb:EQ+XxI}tVnnR3?jN!`)v2zՙJGFd|bvǟx5Tzc'Ԃ^:<T4JWJFKSKiG%9*!HƜ_y( ްS^ v:lob%ΚF'$rѤSPMӾxו.4H?%===ܮ/\$:5ܳ.<ݺO n(76bXNO&e"si7#+]â vXV5ܣecoo<}mYn"S Ymqncy[3/,#h7RZ0;.{5r8h7Esb<'_>x[PZq[d;NrK_"(/q'r`jKEc!s/įyMq{~-SEǾh  Lb^nGvAmxw %.+Ywݪ?LDj*ǰҔ>+5C?ՒJx`vũ^[C+t|og!go[IC1tEn!;4~$hر-k}Mo?/]T:t?m*̵bGkR6?ťeҳ6|K1ɰ<(fnᏉM[2? 6SlZs RlF,zI$6XFz%6Uaaٳ*I2WXnWEJ1^].G{FЎ QzH$ ް8 vâ-~OdjKlAĈ_PjCI5,VJ“ckGJ<&J؎$y:欻{[z}aXu(+BsjU &*(N!NQ(쁪,Q72嗴K^,ҦKzB@4f2p?ߔdUgj4B)bM8Z m:X[sq/6!7o$bCqz9 0?5,Rją+ˈO`ԅ}u#aY ]2e 1_]SV Dt5M/sٚB+om]"ctުZ:9*'5;gǧUm0ۮSb<F2V22NB5 uAi` ن=,-?Ķφ{s&aw'㓀9bu]@ʍ$iђ;,.ܿ&!7Pi_faO]U mzE#ʒݻ5,n\M8Mf-Dp`8WK!,Qws4~"4~"t[%:B3'j)O¤!d/I"v*yX)%ƠәmoQxٴS * It{ۈb; ^'KU;@~mP; e[GZ5`vQUi-XE`+_Tc$AªHN3h*[!u]U%|磒66c{wVrJb7+\陚6o5mNPB}v&bgeu$m%ӫ`%l̹lu $`]%iɵKXP( Ag۰'Jz%#ݶ̥{z{Wͪe^([74J8{p"Fٲj`ݑ2dxS Իj!2 yIL[Hvr`asm^iZ-UU9+s3 9g,dN\nqZ:bɊ;"N#nE™+Qj\M-5z E\Wg0/\zc{T<₴R,ǮB|Ҍ]9[f UŒCK}P); dh?uhHm݉?h&'ۓQaȗEdIm{d!>)qh +OF O`qόbzlS@Lު. ,j f 9Ynh$0DGڿ019A2]+4&z$Ozs\)ޔp_Wpd]}okJ<EMY}l)23Bdv;O@qs$CP'jF"Xlb dF,fGrJ>J]vq7axjG11ϰypfcK߰Ԛ^`JmVsJ4X \mTn7W"ZB.g*YgrE/2$2#5aHFyq X5"lBXL CeI\ŵ\u*6(]eȼ5 858o L/]Ф/ل;z8&\#ȚR|XppvvM$1bSccl)?L^"s0WAAcq=XWbRP[~KjB5BT|=cc PSvJN㤚Ҫ)ViZW|ZɰfVJr{<2&v~-`󼎌2lA~UJnuTő#Yas t lͻڽjԩ1$Ub`Qεڅʺ:D觑RP?(+@TYѺܓ8_`-$0IfBmu3(kΪo"GSEF'x"YQ>-o (^N_P*;߀VǶzĈ_1\Wֲ< tRe\nfhEwUiM Izʬ~v̔ܯmizK\RdI-<+bzE6_͵Y͛.,^&hkmb´HE;̷ %IYЧsOi= ~iezePwdWg->Kt7x^ )Mwo˖gV[אqCo?HT")#›d kT{Xֻjk|}/}s"6bDVG>}MRduF QZP`:1/U#ΒS`[":;:ԷU|V <([0V懱"ȷ Ay U?d> JF# `5L *J>QoWLJn_K,nl.46I"{Ýy\OkASkWp5 Ù$a$!`Z҅ Kݔq{Gթ2M@oNV=3,|Qc$Y--Z=E֩eKh w.]nAw< hG*TЕ#te8\/T_Ul2uƁej'Kvv:'ybpSrkF!$lhLdù۹1?.r߳f-}FZ*t7]VeiTJӑ?N#b#H6PĆ*"~s1Qw."{d7 b>ow_5pYy;jh[yypuFw'j^Yr7uEg"Mƈ|e[d@1.aos4Bj?@͑H$R%}΍$AjZ6dsƞ~m-y`5Ep*/߀]+ onBQF("5;ӗ"h@BM##'w}2 Ft하˯`PbBkW[+r;-/[7EjlTzRc¯bw5j4q[w'WVH'\C<&wnA=o>ewc6vmk D vǤ|SD*\\%>ԭX"ʼnC$S39DsL1} )92Bt /;S߂Q.M}|hsd]O^uږmqmE~m{`ݵkɈhR L[1 \7V7Vbj8&N~ ԨFw,0)ٗ+b@`"E( KaM{gv%kdIlIdy20Nl 66^$HцK&yM k YG5m$mB#ν3eB>/:p|gν{gν3sG0l6̪It߄$9kN &G9Oίl:(*XP>PˍHV+f  ]Q! k7iBc1'$|PPW}▾i9|_fErƧzc~%lj0[F=_j:NOЙjE#綴4=*]D|-*ƇZʱGM[JSfXKK=0E,.v*'Zn' M3Θ(8sa{ڏGKtB<lM!Mm1ОJczM> a8dhŒj5'Q?[ kXvEX/08&scnۓx e_20gΦlY=hS3.gnS)f/W v罳ZBƶ*sN*-9!a?+ɾݜw {^ؾ?^#m3Tӕ M<ŁO3bX*FZÙssT5l6XTZKmr #5XUbLk8 < R*^OA3[ϕ:;YԂe6T*4ܠ@ g;P {riD*- s'ё}1n|U_5κS'JFt'mY׽5bpU|7OK^ySXS2}!/C  ΛX7e\-+lyC7pN32q/EA / ]]gӕ䢟z]J&<*t 3Z_̊\“?ͦ,qՙ urDTs5^hOLXdthfL̏FQdPO)t4ȡ C[z :i "f l.oOH2uD1_^v#MYRE| r} :O<)wmQ_o*o^;9#oᯑSő L.eY\v XV^LN_9-UA&GJ,&k3}]Z"!|*$sibʉn\v Zʜ뾭+eؚY}s_K<&LyprmGJ\ M%hK_;%Ǽku?H [ J Y|41_є?+qFd h-u?VOo$mb-Zk?F/fjţBKY[X%X&z9O4d=P½O;:?Ӝ<7>V< A%HILeeP\9pe; G 1 'ޯ}>iyE[->oѶy.u^' G85 {[}poEfoMk ͤǯgD$<ʉ44 <q$i@Ifǃꬅ|c.d9.siKhh9+@$=tȍ!h6,n$1`^|| Hګ4f̳! &?ؒ1:H0~tJ_5yv6_erTҩTSmѦ@~^kX"eJp! H*ӻAZ1HYf<]E"u?|) TBn*VL{4d kfB4y\d"FZ7ĥieYXjg}1W(T,%`YSX76*e3Ǣktjl3 bES2JpU"V0XlFSFRiD^W6GpcU|'7.z%+,` çe*K?gCkBRIG%g6mK,SqRqq/ !DI4u>ߧkԆ3 |(K˱}>L Y axքi| @^ K͜zyZax:F}SUyY`6G 4II5PO:X{>@}f„y'=>q΃7WY-DJf1fɚ`ĮdJErs p1^ldœ/60RNk$ZKJ6 Y >(WJS ;[r9F"V>G 7 ΣW:(˞r&>\ށ %RȀ:yHI D0䚧? fFNfU9zk-qc=A"vĎ2OG dF)>G2r2 տZS=s*ܹdkUqrf<6b7⁆S DtӇ$K^y!.G.1 #_+D9?B9ִT׶T%o7c3?hAGЧayRZǃe+(yJmTi4xaڧ/*"; kGv8R1,u*NpqWkF5tT2vlT] $ TJ~H/LNjNH VZ`8%rj\;JlӇVo:7hS,!7shNU &1̎vO7l™RP!U{( &ISHYCvU oG㟧/̥gu7zG4դDɣ ZRҠK鑪GdIށ6U<6g"4\dg %Jj%Cn=7] 4;L/2 ӛ;5^zǎ1'Gjġsb6-~g;@e4]Bׄ3b7Kbw=;}]}W;WUnt_6ό6-8 cQڮƫV߾&R%mf{bͻTΨX==kZfݱpåuvkY;on.bρ%GTT?dy2Rsy SIc#@jn/mKOy!$N~&r ]B=Y5MFH+ K+csWyM7>LZTZ2+b1͈n/{[wmN(&c.pm[fme뾳}o^ERW~~@}o}ҷ,rpmOt9sʛ&}W=7)8l}Wl)y?/x?gU9$"_ٿ7enI>q)2يgr4d_=YAw$3Tw~_ޯ5bgy٩#f.ǮG;LOI&5,:|ᐼN`NAy_y ](cj/kBlnbX.’F,%3d:TbI K*K0\10\!x0 ]@q}%)_yKu۞ݾ yݛ]qN&_5CfFgwZ+Z*3umxۯ*)Zs殎۵4x11::o<` .=]:_+YK+K_LS?M}t4Gy>\(?';`lN_c~o\;^Z2,+ "g1/,ްweAu}+oik$?DgE#ӋM9S#Xi1yn4r\u2;7TyM-J6ݱ]Xkq: AWGz_}_}q^st]݇{˒*[_ZnٝM6v?x_xBOѲomA^ȬDQ$~F:O^S 9ғ&VHUW5\p^a4rVN.)YV΅1; ,բZ2Ogb.LD.=B{$ wuR &1;Rf-*%k 2LH8ÔeVݲ0=LJyhЗstj5YV9ic]y[Ϯ;*|BEjD=P@,F=:u أ=r0^% zEnKJ6j j<1C)Q^$v&*)%$<NmZҽ9Q%ăW^gv#įQ:s-TڄNZW Jġ׭ 6OgOnoTjsJm}_*l)i.^ZHu΂@_7DsBc%ӊgcvό`z"inauf{:3h1y_cҙ[{(,0Vg\#L!բz(0mǰ S' wF~S}Z= e]`c76.Vr_MQP7~7Ω^všMiٱޯ7ꀡi)Z\zՕJ^ʱ\~TQi+ h5޶._fܫ[qY#'3 .7nDv\z@י?KDn߷ySH7{&FR'4CTdܐ_d~)Uv&93^M|ۤO"K&?iN%K)ԇB4XGW >G DUB^5h[U/P$;&)# {ѴV)y|kp$HAHEWϥcF,Ƣ7(8J'@I!鑏Y;T.HVz B 2+͝e?ݟHN$>U_V, 7FʂWU,ٓMo6S)Rg4Ǽ-M p]T8oFTQ\_hgjj3~\qNzႀQFU5ТD@1U-=FuǘlU1p|+[곍EdW3zΫ/Is"b}_eW.ڱƫ_P%+/cut\znJ2ܼBar -}}װۂ-H(=cx/adA 1 />YK~ZdMgnut{|Mgn;U5Sz斯5x7?pC=-xC9>$Sܕ:R Ю#3._*'%z?˷{!V,Я; hh j"11[4FpDä.&-"aҊa5G$o. iES{T3eͶwXn q7\D 3jyjNKaxMnNϷ9;:YEblugۚ϶ƸZyhw,/A6QQ2'K*rL_dQG'G7e8 _zla*6̞$\1Pą < h~IqZ?xgfZ"unZW>x{SG+Y(=rPI틅}16e _d `w3Z({B%0^* 2y~ :871`o 旖b(_n9|Mwm9~L~ 7y5sȜ@m3GO]/nW?ÛBob3aqW 0(@/,*a:(t#WN av&8+Z px&2}քl',A\dUEj,Y5(=i; Ledʏ~N&9@/^НZTE!Uc +#-&iy+Nwz7K8Դo u%TMbB+!BKM4~Ak=3I:JO<1/o/=5$QtL&ix2Ǟ1XMWUK;cQid-uo*u7J IhLK1a`X~'M| I~-c~Q~tg481#I?`ye`ܣiSh?g~b_n\aS=dI^Da2W%B"kR@{bȏ#-r MkɊaf%I(eR{q{O6]6k`2Y& ߿Ai34ΚV߸%ђVTqE<6UYY]S)7ΫL4H߭͵Zԑr\Vkwtp\F'b>P%w*ntǕgc0'/޶USZ(ΏN7LojҸft˳XmRa\VLJ\mP U6/*0"bV(G AZOPFRo373LC}@T7sZOwXb`[9&~ϞkeiMM;WV_3rnd4Ŧ/֙MS/79:PuL _/L Ĺ+zPf&K'D F9b'- qHa,zx=0KD E4 t#3xbjg~$KU-ER&-jfu$.9'$"fnQ:pV,hf"Ǯ7/'ׯkznsچY _-aLn ]'~ WQ+EBk9B%V)/rm<嵥_ik\6bT"N^H.IĎ$ 'XiڎB2 ANRz]$?.bR|0p2ú|7Imz Ybњ+OEBS@NIGbLO~S_Ӭ~}^^{g\=kV4wCebŁpfP(UC4d&`xvVl*? L-YKs]sm`JBc5r٦V<ҋB[CR*FDj\}ӎqQ|0z2DEcod Yk+p vcvki=ȍ-/*b[chҘh>4 A!u-cJe029g-49hٲzopPUIcm>\ QU,vATe%{b1 {-4$23=lErzh{= 3|$3#D$Vf^bY~2s| KZ.l1oeI9:~:}\GMo6k}B(2S4Hc ~I.GUܮeDG#Z\z8$=-xZ5¤~1q>&$EyT$7o(}I$D)MyeG*i'z.UJ'N/+ f,1ljԣ?ogS Ӏ3bD_\-/Z N'+U3'yoz$2wz4gZ3L_7ǿ[gb0 ?|4@~/0V? 5msWU*-*\^pum쥳KF`8+s~3W2gٜ5u.R+F0X ŞPjICՒ*LK:h&2/Qc|"X)f $v#(Avȟ<$[$_}oSoNurXΐ.Ko<ئ]yAeǸ9UfեJa,1r;ּZ:r iNj58Z2Pg .R:tehElZ"d*_@c2 x}U7[`M&ߕF:]d|~OV%^"Qj>hᗑYz3"1L~qTMT*#y~TfK&F^#gN:<+,%/r/ƊWέ[5}~undk[UȬ[QdHfg77ҹHk?.IKfIg6u~T}cDgJYy)bZvY.ٷlزZwgY -Qj\#\ h,$5dNQqu\4I0V#҉u9~j=,"5Y٢';^mN6z1z=,"Nd9tn@C^iG\ǐYkfªDԜ_ ^ =;w~,tj NqB/ŖN mpwjrr4XjvVoxM}mqj xu-H Z7*~52]iOu*-+k[uW;uFE ƃ=HHè^.)D#S%b~Z& ]!+~Ϋ2!W>ī8$A N"W::V\pQj~rWlH$F 7hKK#eIo'I35K޸% |A\S"&Da:]6My]F^Γ)8|FiK5ht$Ig v{'3/P*R֜M5 * ,w:X]Xy,񂩞 j P%\reIBBZ&T*6jWF4O+u`爪`<_B(+-?-ΐ3}`ߠһzFh.Gy&%?fsk~7}\RE%~襥/-s=9}N9}N9}N1B/!G%DRoJx +(oOH |0}H.GpRooO@!8Dy8協7QJx x{\ P< +[(_AZLkI~l#3*`Y!Ô)o4>z։YtgQz僩(G_G RB צ> \J6_m;) a7RDy' QP?0sGP-E1%)ux +(oO] |Zy %4a7RDԯH=u~m&(5Ԅ@cMЂC-4O B<-4O ͳ oO}h{h,p)ԯe.!Ô)o4^2쁺APYD ;hnAqZ8_kh-{CR?NJ ׂ@V(:K)צ;S󁷤zwBjV&|+;hz{SQONK}R_Z?5@/,WP6uHxp)ZrHmNe$iCo|g߁F{( 2 $}4J8H<Qb?q$-RC: O"1 -RA:EIž--%RdHL|/H|GT|PHEԴ5)_I4&-f6)gi[,}D iYAhbH i i)ʮ2TiٳBZOzӼ4g>OzӼ4g>OzӼ4g>!F(JP9.^azQ'D n4 R6( GP7-}FD#; Vs y.E( [o3=Ɵ6H B]$8;`<g )W(urunK$ P,)NC0zF?Mp#E:kr)7ÞZ+_&9%b6/;4ƉT= [`=x񵸩\Th  xԛ`;L!5Zv!MZA'v@5vC}4<uP [hkڨޞIּ$i_?Ӎ1at UAV49q&'[ Z'iS]R z_&7f 6CjO͐c= R=@vZ^#=?H#@(i?\_X(=*7PhjXRIoʔb-g;m* Uh]sښ#|j:'h]i?R6ɻZp=cw8rj4@Xxϛvgx;c?kD&Q!jyCvL9$g75BSbOD4W0m>44ZR۵ws=mws^صa{a@G֎u]w{mwu;zu nt pmnڼa Y;z;كΎwG[kX?Pi ַA3=En臜w_/MĆһ{7A$S]N `A8kSG- {6ow܃m6ĶPJ{샽h+EԼ~c[?Ψ:]{jowRP qWb;z7,DvZ# 6wu  }Ցȶm==2wC[$o"Vr:rvA[tt vmbXGT&6vߘu.ڼ{Nݵw uCDk}]a=<v M*pw#'M9(󖓩L*@ j%x{ݽmٕm`tLC}C];H},mA[" 67,PʂnFWaQ9 i*F"]|O$ (0Ϛ_"Ygͯ?k~H~Ϛ?'<2$h4FlP9D CS*4 5Q -C߅+Aۗ3b`#Wܔ~M;vx??޿v4Q[KJ xw/>xxˀ-!=e(= xx xxз$d 3N/ޯCyԎa̅cw>x ˀ~{ >x x_nCoeN&xE* n7ޯރ(= x7GVgl%{xOƫx ȧR3׺DF8 x5 xOQ3*}FW2x ;!{> x? xx?d]ƪ嬍g=݀ }m`b6^x$+Oƫ7Vew# ~ > x_o&,G-О _c,kl;d*l xm1{ =x)Ul.>ʆ ox{"ޟo ܱ\dҔLj:I`("i$GG(d3/>n@$H ;{…gd"$ 2'vO /K=M;R$QzVeeq,= Ö{H(5< r$S&TIH"`>{vӂ6@賤F}tdL侳a(%E[/T+8{otr QīD8+KF]JdH"e%g !}HX$OE==/"^(=oz8y!:zlH$! H~5:znll݀,$- cAe)>nXMX&lLX&sY)6vZfVOLx\D2hokPh, NJسLP*;ȁAND+&[''FQ1X>Hh7M}6F$%zs! e6\ʋR1^4:>z(mc;,A\1V)8K orcrES%GI?㽃p4ʱTmcbc|5DR 6Ojo_i|Y<1$lJH8͹ykGKvc@qRj1#"E"1R>DqF-KdΜGKzB 1r9˕ D.mwQ 9L'2,';8tq]}œ5nd;ys/{tr ^%Uaⷻ@gN@~.0xU b]p+SQF/P I,O!e=;r ;!9y=ccõÖ%8qd )VpDhHӋ0=&Vzl+o<14b|7K']G}.h{e=&k4uR Vdu!ڇT/Ne!JT(r}'ϑ3I'AV]m^}H"H;Т[iÀBMIk/\\FB@,+!by҉ѐt/0= ^4.YBQ2I7cɤR9w*Q_HwV)ŭ7A8E%F/*en +|>P$Q ̘ 0J"6$dfGv ^"d-tzDNME*݅^8Z2;>Pa||?x -u=rPY~e,%X$^+g&9GUO*kGD`;H'TȐ"ZrP69m7!~@<)4Ó7~9Mx<:~PV&)t%&$tJ%ٝrT2 Q"]fZ$j tפQًE^@. H-= jU|$~"@EY]TLJEi.J$0 .G ouvN$*JD• sJR*HuzQ W"ҝ)+irP[L"Ĥ离.킲[=CsB]D)x3t]:KP+uj/BM.gC9+U!кz\X3'[O?q~<=Bii"kTD9}R ߫O*pk]@Q랁~] J\VǶQ'"DZL|ξ:u^#@k9C%*9_/Z;#NE^;)*bB}UIhaqwP-jN@^MF'IguQ:L|bJ<㔘\OGh3ב'π$e@RJkpߙԵGfGf wjieQ8# A_֯j8S4-E3ޝrx!mu7-ui52\\Gu!T gDh*0ѫ6??y>y'&M^YiY46g#VM͌]?4~N3~f?{g1}aakt?]O3p_g4NV^뿍c Xq=/=FҤ0|A _/ώMiؿE௾7E]c>}uo~wKw+bw[xy0rwߦjc$Ɠ=/!uJd)G:mmqĜf^/ -TGMmcM}qTn{8%#~L8Y+hpBMBR,LsRtm,[tv$EȶO@B [{lo&ln8uіel567ta8&dKbƱ흆8 ۾?[mM5k|^d[xѶؾӭyE mПn)Pd6;Sn5}.cIH~z?ZOmӟXkh雧2#m%3[1sWgf9f,VwҸ3oQ$5Ē2~]:S|OtviMsnmk z4mboeD#O#{"oADڥ k->z6Ό?l[ET"N3"qU֞WO?jDe#y%81}-w1ZO?blӿ.儵z~Hܟw>pwB?^/= G{"PCؑH ԭ6B| 7M8~e5ih@eԋs'#Ϡr(93Or?̂LIt kad^Mhq}o a8m"ṵ̋G.$nnB=iuv?viWةֱ.֐ь_nFhFvhd 0.d^)}fd{3*s:F]rGzMKg[׽z%am eGJئGFwA6i8oTM]Jᨑ~j،V&w?Qu;Bݢo]S,CK5kixݕiQp7zg?7suW~j78aczY8Yƻ^C#Q&̨6cӯJ>ܫOe*t6FCyO޲Q)z[ ^:hϋ tCߠ Y(9`|{ʯ>(}sBg"[n6GŃ?.LcDk35Wx߈Qεε6=?Wi"4J|7ΏF[ɴg:]3zJWOn"Yq\՟Xm0 &.nh'O$HS ^ w#^0f\( ̇Wa,u <~u=Hh`4 +x>,0^LPg19:W6+z8,ͅpG G$F5'0Gy]gKҙ}wr#my&s0Ez,6e˲5hnFDk*<adlhd] K]X/+ gAJ4~0E4WC47|7_یWƷw4kx`%m$6oKԇMwk7߮oMʝjlY1JѴ?\Xwc:1"ZJOZ@+}iodN>Zk1ҿZWm$FK;cig0팤0m5۸3^=ӿ%=ˠjnUn-N3o|m0XbZ̕~1^W`> `!~Y'wpp {8 p Y/ (P d8 ?B<*IjC ,9t-/+)&&#*zՑWVGOaa7(78(ur ΀* A8 TBA2g뭲z' p`"/7y XIr=^g:ן:YY!YYKI(ld-G? Yd @ҶZlg s(qO`/Ed ȔWN^x[=$ G<ӅgL3]x t.<Ӆg8ViuxZVE~<&DŽ0yy^3QxL>.k\x q5.ƅ׸^k\x q5.,ƒa,Ɗ.raj.Ra,*.B:TC:TC:TE(F0*P1.Tt˘-{1-޷ɽN^4Q6' }&ݎS Nt'IyAt'IyAt'<%%s8s8s8sÜfV3gj9[̜-f3g؛hHbV0O _}LtUbL$!:ȝr w:ȝr w:ȝr w:bb1s8s9w9w9WLs7A^s0Wmr[KJ1́5Nq|/&:ReMI~1Tp1Tp1Tp1Tp11wQ ӿMȨuGLI3t+tkZd=zB/ zC 7C?npw0]p7 p {a(%KMk`-:X> clO` | *)5Iae-Y #QмGV·a? +,rSQM4(OYjYjA;o ,G6Vb@,\Ob S+d5NVYCWB'2UD ]jyߝs}6}'y*Z3D 1`XxH;4.,n ͠9Dh C+?Gv:@G:ѧdp7ح0h'9= caL0fl]CHz7~TrZ1st0jRB4Ā b!I14M4-ֲB;h#\ *H"t.p5tnp \ ݡ7BO7Ao}fdzv0a {` C!E}p?<2/0F 2fl/\/+0^VŲִ› X o3Zxޅuރ! > !|lhʆo>-)|VX. {[{DQ$@ #$w5D<3L3D<3L3D<3L3oO` | vȁ\<vn8(f' QM4(, DE^UgY-ll@4 XqX>}g }-rK Xsl;sZ诅~Z'/`ksᅢCP B QYK X~o,>=k?-ؖ rh\_ Uj3YnMV;4BZ%\ a6:Q^IX2ЃȀG+"!Z3D 1`XxH;4.E7fZ@"_M?g4nt+8}5t%"vkx}z^'8݃7BOGfWrY==ɹi 〕n4ue 0΄Y0<<:*Z o> q]5!cLMFL؉RLsDYZH;RK-пШv^8>sOPKQ]!uɔ\'J)}-Ge0 䦢RQxmHWa,ux2a,%ބeVJX-Xkmxޅuރ!Kz㮖^Ӱ2հ>?DCJo!v Iecg2ז/xYү|OW>ʧ_+~X  7/HxizRJOJk=Yt|Fƻ4KwޕһRzWJJL:I2X&ˤct,eұL:I2X&ˤct,eұL:I2X&ˤct,eұL:I2X&ˤct(ER(ER(ER(ER,.nGTTHP!{R-F?k]u}d =Wk#Tlu[V!#Pcj@15RQ#5RQ#5RQ#5RQ#5RQ#5RQ#5RQ#5RQ#5RQ#5RQ#5RQ#5RQ#5RQ#5RQ#5RQ#5F#Pcj@15R_qgF<`MsaFϧhS6`Gߏ61OS)/`0_@? G(~ЏQ\җƻJM'֍%΍#=a,2>8f3f=/Jot3ă9̅y2Xbc,1Kl%6cXbc,q1K\%.cXbB g2>b3Njn*bn1s{{{{{{{{{{{{{{{{1kg<¢Lx \o럱s2O53W(S9a?"bM-U_-^ h m-0')x8xó0a"LɐSž)>N񜣧^e 2L26pt*̀Y2K0O\"w(n(K`) >Ʒ/V!`(!l q `Fe C HpPCC 54PCC pl 7C?npw0]p7aO< ca<Y0&dH)/TȀir09'Q˕_'OjD VaETD q\@吢Wi&@ ad&!~CBP?!~CBP?!~CBP?`0R`'Ix 0,Lyh! nuCBP7$QL|xpv)j&G<4ӽ\Dk/Z{iXb&wΒgxY<,Xp;L"byppptؐQ6:`6:`C3`^h›@lso/%أ{`Q=JG (%أ{`Q=JG (%أ{`Q=JG (AA? QЏ~(l1|l1|l1|l1|lb!/b!/b!/b!/b!/b!/b!/b!/b!/b!/b!/9>HUzRx!z-#PKD1< O09c3F?c3F?c3F?c3F?c01qosόo&vOƞש^!{Q.r*3jgg:r^(\w Ļxw|(@P>|(@P>|(@P>| }A/ x_TbJ,Se*L%2XTbJ,Se*L%2XTbJ,Se*L%2j\XhB55Rxm]h~A$VsE2-3"JijYeZeZe6=7(҅.tu ]]BWՅ.tu ]]BWՅ.tu ]]BWՅO >ħT SA|*e^e^e^e^^^^^^^^^^^^ƺggDن'=7.|+WJ\߫T&Ϩʏ)?$Z1J E Koi^;E`".(MrX5jy'T+D9 yV#OťJ2? >=5P#x",n&̂{co@&މ{c`%񞸵%qi"} qsogϘ 8=w?x} JBy"!B3hm#9_eyLrX S zաQTUEcCգZGQ(jPӏ~%X*j`OQ<'Q( PЇ'Q;O=(AA D(AA E QOC= (bJi(T(G)?JQʏR~(u4I򠔆RJi(MrM~R{_Ph3)$lR.7cGgUn"רqUZ^)Q<|.W'W1O?7ݑXF*W+ZpтD1]TN-ѝ;NcUȈ$w <*]< O‹E!gWExQ9^QWxD !!7 P'T UxBr,VłX_&:җxƛE]}{iK޸ռGh+u?Ee~l~Eu*xqE[$L\r>FjZ8`m9GP 2A?`SUrJNU;ȹjG'3tou7wӛs^=s^>pM*5T"gLDLQqM-_o-mo(rܸ쿃b<;$ʹB~%-`v9,bXd%mMF3<K u:Xvfx=3^l~/M]ccq{>V/c^+SF?'N^9X.֟|Ew@uho!㇛XKw21oLgOgAu%TɩĤB"ccRDZ_WyDg/&P@[f- ~Dej#h M!#֑xHrjKNsxDmǾ=tC!xL﯂$9vuWUbMXmVۄ's'7 }dڗOf2+F򺿜xxzxf4uhyXy8ny?+rYq~p4] a^,ĝZ^ \>GTHxU7 8Y C#7&pG}i$BKZ\ۆmh1",(-~< ?_4:[ǿrSr3j8j8j8Q`jxyvޥi?P5*$N"=ͬYG 1cΌ=ͬk_ܣԸO<2Xl,BH /uG.wwwÛ_+y VZ}}܈o7^|odFr#NkWFvH%ِ d}d]FËS{{($; z߃T=ψ'PH]([ohFn&#9l1Q8RYsD\|{>""^"^TzDDDDD($%%%#ŊbbD\">"DVNDbS1)Kt%:}OT*&*rJDb>S@d)$b,T@t9At9A9A($Z葡PHd(Ra,upPcB,Uˌˌˌˌˌˌe2ۋbf{.ٮBfy!Y^:X{Zq,ČJeF-gF-gF}55uv݀]70[|5]i66fF!l-zLJxr|9Cx^)/˗5蕍Nxs ZeUxu zـ>g6{Cxr<1o`+xl5#wUZoEKF]1#;N02/O1l?Wg~zwU zt7Az7' z^ ц'U0OZ_Qh<٪>SӪxТVEO<'EOU<B^ӋY#k!F}'k}7fÛ}mA~6lŻJ3sPK$DUu#UՍn+N=6V+i7GTCAMtmَuVW 5A3qgD~2+A3r+A3X }ȡ6 KDy kҎ;]301zM4g"y}:\TJ_~ҏRPʳ3<[1{yx1UsgiCFs/Z?'o3~S͈3*IHldĹ@Jx%y+3TTȧggÕȧgOs{ 4V{+ɽ}XIޭ*"2"V+}"JЌOp{2EGX#ShjMun烧+nŝĿL6u箌q})מD#AzU@4OH*Q$#0E 'W-O? @zw 4 뻅ۆۈmSłbA5W+H Rc U}:'H R|ƓC'eO8{ݎcW꟨~W~W~5Thx kа Ѱ a 8a9q4 A|@FLFLFL(yDwkNNNNNs,4OpP3uLf4ӦY|f%XV溕ne[A5( ` Sa:fE#+YȊF̧g}.`E6666Z!sʘ99̻͊kj$ ,`hFkwND#k5||>_׉ ?ywI%8%W`XtƢ;,;Ϣ1VĪX5fb[\'E7[.F[P0B+7)K30^D6A}XJ6A>t ZEdYh;ӼQ$^[:??#4< 0 ^0f,{//ߣgx{&f7M b̼3 e e e^ThmQ߲4ˠt,]_E7b*JG%#J%ӈiiVZca<Y鿫aLQɁDӁDӁDӁDӁDSF4MmDSF4MmDSFw]/yKw]/yKw]/W#j_5FȿW#j_5~Q?T@p4ٷٷٷٷٷRӻnjz75MM簾wSӻnjz75MM簾wSӻnjz75MM簾wSӻnjz75MM簾wSӻnjz75MM簾wRDitd"'I&rd"'I&rd"'I&rd"'I&rd"'I&rd"'I&r%rXKd-N;YKd-Z"Dk9tpHbvXY̮!4dd1d1F6{X10V8)266̦K'dK!<9_=$d9YGGe).;EgDYNd9;YNd9;YNd9;JG%QI}T>*iJG%QI+f^-XkmxޕɜɜYwaݕCEmdQYFEmdQYFEmdQYFQgjԙuFQgjԙuFQgjԙuFA-/ 3%3%3d%ܬܬܬܬܬܬ<<|;NgS٩T|v*>;NgS٩T|v*>;NgS٩T|v*>;agk*2(1Ҕ ģEi%nSƊ!uuBjCzjt嬥~buFEY_&i[#HBidwEDb)76h􉕼z|\dģ\Gз\Jtrz~ru6W?D3ch$]G6J !+]r\}j֣kd:F',m:FTB~5m5ij92iPMfAD 1`: ʾNb |xBx ^L.դP`(!l ȓ&pKLD,1KLD0;LD0;LS' Rdims4f, s% exëX曖RxrX+er\[`[ B,CއUYۂ% p7jt?{sjm&ޭR]Uƪ~sT7ftst}9~V6o7Xs<.Mn0OtxBLa:̀0 mԶfj[3Lmk5SۚmԶfj[3Lmk5SۚmԶfj[6Yh9 _Wvא. s!"pQpC1c  %Jf[ :@Sd,Ugxx,x, Ƕg9s<rKn |Р P# `FZ|k"ˡN $ s` Vk6 *Y}59ױz̏~c Wq|5k d~13bW1qa<i|1mw|1mo@&,@mKMXaUނ5ކw1zxއ, vt{`0ءE>v:̀0 fx r0}j(ylF| 爥PĪ$~X?k5gYc~X?k5gYc~X?k5gYc~X?k5gYc~X?k5gYӿ̴WzXYYYYY~:֝֝֝%K6ʔPjdMy; 5\6klp٬5ƚIcͤfX3i4H٬Yd&f Bc::o"=֫oտ TNjk'IQjԿFQjԿFQjԿFQjԿFQjԫ~U?FC:TSwjԛ?!=ԘPc~@M顦͐q3a,wȊ @[n:-7ש1];EGk}SM]*)`c]XgmoWdtbSrF0 [{rϲyRۍgnL$WXS}p?<cE277}fcf'W3ik|'2>4iMq4lM,4AV<Po|_LK?Vi&{5 m𡛅{ü;_Q ~-yWʻ<ǻ*a(!l q c~_ q( pu"W&re"Wj\Q-SDQj(c÷OLgOQD\7텈ܡmqTf f fffff2ᴒܥbgSYa2} 8=;΅xNK[ύ<쌢KiO-Z"E#5u wVU憾3qB5)NÏpNtP-2e,+I.wӱ <}%3:9,?3vDe9X$#f6׃֑0+! JxJ~Z ӷzGM7X m|=m'߉2>v;ܑ1eF_u5r0AB$,uՇu*Gl!.1d|PwP.="Q'O0 I_\0>UʉśEF 鳌ga<S v"/MZFZNɟ鹆z]Sws?ifHZRʝ軾nXm+$?iO,t$L0fLZn_:"CGĨ w9e_r -gI>iYnu^tj$Do0^ < 93Q2l5}Ȧ"W%FJW&}oQ,c(?3l{ba7"vZ[vK.Mj}}Q9{bc7v9~Qrsl."M:sEZH<ě[C^zŲ[s]k5=uຎ\w%u⺫VjvXTeTTT{dc%Rӣ5c.zHQB54\5w/W1:?.n˅w)p7!DoqšN C/AW<-^D$9bf[" X*ܬ9>]tr26uGMptQniFFJӣ144AԘVZ[lMkژakkhdjgtANI6uWz(=M7*ަJ?Sve.eVe2t2Lt2ti2ZmG;ӕS'Gτ/ē+bxVxC4$&lDIHdJͤH?R%#EKAxOJޗ>H]CaSXJz HRtO8. ' i4P8)%-|)F 1D[&ٱ\)_4IR.J.͖-riLZ%#b]zWl+>%C!dG1[/Ny^|RP),E>*&,Ǥtq))22Wco:(oxttDtxxTg6}#~nxttVbUg%BH$+1J)f?H;}R(J4A<()+K#J<<&e++e<<+*Q"))jeTl*fFyK!MUv)H(*{Y>e4[9| =|PTIOLNZvRjz_/WMCڧQIHՑHcu':F/U'i 5K͒NKէJWeYRausչr:O'RO1"9V}N}ESPߒQ$@nI$jZgyM^Nג$9SIKdm6DkCK-hjyڟ?^m!kN-G.|O.Jٯ\UkS Am\==,OjZy6[{R~PD~D{N{N~T[-giuWci<' `&?&aj* O~*YXS\곔Nl}rP_$eUJ?%eG55eESߦTw뻕1}rO@Tӊ[?S|y SJ,ET٢(0EDXK2kS[YNNʓ2K2RnTXRZ<,}nWߋJnsp,͘IK &g8cuiBGg>Kq PӗиguL߿M~^ u~bx'GYҏ]lvmº_ß{2R.~GH?gP9K!~ >Ez3?>Ʒ?7B}|%fk\ zGjGHnv\W1=>y <&cn2SY{ ]nF90O3^vy˨<К#rX=:_n|IZCKc/Kc} o ic>TKj7qE : +E ܋:r/J̽(a&i&aif~M׬8BZ iZ'dhZ;![]-ص~- $!R} "B!E_xQL{,=BeGIa#= _9>A9s/|9ps|߅Ӝ r.YEJTg0;d7ٍ &8 ~$[`Qbi9XBVֱ0*lLeml7 G,X~feCcڱOؗ5uXڳ7;#}yes8KR'a6!a:Yg$}-bď`mRcR[$KmMB4D5 *BZjUqY " eWK;SkDk~ c&GO"Op k+-׳f79/O oGvGvGvGvEՁ,\] FܩމPww1M#d8ރqF$dhbکcX3u:%1~iNGZ6Յ29j.r<&nՃxU/Z +Bb%j ʗbYh u(SN~a6|93ՙBɯկ^G77i[F=Ϫg9k~~Wϣ,8 @G#h4p8H5tVD&Lh&LCX&S0=:I_X #B?fQ̢яhl=eOOY9'(ʜOWWHҿfzeO ϱpnV ւ#lME̬%2Z 'ZsDc@X68\Ţ,,B{K;Z:|%iwy2?mYZXAZͿXZrd,# J=BXF>[rep{{'Va"J'E$ #&kECך/\h&4c0FmtSȅv ni4`==L$dԀḯ!аx\7#`sBH;;f%k&ɒ̚4͒EHc1tt?kKG/!4Ti"mDO;T9Fxך%+9@$5v'42DXJ[9$^^}(Q%XXkX v =QIj4G4-,hnՍDXj!!9@2XP M%DtzHn*[xjZ&Ʃq $)µQaP]$BMN"Stk親ב~CMCZZKµ0µhµVk1k կԯP[KBVnCv(&k&0)Gs!E"s 3ˀ>fs9JO009Ф<%iF ҧoq#FEH P9E E$)"-,PcD K[K[_FG #F4# hx m>my< D&vf8ӷFq MczGy y{g" `^ mZV?~c~VCvhmi~^YCl6\9Y3^.?C=if'.͕OG!K>dW ^4XMz[6Ӻxܘe ]ӝ-W4ޏ&O!Mlnѣ'M*7X?c?>?\{ 5R.گק?V~-"h?t7/Gic#c/h=~2} З@Tdy}3ǧ G7 > 0>2zF_kt+x琉lcbxf`lNu4o:k}θG[Fo-t xq3e_ :7dB ~Tz|LEoi5m3̼76˟:?#e` #Oh_XO.ߏ_s+Yi/~>lo۟&- s&L#Bh0 >)`~2deWЯu/[ Жۍ׫F:d6$`~ }n1˽)iCM:?/0\xn[ˏ2^_ j~v6Yw7O!?S?=c箠]W>1O/\H-nٝǽ|D6M{0$o^зQM;%-v^x[=]П&UZHM~|m Ҕ{kCЃs/Sc݃?%Oo#-\岿+ӀtK]Rxg<} |5Jƻq`}! >wOӍ[g5מײ8(fbdMѾN7|F8=~o,K߻/4>ͧ7BϪwzb7F[\6^2\<Ӣyd1 zcCwҔ7^46Mdʰ׉ q&R|K|}%[N;zq{ط.Y)Bdx\ fP\ FqLR HX@R/`X@VA") P it% !by^c<>0MB)ZQz'#xyGyGxP#Q>oxľ<8GxI<_cbhµpXkE%Z%i1ZkѯڊA爕<~XSZAEGΣ(:ڭڭ## yDYQG\Mզզk%Lo<#.uĕ<_tėx,q #c鈯X::KG|X:↰aqANȺ p]77OZ C' 0;0%B5!5hs*P5PaS)'>ډˁ "_D^*p-rG8򿡷:0-at[h%H ՄRwRǰkRkYb-jD5ЉҵfqFd)[on'C84p9;mm6V`zKr53E~D ?.a' k)/g,kc=z9a`}MMY7>1f;*f1kzɦ2fy>r0|`|@Sӧ,gL07}}0}NN|F6}͢Mzv7ii[ӷH1A,K6}g-WD\%+&C*+ W3(J8]YbQ,&ŪXQskF)-Q7FiJ)mrhZIDkkYK)1YtaUWGJwC2={r3yQdA }̤ܪ܎ALUP@VqPC()%{ e2'뫸7Qf%_n(E)EJz[X?)WB@ W*ZT}ͬ5YW͏JR˺ 8Q c_yRyV)p( Qyd=,S^2r}AY+WW*j}Iy k(%_S6`F֓Ky %*[/٦2;.ez[yܣaʻʻePr}|(1L TFzgr|u mUjڂVVƱԶj; l[MTeuF9]Mjw;Z@ɞjOA[$'KJU"ffC*p®pZs b9kA欅ZkVh֓vXK:gh&p'h.-e`P `0(h\+G:6͠ì6SZ4;8l<9ړHU+D[r:-|}2:+:u?LX+x ƃ1,",izEEa-ZxuS^O`OB:]OG =e2LOFڦYGݡ;PƩP&W<ڂ#@/@>t^ ]6zgr=S)(YWb5ș@`oK^ > ef돣s9h }.OO<}OO|l}Zu X"|pE/}7KQ99l}AzwvR_WaKv9 LLu}#K7̛fvO(E߂lF}'D{={QfHz_~X'2Y[kcb`-%0ve22[n~Qx"^V_%ڟ_vg2Wk3b2+Y N!Jq!2XEFq8Qpqh__`׊kh;5r^)D;`)C@) NxX9@X8m)Ds<*DX4 I<+CGϋkKq"I$"ͣE$H&Ʉ4юbFt¥p4oJ11Hq缹 +RgHo`=oDԛunJLLtt L+q{C }qĞoo 8rsĕ[W%W \y#)occI$ E)EEJ( bҽ7ĘUb*qhaa#OqKw4ďcLL9ڄF XT0`J78mn&6mbUbbos튭sۈ+IJJRz$笷[ rSJvw4$E%qh15ct0ׇXq/ls~K2_LRY&lM̲XYn\)&6GYB-)S Nu_lM̲1>&&S'sfٚe/b}YުTv/L"~ه/UWV,8q$r8E̲71˻yL28epVHs6y3~j{jv q[SK?1~ %y+1МA yzz Vtbx+:[)ފI!oDVLuΣ(NQWQԕ2+(ꊉ(ꊉu%IhuE+(ꊉu$ꊉuDQW"(J+b+:E]i$ꊉue(E]1QS+&b+:E]1QԕM(NQWLuE+&b+:E]1QԕueE]+)r'E]JQWZQE]DQWPԕM(J+b 5G,?%kiױ^Z+KZOzj7^ZohܪZAЃ;P. p7>ڟ?!7kITCB6r\塖GZ ~Bo ZS,$ h' ?!Y{L>DBii<=soV-E-3ўמGE;B 譝β~?$iaK"w9̌CrX(Ͻ[ɋO^ĀhbP5|^Ek֎/b$kFC3 Y x-cc3<5gmfv]nGرR+E؉;aJvc&1|H=oxZ E^O:&/qȗҳtО<98v9`^݋3tԋ"e`OO~4<oZFy'\?'\? OhOBG@?? =C Bwxː]OBwzp< g"뢯W~B7}z}=np=7o0Lߪ [ۑ=.}Jr>ߠ'|xmC^?~ЃnG:,{ʱ ! ![ !C;>Aqs:}3P6Um<mhH$-xS ɡu&6T[C!# ! i &bHɺ2q-N{VRB@5 ְe~Pʻ.5^)C6MVȎ&=riW .{B[]\c]۹@wr /kOU0>-[4(.[:k,toWfRx#PbB?lE0Ŏܤ}]UУ\ӡǺjVZ3֍q*8!5:5ZT?1lk)ϵYe']I#ʵzk;tk7>Ћ LX:R>x\Vl߄Վe/v,;8az4S/s);2~c} ]8/k&VscHNh躜89T9[yeS9Ie󡜈dhyNm&v7y~y=~sj~3O& Bzc?"[P#I9sAI =4Ei/{;RGW\+rwqʟSCzFc:;g?q TWFY6Ő'}3NjzA>]4kUd/\sONaN\4 \44OG[(Ȳ}R!;c&]P XTݭ:?ת>Mq&GLN.ݿh&7ytIW:htvfhW6hoN8^⢽zJ\@ZJwg/6)}5EgxN`~Hu{S8'*:٨y~҃ q],6kˊ+B/nS6ykqk0H=5ڌPΞ DtϚ_CĦq*#]}n!H8s'-NzTcDXSũg3smb.[.%i/H9smFC:ʿg8Y_fK(N1ݹx,?ֽx~UQ_Zt g%tM9glտ* gG̔RL l9{^IzM~z|v4ߑйʿ' Yn)Kk'*I"׿?eIБàcrG|%s '!7|yrsӡRV97N\jb\єm(? zpn)ANk[S68wOlvE߆V4ꑹpf_aܙ囃mSSrgרsBr@..]]"wCr7D;g&?1ΓܝWA?:y.Ԕw&.=y\q}zd* 6/ zC^,vR:Q{̥唓.k>q[^F޼zJ+<2+@^oy;&v1 iCU~lb=8ɉƂpnP&楖N2y ~σ1-*]V+3Q@KkR^?"T%o?1g^?@TZ9;@lZe-4hcv: [?-o54CKڨum#M:5oqj:/'qbP?6x5uA|QmdF6x?@8ϖRcNnh I@[z>%iy4G޾@4w@4_9͟wliZU^]يyP<Ժ9nsyߴEi+i݉i6mq'ƦmwvyL;pq|#{\VN 9(/H;TwUp{Ӄ3$] mv#5I9ܳ'up ,^X:{q`Ť$Ww I5F^_qR}d'Թ6N2i{O`h*9}4IHܧO@{XI]˶Oቄ)4PvzbOgeJO/5}ܞe[& 3̟@Ȥ!۞6ig I'NItc M:I<|\L'񔂥O1Hg M:t҉|/SuV.],ۘ]%=1wJRzg^(L?_S'3𔡤Gp;etzg))=tZzwϒ#r 'Iד>Jk1Oq:fj֌#3e呩'W6)2t,JfDr=3:+tbq;lGj Wv UM+>_36D.g]beJ"Pf^I4x’%%jRmKk2mJ8lkK†msIm[ mgmoɈ*ہј7n;V揶,ɮ ze;W⭙c/R}.̷k%>, pdYQ%skcKԬ+Y\ީdY:{5=Kl.Y_=N] >W!ޯdkgXzHx|7ye}%jڇ^FY=9J-9UߞZrHW מY`_qQ rti]߰w4} // )؟K{<t@M}N`vÂ\}QHt}EiJyr+M57NTt:5W;_As3Љ3r醠_9u\?Q ȉ.1wI9|Ʃ H/vĕq2GEN]H,=vt+=Tz{i=kgMY{ wWm:PjGƒU{ڏvuU OW:WxDwfk>sթD_T 勫:7C'Bufٝ|IJv_r׿:2oPuLv?쁾 C|UwK+gc}US}ٙ>o`_W\'/P+竩RQ= eoS7zp߂a)}GB/ɮzL^MDZߎj[ߞً|K,AWW쥾ӲWNU}j*W;T/ 81GT\8: T^;S˹^*hCBEzmeo)RBwoJf7 |tTozٻ"qhDJ8)|ɘPDpɂ! LMpQgb؜YĖb4k&ƊmXsؑkYK))J,Ř`\S3nz[wvֱluo} XX[OX&V֌l$ gX*X*LUw؇l+H0w]0Ch&!VH4J#dqBP%tjY`appݲGB\#?(ˏȏ~q \~Z~V+jea0S~S}7K)'#< a MXdjaj!մt^XarrpJV&|ܨ$ g ܦ eer(w+cE2AIt%WlxR2U!ިT7+O+!;q\x].(;b_/)brL,KW)JW΋5*S-#jR|ZmvU;W6q֊$<ɢ>.Z'R_RHqZu)#uRQJI>[TF]뤭Fj_>_l1:\X!!ؘTVڄεk{ͽݵjgήWv۫P;vkՎSR^ku0~k& `l<֛71fLA(c<QUUfEmmїNa.q73ӛ:#j??dVz;EIh_&IaeT-ERb}6RWOR_/kG8KHq5H"rU^enϱϷ//obnm9h?b?nöavD8qDG7G#11zccs9.Q8j3s.ΎŎez&&~!Qm\`Xprq2ҸHg3Jg_G m.p9mS8~!ys:'1X$Ef5ĺ`QX4%bfvN`R?1]8򘛵dZ2,,@GX8I,/sXڳX:td`I`b6[$ehyK,X }?;e=y,7$ dL#X_z˻/g6q r8 !! Nz{(}x`lln#xpD@*6:YxPf 386^X+e ,M, o oL_6E;lZg3sһu.֓tyZZ?4^z{._K&Bm6adx4[1$̀ ܐ,,fl5YŶe5M=XCَNNؙ]H{=ޞ`lnek`lficOmXrR{}}}}}} .op oo9D,rbiecc,iTS`"ﻰ4#+ +oNVނ<%Yy4Yy Yy,Yy8xۑw +HV@V~5Yy'kʯe۰t&[l z7ֻ [lu"&ݗ,f~-dɚo%k@|cL(2ABy6i_Yfuؗ2(w-֝`_mܝk =l~\VR[w/w/[Ow_=>Ym?Yglf?ߧ<mC#g~\̳C2ʝbNw(Ai[п-ӝt5]ilnwp_(6{=ӑpئg;:/Z#}ls mK~Psɓ}}ؖW,Y^k[p93ֹ7ɵmto#IݽK^o0_+Ev_,#l~J|#:؎Ow.9њ]X=QO%igtX.>.?G=퉞n?(G<~${P{ ==C~8yy7PϨFGBxS:SH^$D=Ug%Rm*lCXـqynЛGum. h7.o'%yc^]%0Wɐny C} 7k~=Wy9z:6xG86{G;yűӛ0G8z\8u9{cbIoQqΏ)zg95\Nw3ʻ]F1λcw oŻӻۻϻ9л9Ļ9{H>ss=1g*yvfz8 rghik\6М0~gΪ|9=_oμ<Hx[V<΅|޾@yٹO105 쇎98Wscü u1\H>gƦssdhlF̃ i|ƅsӃܞߙۥsw~w^>y$,y<.m;?Ǹ>n]t>q"m\W\~qE\qu˯7`%cqՈ/Js%O}lct ʟ?5"kt6p q]i'/Wv&eB}cp\n_S+zZ48+9>6`dSL琷m8both_q\~yil_iW9fEy}ӈxټbLylj|󈧅8A ¼Y%|ϛ[NXž\[ېҷ9ooy|{/PÍs A\jXSԯn}$!=x[~ɜuT>9~l|ycxs [k5pfyG܌ssﺀgL4-W -k7fo9Oø57'ɂ\Vs?I>{8|>{fri\\ƤI.c\$$̙C1sΙLB$#I$IH$M$i-\Vcy}|?9zֳzֳu9g.ܭ:Ҏ]*woAd깇 jh DAtق bDAk-U:Rł.xU-,H=1S׸׼`U^\E:Z5e^Bؼy +ɱG^zSe,/XWP,oDJǼ &lɛ^=ovA1 _ޢyK q<[QpPFsh_c_@@@@|&{CÓGF'w ohNIibJM. KXXXXX888p""b_3dDN,yDzG,&~D*"Ao9h%V~!,4fނ[qZ qZQ8 pZ44w4mNW4)NC4Y-1ZL.ލ3{p&gL>VSthGv™83p&g]q&= " g^vǙ8 MxH{_{_™#83G 3ޤb2h\oa=OG髾"77777پEվM.u_#7[;ۇ}%S:~͝Tct{W ,y bt$3P^CnG8#]I ?T$/XH)ަ<2< F[>F}-y8z>>ޭ~zۨGsE}m(h N&R/6@/eϴiiDc4ig7*/{NoJߖ~޾|7|,{^^/O2/$(]N /k/䯗OE;W-7F5^虍]&]91|-}m]9}K+O<ƗL`┹rtI+tHΕWT")B(Joc_9|c}csz땓v7+7Em3\Tvε-4c|Xno/3~(7m+O____Rץӟ|{|wȾ[ٿ;໻{c3?'&ge5"$oo?<% *'?3Ö*j1\s_tM}@@BG@/]H_ =F&&_fVV6QwS-0NvvJKI)QA2Z8^gP1mT+#M3jFg4Ȉh6r}etpk33zgd3_˧g ('e%}y4fL43cNƂ2Vdfl%cs23d8[q<}_i{}c3YPfXfʙ5|3gdɬِ|nMf]}+3g҅N3=}33RC3d9)smy(0sIrV0w]̭2u 00_ 2OdͼHޞ~ .جpӬYUjfEed5jE6OLۖ# ~̬~')-!gۖs&L2KəO(gQ !g)X9+HB:}ijԜ9rV~,)%ggN" 7`[1z%}/9g_ŜğJrmcsD˜9}rܐ\[=`rn4Gܖ9s@qn2jizz\G\o,$s{} r;cWQNVNVN65fgdIH5!k2ǤmYfdZq?6'm }N_F;gvہ}itsOא8F)6NMo/w4[ +8:Վkg:˜kȉ܋ԝaaE.~PP'-}LB'{SMt:t%=.t x~pz]GgNX&{3u屣Hy eLb\XZń`;pyּ-=KVnZM5yG]hiN{̴ F.'Ż>_N]F4voL/ŷ'-pb;m=("zMt_S|cX2iOH(A:M R{))aTNICԵLu()i8!NjgC4NgQO/ԑ[7Ӓ,Gj/{)~=W!}]tMfsIi7|Vϡ_Bh;ʤ]M('z/ŝ~t ]>u )Kk҉cԟ[?)ݯűQֹ[2uSJ1|ml.瓸?K4uԀR,iK6sD.\F1[2ޔR(Q t;nEv|FeQnXvjn3mh>In4tҍtuc]^~{ݙ3on˻wUɵ~iύ(w~,U~9l@q<]BeGf`TtTv^z43GZV*c͗5S?(t9:8ۙЩW8\&q0낎2ʳ$syܶ/T|wւ \ӕZ:JeuhlxiJeK[ g;CHs㌫Dp'?$cD><:Ol$_ωOdDhqlLG6Yh6 J#4N<'Pܧ1gSxHk?9qSvJ\m=)i=i3wڱGn{N&HDZ%:,평iN)q<^x"m=l?I<-Nmζph-bnǑ5{ 衹Zl s^zSdGktFwD4fu}!/AZ} n>Ἇ!c>1*} xCe PMRMͪ T/QY*OtTUF"IQOj@<֪ubڢx7L*jjqu8FyN:뤋߸Sr9I.*WtRU'Ѩ"(Q4۲Qmy/sOpRRe'5333Iifyyzx{Vy9@ÞDӜhGIQW7pxT*V$L&,#\=R*Sܢ QKE5Z=)FW:.bkׂw23ݠ@ǁt#z0a9]3@+J5 lhm#8diD1CCf.Z ~]+nmyt@ :5ڶEl; j :SA@C(ty;A nv?Q3t9@!O)>ж|sȧ6t6SZCr&Jm`hz'^u|[p"٥66E55:[A~/4=˜DOI5ч,±,UBX`#!9|pamh%Lk;} ?t0:@a BQOaZtB}QJQFA2lׂMFnuwDCߍǛ,yH|-Jx /뱌d%s8^F,L`m6g+1@0zsYuFe`18}Y#S+܏؈RUP JU2.g78cy=A4 N( -@>ڲ F W+P.$ 6<6䛡V%K6(g#w6͆6fϕ#Q*;mGЮiJ$4K[o/#F~= Ny8| x{RZj՘iqeȣ^f4(2{Lk ڎ32G\zAGjR[_F'5F \?8A-}d,02e[ڮ| xmƾҴ<m3`<("͇WFh :HPd@n0ŘeYi|1W<$0j@_ nH(AO,z95R? #mF|QEl7.kd\?0J`Zw?h^4c?5v7V`Fj,5,ĖH;v@#5.1}mk nk(|,og8Wĸ {0Kle};?ss 2cM3r(G!4 FƷN,s780#lrE31iDO#BK6Gxƅ`yIp!lX (jbܛNOb=AA&ѳ_ 1(e0'Ж\g`~Hh:̏hWE)}j9n;Sg@^'D}gzxcV .!w%D i1xU3Q?4Sk}x֯e.$oGQ )#}Q |sԢ3;*% ꀧ|Ϡ3;r9 >"gO@O Y ZS"p 1cȼzjsalV2 IKMdz\&!RD*XkH!"&ƧD/9j+qath,'`L=iwV{!-+ ].>hha%դ1-x{_jlf΋жt7PgxFa9Ք S>Raw?ᕼ^.` 0 0p B2u5Ǵ10@I$hN8L!(O'| HZKT<tCÀg;Ah{i,fdIdIdX#Ɏ,)懠͠7u]_6- dc&tD{!QQ :`vf\.HVBKkG0댲3T`6iQj-'Gl '\\W1]ch:ۡnxxoKJRaTX)= +1 t]95KyOEc=qj8~k{fxWЧQBg<ӽg ;eKGYE=x7ބ QУ`7і7>f+!Sh# Kr(x7-!Cquz4$;0gn%mwNSdQF@20[\&({GǁӁ=8Iziاk'xσ檠wY5'XSdI ā1ڷfa<^~tţ7_`>Swp֧ef$wCyMȭX z%Fx{'roȲBєBs+Ȍ6ؗ}bFAoa&=9wLø-va]=]J`>v1~~}G9w8 y1akXkvvwً/JxFF ęQ )"QE>oD/׆o?^EwjB{940 dyi-؉]qjR]y}el4A,~lWxK Xp<}w3Ϣ,}xa`7j|'h{ vSZGc&^i9b-V)7-f"ƱO˫1m1y#^DLAnEF"ϒ,=jwwrvпV hhWG,˹rAe͘-Ev} ^Nss~#:'9K0425 u|@/?BiytNJ̏`@bp=+awD$7z3pYOŶ"2\A4< >{}0|18$k."A ` 0 dM4G2 NepN`;{y;G}װ㛊;F<>+^c>tS9x0gKm|ݖ?Cg #iÐ0,f|][?…cr;5Ήsh{M>OVO)LG1Xag _203r4G|xXA `y),6Ygr^b78Mh㟩CcSaa1 Ozhؐ=~[ųce9} zzA渢C7VE=fZq澃] N\Nj> 69_b4JW?&ہ N@Bjho] z)-~wCzU>l | 8X(c "N,P0ʑWktϫKP8}Pj8`$d %p38pBP_Y Q뜍:X!s;/vn<xXE4 h`=gBƮ- 8` ULU6=9h\mshӀ;W] rJ`c-5-Pi4< ෴[`-ъd<5LFM#tmFzn24'Y`ϛ :b |FNގv5C킴>:7,iVv?aZr|<3=3[=%E`s!!؟1Qֵ (=Ԧl"wl; K2~,J ¡<`Ku;sy@7z>+A戃,-;A>ki[2ǶW\D0x1/Bf5s̪G\`qz@ewO2/3!9Y:4 \V` M >t? ;Rv:6|82OShc ڶ Yfc]>ǠGaSm[ ?'Stxsb>hհXgH~9<;5AB~D~?k#Մ]X)IъW1;}^NxF":WcI!3 KDݰg~ bZXiC\桶n&yϱm' #'Bf}{zk'|.gxmp+Q6xU̒GΌ:Flh[ghB"<,ꁲ^`:ִ2P{2\LZa4#!3D>KCCCC[_6sD>(rg14е^D0R i-Ù#Hڗ-,ovBʶ!Xc>:fdOH|hC.[GSg Fc7RDu]gh3K@9Lkgt.On'#sxUt,d#a4 -=]l<JCx:4j7q]^g%' z2/`>p2P1(hHeZkrW<_ dHVGَsth;+-8ю]AIzcԐ".<qf'͙"]Q0ڡyi1s6i?d6<28o\[!M]}YS@@@kp`FH;}%T3u !2) d:mqO@r 5Ps;"t.d*.XXE_i]vCmPПm<use@ϒ_7@70 cc>Ovݎ~jr=^`c( d"?uAC<@=j8,A/Ѯ~TH>R+AC\v{<@HV!hA}Oݶ3V]zsc{@C&`92@)3 4HAvL1p?r366 bl|? C}J}-@Y^H~ \ mw>> ƺ B,<W@y4ZdӀux<|2vL{|;ҾD?J۪cOgCQ /5!(e{" n ƾ-9 1 =k 1;i P@dVwm/#  sak #eGoo`CQis"w85r:SYgAD|0,;-B1"6W['ߝ a4݌gp:FW28' xVhևW3S@? lԧ<~ 2j=(u>`=prPvhπà- J@5@ A( z0$_}+u2p.8(0AfhXH@AvL1p?r366 F7>_΄ >2j' ux7 v's" .\# .x Q8 '˓"s86$%,O 滐Y#q} ZV D 1=ZIxJP"CP, 1R@P[sbzրUuv" PVwm/m lسBF(pّ-Xgx4w&|UNdz Pv2,<#߁FeG.,BJgbː(3 1ӝq".;8GzsLS r&NtG|Œ4 |r~oFs'АÌ|y–'_p>1sՐOpz'i3pp)}8:O(6*t|K|&甌~ęX,xQNZ3Gɘ-#w'c0*ݫ*gU>'{!赠wCr8Z1J]΁|plc` A."PU6\hql ɣ-`:v+ӲUt*88[!e D@*h!A'01O\zE ӡC!3e{JΜ[nC=w><1ސO ~'o;|:#wʆ)\,:|M\sـi<TGPٗ)Jv[u-'tA+ư+'9oXC8s{%,|M"^nv}!zA߹?\uk'V߳P+ |5-`,%]1jzl(ęv1Hc\R~V UOس"6X|ڵF3k(16{rlB7Hrcɬs(6gP0<:D8}$x4c  lMfA34BƳZ9XYnSQ!"Fm2Mx&3Qlak&!c 1>}A[ҜEUGtdm6fSLC4CD_jRh$ȯK)Pho['m)k3V@Oi2;ŝ$p+OD[)%ݹ(_%,&fB}!ljG"MDI39Q~_eG''*v,%k?gaLh㴂h'c͙/F韁a l--~(؁ny Z Yഅ dz6onׇW/q7 ^QĴ 3vpCK0g1? !m.]}|E\݅QQt0 XEƜ|s1<$,wC50#`fa=C38xVU,vc%b@+H^82Fdx{q;4$@f|N49~ɅhJQgzE{3&J;2{~ ʎ5^6F` 6amW[SH&{q"S|$X01G@#&򳗋U : tM@ǹ3bW%A_A.,V5'z5| o!u`H*Қ"㿕 εȘh,~uY/0~wG;xϘ:F2s3nC*2mA2jzC:r1%wzr׀~48ہȱ! ċAy߆DO{(kl#ןl! 46cQ~[AޓR>v}\P 02@i-Jo{3k%8fM]&r{6_`q4E.N%UΫQg~'Oo`)^f++o VJ@(>WYANNCfJ(/>#~ Uc.^5}~IonmMxAu5oU!Y"،tњ\cL6}ƤQ);=̆"L[F,O+(vBoؽ(۾}իPD}h-px@"4;!0.'@W'`<Л `.p(p8p YxdtbAUu]Ss]ǁ- FkԸU$ こ Z3󀋀ˀ[] .2  9hH(` 19 =`H0N#pn5CJ]4?dMkֿ`Ŀ7J~coN'O3?3X[-:§Zt'㩿fʢJHѽ.^]ߵF lBz&b(%fhZuzhm@[mԊn5xH~Q2F]d/!9K. GL(9e>O*([XZaq}yuz\I\Rde;ܻ2ϕ)טw}-k\A K}[qS̩h6}o L11p{{s?u#8ֹwv=Ē[yG?7 ^/ߨ2|Q2|M+2"Gz-|.ߥ2V]Y&U{AkS4Roq * WjSxgQW~~!S)MN ];RݫOG5.;J/]W"=[* seQӞo/.jTUdx;{ Nȭ+O1wiGFR/Ou:&u17]BO 7=[.T#o?ᾩd#yБF#6q}>Mlg3f}"#k.8' ._/klfŚif>- 957C0s5^k=v2l[ӂ;Ꮔߊ1Qt"CTmU[SuU]Y^SduMVTMuTw;e%H5UDVQq*NVUUsYMT-euZ76ڪN5U{^ު::ڪ+jUR~Tʖ*GTʓ5Dޮa2FByF S= x5^6RX=Ms985]ML5S6W,BVeK5G͑<5OV|yZ6jZ(V"V-V=jZ"۩jWޖ;yzW+;{z_/;~NG#X},O'ڬ6xTvSd\}. Q_/eJ}%k쮾Q[|P}|H~=)uJ>NӲ:GyMK riE"EUN3̅qf"Dz}c/n3Ls0tL|3_7Es9TTTT-qRQVѢ**Fňj fj&nQ-T QSRĭ.uVwuE+u~QOQ}DJU6D}S>qRY"F T*Wj,TCPPHP#Dc5JM5FĪqjhVO85QM$5I4WSB=- JP3DkzQܥ^R/Q~Y,Vs\V^vUW^uqzC!:7՛ZNjZ.W+ YT+jZ%j֪"_΍"b&Q[(z&mjEj;EjENɪCj=n3V{h}/IuRQ_E_uFsxX{;;MK]W\W iҖ}}1c% ZϗqS "2h^D+ b%bX-6b#4C :8!E } a}0Q#p:!pBЧp:p4݇>Љ }a}M}p܇N}h .tM8$t!3 9Dq9^>-'gD,ȟd<(ɟayDq8&>bWX|-von-Ř^'~ŏq~%8$~?q8!NSWFgYqN wqQ\Wɍ5=IzSX?}G~z=EOizz@3,=[z>O߭ѿ'D?G1 OH~R?gsy7~Q_֯A* +) iJd I+#2[1)9VlL-ߑ+*.;rJ˯.-{wr^?G. Fm|k13Ə'8h2~6G1q8i2~5Ng9qݸh\2.WqՌ0+ZZVGuzbunVhy$kuzXZCVOacY+4|t +ʲVkY k5j Bk5zm=iZk5zΚlMZ[Ӭ k5zɚmlͱZW?MkzZnc޵Vno>Xkuևz#kdmXZ[Ϭmv k*vYXo=w^{k:`dXCau:f~NX'S֯iuѺd]XAjѬWk"uku:k[=6<a#F=6:ɰ1aOu?~==={IX8x gϺ'sOvr~==={W ݯ_w/v~ӽ{mr;w׻?ropĽɽsv/;__wwt>}}}7KjpnK 9p~"d_O ?~.|o~)r`E2ˆ0#\VDHDhDX;"<""BE(Q!bM"*GTQ-z5"nqkDu"FDEԋx)bvs"F̋x%b~?"D0ⵈEg8c)مe7߿#[W>*l̕bxOT9U$gʙ3A[0oy0#r|O qheNu3 ZǺ~t[8τ {I^ Pi=)8o_Hi*:4' h(:#O ]} j (,j7o[u}TnU04M$9QQ@@ H"(f@E0 `b„ 0sFŜ1"[oU3ݽk߷zcnleԪB'TbG~QOn7Q#Oo2Je wF|haBQFY|D*> QG "9/ AGxO>R zG눳rWqL( 8tCLs1N"б#"*N'xG4\pvDа."G+x/bxg:X9 8>!<5I$-O+bZViZDIkڴKݙ6hcڄ6%N52 ňn#2#=*|(|UQ膨;3ʌ ?EeFĨ[6_P j(B_1#X` `Ip,)zJIjڤKٙ4$Hc҄4%Hs҂$H֤ </ l x6[6{>|G1|g|{k}}}}}}#Ui_rUTx@>9#9KBEz+Q@TD7p4BQA (T E0%0*` *$r@Q5 Oh tx xUWT}~^3Lc!'1 s gS8h 4wKx+xx6x<{̩YxiD\ء0 S hϽMF/1F?1`@" !ƘCBj65TSu uJ5Rw( tzL2 K@ `"x#G1.}rǠ+OA7ӛ F mx.Htq$g9x/eX#k$@.HaX/ %Rz)RVj'P:`c`H=^ 8M-=,k통p=Be&Fȶ~h|F`8}s=0-ϡNtG}ۘ""EEa½#VqPAT`Pf>Ȣ+~hl'0vQ=^+D"1$ 0G`Bؿ,FXc¶ߍ6؃=`/}p{A/@ BW!WP\N! .!^ n".c  V"ƫ EB! 7pm BфKS(ηEo'^=Wlx2j5AyGh/γ[G vu]E߉J8 C<88 pqH4CC"hdqqH!1C8)8ZMxg0K=h aWB?twap$Lcwɂ9p.\ZMp+C8<:G9| ?/ hBP%=4E2'AG,îXnXݱ NXXCg,#d$ee,t2!*'E ';IU,Nd> E$BB, X~aM(ePt:#  e`w@i|(AhPh0xՑ tEutCu< գ`_T~.Q zz)HniGu {I(oB![Ҁ@!#t&hT Expv"޼,&C8v\Q 1íALD aH"v*hbd dqV&^yJ lbA ( >> ކr*ܤ.cAl&awW(۾ 퍱c/0vc=c ݃1v!Ra:QBH={[BM{SGu܏Xs =|<sI2xܼ ?VAgǞ؞ ,<SS SSS۳ Po{t{Ͷˍy)~J`?}&e;|W(}ȁGd{dak _s' uB0yd$Mƒ4r,3#Ƅ1c,+F2ӕ`z2.LoƃD0QL $14f,3d2әf&31|)b1˙f%Yˬc60r`^f?S11s9˜g.2L41/[3$Q0/=SF") `!LS5h9'bx{޺Njoy ?!>AD1@*EIܚ֯ ձ\XU[#eq]qV~*>,jZǂtূt ^ vJ4*#$\j\:\k_|M7~vGXXvF#7 e>) LFL0g%XQGPt\Avj77B8e= Sƹ ʢ {)ajBQEjPr|GQ -Ͻ'M"e߄ !2lB D( kNPGm { 6€0BmcM2#Pۜ0Gm - qKXD1j/p<^_R̽)DjܛHwd(j=Ž?4ԞNNGl sk(. CBC8ϓNYlAZè}Th!C\w(&pƖ!@Xr0 v( b1@@ f 3 b1!y<b1@C !y<b1@C !y<b1@C !y<b1@C !y<b1@C !y<b1@C !y<b1@C !y<b1@C !y<b1@C !y<b1@Cw-$-^fi M=?@)$Ks*5P"b#H (3ì.X{4VjehŜ HŝnWuXxQVm\$K5ײY %<ղan2w It_cmbbDsB158ttLlbtjRDeRb)ȈJcSF'E&$'ƢoqX؄H Єd_^ĞudH9:Mlֿh⎋ļ^>#sVklrLdNo776-l[KX[IgVU!_*2&6<͂z;OY݆-n!Ͷ̚2k:?-;_>zcwdፆK r6t~QKMMܟ({o'QX<1b ~u^7QV7ݾVYRWTN̞ڥC3Z*Wx.1Xz]C]l4&;S>.&ӳ׼Inu7dT\/Y?+cFm/\FO>p!k^I9Oy@>Az#xhʂҨGHVu&F̰.=5--Ο]HS*g(6_sOz~yٖ:mlm~֋,S*<%2ờ,ÓbV)IiᩣY9%(qIR}Y,ݽcǎ"SSY1w 'xq^8bT|UFNoTUߟ}%3&uʻ i=rJG#x1sNr'х~xyO:#Mʺ#fv$5#>2\ݼjUՈ30xixf[}\{-:(Ns7EejRƟzQ*|aeWC޿D,|r=gus|3 Cs3դ]81䰁~TNq b:EK0f [v:щ\ӱf%̺5mk0ɦ-v'i4ʙˠNj^Q8/#z '߽jՉ\6Z ?M\w?w%>5_OZK_G;6RoW{f7n:$$u{M?]BscڻpN:Wjo/xz)ۜOG8U.+8pxZKf>]mTgNLI%7+Po ?;ݥ"YkMSt|&<գLgSa\kl|jɐo>~FG&\i~B>RyՉKaNp|];\ލUuB֏;,GhuM"ÊZObZsچe%fm]dcE$*6*qߗɿ>yЉgw,8D &U4.g_ƆOUNʛ_EKfj^|H7~=}3b^`:o r]ɒ[o\~YF4s{X IZbt6+AJ5ëFw/75w+#`ϱ*μ/Tp,X2qd9qI?vS9杹#@5 4i7U:%*ZtgdqR :ߦ_lU`/IPq/j64pU1==sΝ*>" 'ކ¿.[fǠ>vby2dkܱӕ{Mɚ+n]rq,ĩ3tO( ;KCk$u=ߧD4kGg6,/CuHS=sC6<>Yfu,g^o=&NjCW,J\/ny+H!x Tr-g!8Ry _GN<䍒NO;۝Yk47PD+-5&)%6u.-k#a9j-6,,(ll3gv |ꆪegmNeuJ] XH%p(kx =P,WJ/|{Ro5̿Lx}s>>3ʏkF_6%}cwKM>{<#gg b?MTns7*nWx}L;/2>Y+5 L4}ӁTuS}!Z$cO.m6uai(CSˇ[)=d]{|߈zm8$CC<%·,/Ha656gg3d(2FdTpmqнեCv̒YoɚF[F"*q-yqtE.c@;ۻ 8+õ+Y767?L5$o<¼]VN58#]rc|;ViքٛuY7yY?K>=3bF̓EVy%~^KRwzύR*u\mqx$lr,;RjOJ8$;LčTܗw<5尝U$rp?E9{|oz!PRd]S,|}wT6 g0QqM.w`0+ ƪsJz):jMqwT]އG+u=*Uq߶m[Gׯpi\z0\~f8i~uF?CS'^xפLT1f[:&t{bx }^*$}i[Ǣ5g(DNAvӽc^mYq[I~ռ4=+uĒ!;(y1Z>NJ{#rEc$>)+8%1iazzOV˝-*fIgȰP?4 3o ,: MʀHl8Xva7%,X?ba/?iXn!K;uW=ݰK3ֺ%K%-|̸0XqsKRuWכt|8j#k?Cv%/mc̛ o-U~CĦ%{.l{SJqkT"a wރusLgNN˞!wP7sΓF ڟXW_>Yƞ!9w:;Ўg7yۚ}J۪/ zX*XsԥР/j57L'[qn!+*u sBӥ&&ebe3 Kj5eC56~ՔPg<|^.>5=$5V?$6X\fڵ-9*7{߲Ͻ$ܭK9۱ a_e^ҩ ֢?HaW3dnElp+q3>%K=I4nѨE=) amB1 s~/\󧲙+gdc3/G@efE$F& Oml?jYh~ DPB@2T`~'_"jYh*~V85WRo-qɟtn=&2ҼGs]ل;?w;g7  6,w߁W載Լ4twwf׸=,M>pR_saEwG>^xS=aHΔۻz=I/mc4.3\[:610Էq7ۙjW5Xb\P؟q^ҮVũ!˷{:RG#oڠ3-zڔʷF7ͻn ʍIL*JI BSYQ=oF$1{F]n_xMk"ۿ)8|XxC!+8+LV#2oFZ=+x_:4 T^`ܒ 3p5nc쎜[rz<koG?qU^w={e8UKcT|2(Il/lƴNgyW.o;E/󺓫Ք,mN,͓^]IQ%VvC(?\snHލ}ΝNMc#:| bJL3AP/*zқԵw"~(U {;`TqxtG.e#]p=m0\)>]u&JU4+~Ѻ=Ш\ӛ"S $fIOI t(_zN6-W{l> eB7*Um>W#{Tlv_0 wu#_I}|󻔉ܠM]>p6ŲN6JAv.?{ұQnje潛5L޿ظR3DmfjfWXFYurvdys|Jp{(Dp>ظpA|Ҿbm oRmOK&T?]:`gO#oD3n/VVɜI-> stream X } xU9ޛ{o}H.I’@IXdE@EŽV[РVE[ږjmBmնƥUH;g$j}y8}3gΜwfygιa 4eJovF]yTWT' |[)BEE8Tڪw FmuΘҐR!up͞ږ֊k.uzKF?*Bpׅ]+;Ww"`#AkBū쳩Zcp?uQ !ؼ;[w rN\r=s~_޳{Fx:S^gܴ:P ;W8\ K@HWzպ#Oί^۳zC0BpD#"-0~\p8| CWWCP8DN>R/4P>Ob )n$C2 ԃ:/((e7r x*n)gq'Fbz_='Xna'ZqZ~Ʈ=/8ob+}^ý5r9 _'ca:25`5{N'^;2TpZ (5A.CU'杖fʒn9SBs0=ily[B[PH;U(u_ұHz Qy=9ap,NBwZ^Uq iB<}w$|nZy7yN+Km6QDe;9_>&F |܃(pR idP4@~ӓ4P޽኉moD(d~{s*h7MuOD(ZP'^9{ a}GD5?p&o Q*%q+@_'JbF;s#(H.=wy7aNxϭ9pN|@O_.l95C|UU Հ"@1` 0DҜV]̉~Y|^MBܽGDsQ6w ?c~-}kQ!eqͨҸzdj&n65F}A;sǹqqkx97kpk1[aa%vs^:w+@5` mhޚUsǹq8w;sǹq8wd)wz3EL1 7ŵg,MM W2IrхtcBIC0r!l(ҊN/o ۃЇb3H݈mh 64i[[%3O 4ԋpJ5QkV1\+GuN( -{HA)Ct^Yh΅Y-XfOȎE{b=.-&yt zIJ6ml!20"-lOE__×i;dD̶~s +\!?B11#$$@rjRL9ChxV#pFba58# Nq11HΥb0n<[ۗYNCS?܋e aNU{*z5 _Ni+c`;gat6+$K̶ty9m(~Y,]\Mjn2$SzUJRԈאuA@@(i۲v;{Q]) e1ű CA fTI -+AjNmCcz$ jtj!NݫJ t2$e!E{;-LJ6jDq.),2(*Iɦi57e!sR^]hJ'zbb%)#4VAj#7iA29NcT*ﷃ?{!P*OTEŝ4;h.Sq=w+Pq3ߣ|nF*s7\CuT\K5T\MU44+˨oqimKo[ b'ZA跁1Alb|+B*ۺAlob#PTYbu *4J*VPXF[JZ*i.*QIB*P1VlsiЬڨM;ި2*h@跒;L﷒=ߺ ~kF~+x QQK#kAT[/QoDeu~s TĨ( ;DCv%TH(T "4D=KEN)D6Mo"7AE:Gq;6*TX0 L#4PBGДjBI 9M))SQ@"7d%8  )pc`x~p & ?x {r߫,+ [; ~ _뢾_t+}; 23uK|GڟC~?<'O~]{\vQz!ps!<{PVm}?p^5i{@}nwi~}pF^ uC~שUO]^ZCU|!%|o.lznkݾo[fllkv}-fnipߖͭ[7(-.^oCa x\gn`k׷m]om+Z;c펵k޵oZ9'dlZfMVxeyPeKZ[Һg_wkW… ;ZhW8u9m!™f66kj^8uO-lhmZ_X:e_]kmaMk5Tq`ZypE'yG@^ao6}n.•]x"׵.9Sk _9t|,1Grz ~;o#uOY#**ĺN56|6g#o{+#g0`a ܠ95cΧ׈tCrhg̬1h|\3]451MZf c x%)j`\cofK40D s{彡k+Ιև5}k%OlW_* ޖ޻ ;}vTnúht|n}T!$[A Y Ăupg~. &pnn`'bEm [6VV,XX XX t<\@; 00 h43S@=` P T d@ P(LJŀ"@!rـ,@& H@2 !@" H~8`X`h(  Gp @C N|ogO'cG;oۀ? x:O?x {W/~x "~ Ӏ#~x p$ O< 8<xpp< >~p/{?|p7.;n p3{n \ p%` ;0 01 01 01 01  `0 6 `0 6 `0 6 `0 6 `0 6 `0 6 `0 6 `0 601 c01} c01} c߶Ǐ? #Nzz:C;]n@O?Eh]^cԋBϢW[_} oDZ$GF  !1|pJ7fqᡑ0Bx$ˀ+>V1} As<ԁN?y3hf9ZVpn |/ZV֢h>B1m&mAhQ gM"hN1IcvKХjg ]1+Uנkȯ>)t|G߁݈nB߃~q+;Нgȹ!NgA z=, F5XjVq%8PwR=RM7AqW\ 鑤)i.H.NuPjDC72}6N3!N= #n&Z%)SM{>1Ic~>|xF'b>ԏВGЀsGcGcC@ >,{D១Cg/B=G/_!K~~^:`F!/H&#${|XuoHT4 }`b|𠭪JxrP"+c=vɓ_͛ 劫-zc襌7E8co3~(#cY09*&syp~NNv&91.7Ɏx+)H91>$gN.Ґen4ݫr^T$T$4Nٽfۼ&e鿬V|+O俧Vr\>t2Xb4ٕ IT5oh-gѼZ#Dž2+J@at!87$5|oK!r:U&áO3T]"Q=|2 foU֊EE&G )8mG;Tѐ.U&١aC>_ȢV s!V~ASzB&$G/ ?ҩc5z%+ .$~z!CGQT~sFEEEEE}PE^Tm M.b )㈩hvʰنU S PxǔVۙ`UBUk#8EY<&_:L_ƒ^R#d~T:IuTk Z8IГ" #| d4 R \ Eea5j_b}H{h6QuHvhGǑQC'ќ_`"vQ[&bƿ lZp9¢zˏ{J/>j2 *#njsEY7Y?~gO[-̷x-pzxڞ'Vm=|I׋7'$Jcy{ڎ>{Nw0ٝ@0 4p< RJ]D+HKHk5D} 2G8PKB&܈bp9C 8ApΑ HjpX_bɳ1 r QVˍ hWմA 5tʡ\) NW䦊}]Nʆ~ƸƆsrƥ@64rtCI*D B$I*DMT~466Յjim*[_ڱQ9*-`$mAX@-O-O-O-O-OMXk4FOq;*gFߴpO~)Y vs5L+Om~Bgn/qʍjͣ`-UZ 142t"B6ZYTYTYTYTYRm8*s"kq{cY5tđ {󳳜eVXMim%u7՟h?)AH 2kaG}ӹ'`VAEȠ,,!lDVҡݳwjʉ(HxKi4Kʍ \b5rih %u1n%pT{7;~{=zu^9]IM[0C f_?>WNycKrkqaDF~p86%ʥ ʥ ʥ(\t K%j:%k+/yBC˵P}~[v E;d/*x$s_6d *KEMR.[٘|dvGꝷN[RyQ>oꇾHj,h ]7 PRV I&+rQ0y7.^ëc8sL  49$#dx H=;?M%vG0>J0rg^U"82^W8kU%Ӌh鴬 pcdXڑA !4y#n,hɒ ,jf,Vܘ3ᩉىZ\!c4/C(E~Mʇ Ҧ?#pLcFM5a<=N'4_㠑t1LO2p6pT Z9Uɫf84*93vT&f7/;isNɲgFgO-k?%/{ , ΐ5+3r d\3YiϢ19-fX̊PI-k 0_zqȚDvh_{ 4r r3Yy NǢrDGGcn*3s 񪸨˼!`ҢD\k/툋8n~hۉcޅiOFb?:~I!{Ӑ]]]]]QHUⷓ׼b*Bn66{K=:E:鎡dM}w lX޻. -Ԗ S64EE,*vTm~x#d89Rv=nKA+7D&2ITNub׀4HEB̞3( |NrӁ@j::pGGG##L㜢l]p ~]I qJ0^+tu2lal5J_ %O $l:N_-c)Z?\F>U.$$)bL'8 INN?!iY8-% .hNifj.lʡ '4Z͓+,%}801w׻8?|~_E V^e *'s-Ao|Јea+&= n#BV[i|P.ӻDC% #=L8Ӥ ~ʆ|{2& i =}f:ԯ֓66uYtv߫4y9#F;zb~{`"w&NGD p8r ګ\pț{KeK0r c`En@UF#҂/AÁ@Ȫgǚ%1sJL:#ӬQ۸R;Q\JK]ZW%rǰ:.]QOJΩ~䯀 ~izR_81GɆ7 qGcTdc@eypA\Nuk[8iY`tjQ‡,d+T=F^UΪN0z=oBUHUq^Rنo 'ه7D+ҝأeгV|2Q*wWSk_fx˽7aa]}Rp^b9J7O9/KΝQWd̮/q`aЄ;b5R3fm2i$\) q+y `6)}KnXtSwN|0^N֤V'Ȯo]S_=_Ȗ0]|D6n'_7yjWUoRe+nTw 'S%W_櫖 d2 (ͭ*oA*Nks VB#z3+4 ŠxBCPRЂ*eP0-&Q1CEJ?Q 78Pa+󂟺dT/BW\&hM(gھ 7&\Aևd `j\8kOgnAM靑h ̘9+g2g/\Z`UWY$IwemsIX t.ug&{J'P:ZBh=ޤtĒ+Twj(M!BAnၴ4{a$5ّ='Ac1s1~},g݁$39Yj%KtdOkUrt'XTP ߇7ʕrީȓMaЇ4>X5zfxݰJש%ƽt[HTz`%lTA>"0&a/XAFe=` QT[Zv$Jer$dB yiv w{%ce&W02LWdOr,ζgz7++`-άof3+ԀSuhЩW"Or_Ƨ5|Z-0 y0q=w9覜>9:ݑΏQ{/l~/izc+LqvTgc5)!79^" p[_iNl9uVTsPu | T&q'7E3A'Mg:|[ɴlڥ7cw~Qg/a'sc +lQ2%e܌+ZL멯[dɆW Xio8ہ,cԔK~.'rC\NI3ҋa~l2D&أR}ߦ<eH̜U fwKfzZp͒ć5j]ҨkAWFX)#p'W5C3 s^W.**[).3azoɴp:n+TZ|wAgp'J_Ӓ1Ϩq,Ҵ_fNǜڔy[R+yB<9'KuΙ?6GOO5{hZUޠמ\NJɩ[Vl huB9hYz$)j>"ڿ ߏ|}Ho7F=Αfm c*sYǘ ɽGڅc(pbh m'@Ǥ ;E, %q,0:c SY6O&Ǣ*t,`U, |.+"n59nJOj OJhOPӏ;><6p0cjcILBSqmzqc|ARZaV`HVXifs0U ^o@'([Qz-ݣߚ:q7?O6E0*9.W@KѬ*CEQL]u8u`P0c&''3H=ƜCJ jrsݘObɱH[ #UtSÿUvuC=?>`QpJs`VyTYɥ*!pJ'[4:SG^7.rQ"W(C1u+' 'é7LHi=acl2r2NhF%2`<6~(^G"07'|aZW毂t̼ZA{TP[ N os8w)^į r|K!׻EP{/Nc8io$:*)7YwwwZۊե$8\0ȆhpB|ȦNp@G %2 qxtte&~Y EzkzC`Q!d:[QruâMX"mXUl]{dl*DJ1Fph$BkyA;Pm/>`;<ywD0XueJs _?'Ξ1WQkT\O%;ιd9HvPscz"'gbipʘxsù)3'I;U@+E5;#EX0rw'']4/O>]N.I1hPtҲ/_n}j5ѲiE:diZTZy=WWuWgL^5ɩZPɍC53<0a^KjGi5-U`yE0ux,7CdkP y}:/KIXb+(ۄ6,h:̂&7,>@J51\fc+n,n-/SϙF}Ԝ; .sÎiBo=zDL uXD8,JJ#ۄM6̹!A+NϪpdf]X&h4Г&jT*j*4Z"j迤a؊kR-k[%W')_9'hzίJlk8_~]rLm}%bK،.쒟n*R(*S+̒)4zN6Ϛk' "ih1vLS?5ȂfMȖOqί-OeJ-u`L55E"'8?~8l|v:0A5z%4VBXcm4nU] N8zxV->:+lON J KGC&mEٓUh;qm\6'XW0]1MΤh !ƾyz3暻~~k2Tk8` ӦV*k h(n݊GE6> #&2FUwdk*A鑜yk/W`Ҳ9Mw jq6L)H+`T:FWZErRE+>S%Z]pt426BOEhŪYWܖDp*Jwt:"԰n>O%tv'.&)[ovo^jm(4o̺ aMQ2+/Oo"FFIZD 'Btɐ& ibɐ| ib /85GЧ?gIد*Aq-?xqݓ[ K 8+MswVUVn*fɁIMΚo.4읲jgmUy2hu3Qd-ɫ@*y%hEa`U(G~^qx&4Q |,5.@bp?__M6.ɧQ:1DX柱WC8/*Tq ׬nuOb`Z[u5wuw´{'+K8.h4+).bj\NKٖ-]\]6ν=dnv/Ev#qVD'#yxy$#u&)cfuH=_fu&3qH9rʣ&atw;n *5*,`p*. ֭V$ET3x'.oóceuCQfbBڄVHI%fߤH=o5M6[bb-5Hf*}'szWj%T h ْ}CDjkZJI'L0'QQNrpNmK=c.1Q+1%;s4|HGcJV-%@co!VeF(?VbXO,J4@NNyŁ9dL+HH5ڂu\*`69QЙjրr9գUa]jO #,/l β8O!]IWƠ'߈.;p]{[R6u6n-_ >d/۲~޺wt^=ƎƩuwQc1wvP ٔ<;؝j۾z_3rnxV{m}ֆL7yS2.6$ 'oe ΉXASA#sqaԊ*cH|0ZmMuSKkY~]%/Y~^:).5]$yXe{#G*YZʞQkr⪋9%&9B.2lR&B3qRcQK[њ3fm"9ڑUSS#&k4q.T U쪝W68&_4XY8:z[$~~yVES:}r׹CԹχUNgh 4SfWS]MMr;m.9C %hvl_g[+,Ӻ4S݂ieuu`>tj1z g.ғc}~*[:ݚ WUd7k6y["h4=FJmI2/fbiT\6عs5 X^n@vz3QOްj믩3xa͂ u=m G ץʒ!CDR_"?uZAvݚ&|#?A!D|==38noZ *i8_iN4ֱ5 u 94o?0'Ȏ >PUQVD6.(<næ pͱ8ݵu3Mk,Ki'jSP {";u DcM;яoGW:[yp|Q8[u& vz֪q 5 Th22_E$?NĞ{ 7oC'pq0oB7Br+^`AREPǠ.A7KS& B͍uhd{l ]^d4n11TguGrNBM<O&8%=֐D ͠ SF!u"vϜD09yR.=Tb:И`ƍ=!Q(+pL$-G(r\'K촑[pY[J(2d*?h[޳+KWVX?5t':BdDs^$twOQMi|1 ;_3</`O:ӆw{g7MMFҌzd[ic! j BBB) :M,ld/wΝ; oY3Wss>-1@$(TaԄKXSr-5XzS;[a]Ig29Cn`9\86J ֌3dTcqxŇ_)ռ2$+HZ&@y76xB*n|3\ɑ9MPPnK1\8!5C[w,eAS.ATmX72bxZi)>"Nz&+];g59 pCYP܎H_zv&ۜ@5DU#Ei};[yaJ*И4C ^f#p[7+v**ɊBضy&>Ԟz1t$܅ӠnL 60La'IzB4Uax NS>oל^ *d i.tQ^$\Nb!4j*Y+ztq(t T3!bJxp i̊.G0$T<@̌&WbZ_Jp Zp {NaY2h 5o2$V?f\좏8N3K+Q(^l 6Mc#qt R{ :l?AN]Ib`v ks~ ; /JFdcڒ\=4p\BRREsCGq󯸮^^p[^.=QN1j5j:_69WEwgkڽ\V Xg*?6@zv8hIM<}XWBVstdhH( K܌9tjp Q*Qr~aa‚:j/mvF d cp*Tlؿ8,TB\6K|i iY\G4Z7!MrD5i{,fA( % &gf+9)&$8(Ԓ|`nL)r5Q NE4v9V㬐iUL\]HvӼ,9u ʩۥ}^^z]APf:$p.͕7?[]UUʻšo #`*YxĐ'ތ@15.ȬppijBzĆeOUn6M0ȟpj\L9ZyۋI_fc}^UtESגk5Jp!R {+t%{9++!B~b.t[Gc {l3*X} 6:]vmcJ{.ߙ72-6[Ɏ: 4UG0=Tb*#~Q )J,[5e %)t*WgVEp2zҾ 03'G?,ZoP>OPUJby _ r:wn?$88Bʸp Tb)8L&t!rE&>I㞯]we|u枵lPe)nmN\}zSknu!يlj7vPX!-(3TuqU]`ʬhyLu B^\⢗lť ..1w._p`Gk[3: / FQسz+qc{ˊ/ͺӞrKUGJ%8|d_ M(?hyӆD-?-?1~F<(*F!DQ!af(A_I3:gn`s{K-'A$Ri\ 6Δ4z.\L)% Bkc]nvBNQ 3:{q/2_H?YC_"ɛZQ8 0 \oH鈄o(, :O eI_QyD+c~͍pk)bu2(DB DUC6nwW:X֙SD..u,ȒR 4B㹳RH,-YT u8@teqZxOOpҦdoDX%gޤx@&t5-ǂIx˃cq(Vl 7;ٺU0֍Cǹ}]m][;65Fbcַ]3L=w!<ڄ{9cWg"?AEb]Q5Eܑ;qL Q~G\r7bm`{U3}cplo1y!1~ⱛ1U=s4TwɮP_b<􍓝~o= ߿ߓcؒR12[x@eLXk\wwGXj!ڲ/*ˣB+\dOj /9"lvn0/VDJ텤C"UKzyI}!:R?f+"] Pl mH56>%ZFE-A1te=(_^Bv5eC1&ڳJuo𝒯ayފ,*골f *zcS3$]"a֋ gϤj/3r6l** y6xZ9 +J_ߒٳ[qr5u4d~mYZZ:'*T`dڣ?'6#o>ѓVNE>x!x֕kr"==;{(^`ɷƮ%I<<}ڨ!%~C!|_<!~ gZ+|,ʢ]n3HG+L +dz.oPQ)9 5/ i^$$9r*_dW+񫔎YzCh¾a_ yn6~ablPp$zL ,&4LTBFgPnKǂ8jKbފғ!*qZ#)1e^zM0^l\nŪ)Q\5R䴜JR{g/Z‚ek vغHƫm_kFoez?6Jb[Vߵܝ݇z̫mAcQɦꙊS69Z[_U\z^ܭlTHe:!`rxW%fs.1r D>_[=YWlj[JB@h"Ahji+\e۰m-Â"ٖڦ61MMXPB[,7lhI|"19_-7V0yQ;.?]kGs\F'͏ n xhϯ^"v`dy0Z$^R%G1 >&w+ -CW럅"zp\8J2:ĝCȪD{4im|dsKK^x`㤃nIiկ\di]pk}˗B"p%T"Ip&r"Nc? {}`<xλ +?Ǹ>Rѵsρ $pf7 =,]':A׺ *8] .| υj734B.JtHE{*u m,+؃& 90<,!S`d}eD#)bWpYap9}< ݉4 7ͰkyA]}1wo~XAPBh,B#(DASNd (8Y'|okI6+ffw{^_oA==l\;]À~B8S,{xB=]WtNUZ M%D^<,!*C3)q2|V~n~<\^o laiAU("F+Spd*8B !!s1Vr71WG?8vi, áiObHbk Wo:;@i@4ŋFPlܜF2>JvtIv&{tߗ:ʁ&yw%|<(Qk$؂6?8HF NRQ0,EZx凈iA+B`FWgx@ah< 8zM cbq}+-^QjN4} ^L.IWnwk$ğirI#Z5h13IBΨ54l ÿOX4ž_8"Vt(pqSstHg'9DWÅwߗo,h>{˷KhN)CSrEV&!7Z9F=*;%҂EιL8P& XQ1NHJ1<,sR{=bp'0#'QP;j2&#YGGbk*^]1`c,XHTҪ/bQRgU:chF[v0~Pwoug̏1ʑx,CAi:{ڴS(nh TY_h+SL&Ht/6YaMŢFիI)kj,ZQ_Z7BHy}]`wȓrĻ]#aJ16)U(J(3ꋏlud˱#ݎ` K`cF7{PGmO1cgd{km|HG>75Pie~F\"s,pm87R-d,­~Z&{WQF#JiԼeX;vͣP=7J93X”y,@" *cIAO>Y  up.hrqzFlj[`v)&ǂ2F`w wJ{Zwk<Եg8)PE3ve\ Iݰ/a1h p? EZ}҉ӊ{ssz݂!gpw5O򡶤rQ\'s·m8cOګ%hӌRcJ]CuYLۑ⯃V,O<π%?~Thnnaydԙ9OR)N.Ұ}JNhup,h ɾ!S8jUJK-oڌ" f5fsc\!WiQcxW@6zXTȝ`ѩd~,3`16[ >C t#:\I&&#NtsXɒ8Iq^+c7Sޞ8 Dc3T!zG`дEY[vq֢T*>7ղ4|06zzwljGVǬ7[[iƜ%dQ5a*c7z?1֓2卸`{ڦgV*n p"%O$r-MYn%dNَ5ŏy$c+Fé`V.hP Ow{t It+94YZ Ԟ'DVTRc+)=s%>UuAoˢ' ɿsW0=N[&ÚO)?k.j_&GO$cU[33ʝܱk]Q*8qn9JgJ7(A?:RbHE0?Mi#E:Dh˙lųtG{~:-*5U]X܅31Ke26ZI8iJcIp7<"fH3LYwrq}^cLKyn>GIo뭜ޅBBf!2PuZ^3(\?W5TI(\vbw 2 /?\، +zy8kаZ.h+hhtS6 1HK̆_q\ z%-C?W+Rag{Pʘ5: #KemskRKx8^~=]7*ῶX.nhoX^+a#X j̪~.058]d pwih4'ټ;X2ƒ 4B/jCXh+uB9V 0-@;' 3T^qy\h^w``P߮^߽9VԢh``gwHgo;c#u]ij?㟅-B5w̑ubb:WD!!-S9ЊR]^dx1h-n6Gꂆ zml=`W[@kpXiI-6ZPD|xZ闣1Z+s!9fAIi݌>373|B3r@xBVRNC@C:Gve}3eA[K B#hKR :8[YD6'gDiKJ6LYɟ&ēL ow9?@exM(_% k"=:-8 1RJ2 e f}іb04 CJ޸#uuᶨfArg`2^TQ7T1}-hTAhߖ'/y sBf3z:NS3NФm3{^3s; (h&baLuvfBђJ)`f{rƢ3;\kt4C"$eY72忑L p х lq2̀NN^;.))uJ`׊|!D\;0:ˀn6B'yr6gTDzF2%]އ{e#+,qck?, i7yWZBr 9Qzp *ؠ8(ٹjZa9{)rFuFaX -j74VmYٷb)IҎI J|1)>p )f@q0`şߙs]T@K0V>:VZ.x->W_#oIs'+ۊ>wU~n[( s %C||Bl>ȉt]t~.L,Ȯ|>Cೡ\.*4GH}}geާ?Ґ 7Pj?{b:FJL<,O.R1i8$F59ұ;hƣ8.ĉz^a!SrOQvid` +wspt8Ft:vdsXhq=tUn\QRi(l.c8Gᴯ>UjJʁFsoiX'Fʿ (o eI %$Dq/ITZ%R|Bu&'/!bJW1 (--bv̦㒷~4|?PX{s :CӰpfWb| #8ƢKHdݠ2x|,ZNpO`2 Y ϕW\ {K9,tw9ˈk &`FL1'1T`t%}-)" X#'NL :l"cZۙ2`T~&^ćWe2J^Lzy{wF̦N6|9.ٙ\u5-_u,qF㎙m F뉽Țs~..71fWG5Lz6w;p=Auqo|j؃ط]-*5m`ٲGAa:>.*u538)vܺ\ YἼ:`TZq|; 7ӠwQ2:I\^fR]hp&N)}'q@(l:8zwA `m1=zf'h2J<'qa4NA_98G$3MPi5[&Nﺋ^-(u-؝se״-9*nسxRPdo2n9Mů֎tpJTYu^:Z.7ޮĖޒjdIp-82l#Il[OajM٘տ$6v`:JNVJ8J-务c;N7yfwey% LNvwpG0pQHH9COm 3#ºu%;+\uj,Z?0z&AtvH]~ei}vy-c:z+ެE91j:WdjlZMYJ:,5\z" `<U1K`NZ& !8Id8>Mj+$) mtѥyq?ZWIf-x9 vFҐ{ gAZYUQ|p}PjT0t`|d0L)-3x1LF2; "+>wbbt5\^&y67lh)x6G/u^v&rǻ[On<3j.*VckoqNgNƪKp̞#~D:օ5 5'f~<)c<酝=Y6tU 8xmPK"ǴFvA[G]OO4Qs O 99*a~KÄmhyb+|EԺ\{};>Ջ77)Jc>)oq=.h}2X'M2qS3aGOe_;Y*%%U_ M+ Ii0s'ڨ\t"_<"Đ͢3٫1Y{ri1!cֺ9! xIQW6QVW k!dm:]rzJe!Z91r8{y`I+Xrm*Ǐ 6B|846g>+:*]]R#lwi,-??:Y;$k3VAjRu5# Gr7Z62Ç|lIi78 ƚQKBC^+ģcǗ&GUR@H}ڒ;A5hfDP**Ə߿>.}U;-U렕A+/%P Y7B}caT}_,X]IU;4!e0:4rfQ B nR3xi Թ\o*GS Qk3:؀[x^Ѫ*@UK#땯XFzZ~v ?}du`DFɦ5]u4*CgyV6Nymzɐ0#:DX!dIKo_Wk %g2zL xz4J$B3ЀAYxE?q<<2%T㈫ٯ0_ ǀ +12o]?+ۭsK)}Scyڷ?RaɜЮn'QwU_F{,Ln(jv͒z)F13RZE7;c/;M[uwy}MpWy:u)Q19n Uui &{H4\+_<;t.UqԜ XkJJ߃%Vd,c^({ʪrXy%OPu5Dr:eT|^xIxWVܳ6hhɎd,ew<8ضeu񍕫'Vb٥KBf iܶ{6QWۆhw:)wgޞ6u _Kx_WyR !*GGںE68cjBunYMƟj';o6\]Era unh]g\rЦ}ukntE'>178V%J4|n[.M)ԬdӚ8Ƀ.=$݇U5 V\B 8Z?Q@c9Qrhμ>YwqG7t|n^ [~}+4.ꚥ_~szȚϼo* x pl=p0pK@1/$z(hBi7BQ bL(#ˬW|CeʋV9xTv|H*=P(%_MxgqmO'qk\e1}g8VBZׯ Ktjf}^sfΖvmoQ7E{5ZmSq?90֩e $Tj:=qC5{.c^%5e[W5~|sAkwUZcq\ܥ9P3k/ݼub1} ;TUz!&B1jG eS=$Z[rW\ǷH+f$oi4(cx :R=U͠qX-'d{Ѕ}_H5h|f{vΑ"=F ?g!磸m8F p-RWN}/l`5rnײ!R?S Gp̺;?p)*&rDDd!:7K7"$gxŤw,J4FƪO̊[y|?RQ^$D)Z"8&cw¢>y&6J$Y+J{LH\% iŪYg,dW"!jDA 7b".- :hыxm*N1(Y"e{Q?-)('n #UvI_)ئ_d*D0 Knj& }ge]5\3\RcW%7;;tӛ‰ϩ-Ēmz{ƞQ::>л_$g|`}5WuaVzk^+X &(x $ȞGC <($hȦYB@C"Qhn݈^dO?*ă81SsU-IphSZ< 3@V5h_*Ru G.q٥&'a?x$aBH$%aT0PIʂl4S 喀b1;F(<:8*nx+¡/E.’ 2G

{+5G i^+9 mzrVʡh< z( } uTvnI) &,8Zpz "ғ At:MRGJHny.t93feT{y =Y'|~w#g2Pr<3>+=ى=} 䣼OOc][`j9^,Ž}&;S}VW⫄_ӈsT$tUGj2~ $bD\s&ӓ5Be(da"fTR3"gHJ$dF! h,f@i~[S"N~ @ B3f)ЁTuUՒnLdork'4)pσN 5RIc9fl +s":S1c'#u.Z-&]p2RL4ۆi.ɩ8xrM9[JkҶB,1h6R( Z5-YBZ7O5Q6𕪷Ve3^˹.O*UYa:J_C8)4)`0[2<&-gL:-NIe |plEo2(P5?Qb0oPE_K2]E{<R"!G*16]OyF{ UČ][:Һv\QoA{'cx5 ZA+W6 8 K謂}{VŠG h3HɀQXMMuuUWjz91]SQZ\2?ѳxWɢ :RMF\YZdOLv7 dL,;[HbV)W*:N"ruYRkV43Q۹2kí1kX:b}%YF7_Gᅧ k B.)@TV'CX^RRBH\<}QB բJuXb*&䁄OA;քM0s(3m3K}"p<xit4ⳍi}&_5 O=}9ݱc}>лd♖bq|{M@sЗq`Nٽ>ąyW?c7';늓$hE!igM[qzt2.0 CY@™2> AI`J>[gQӫNĹ\GrQvXHb.qZ)5hLhk݅&~\x}v&6][`R2[O+)_iiJeݡ;M@Օh Ӽ±wJfm%Vi5j!ן=^du_(y>js6:ͨo].J~ 76;<;6kGz-ħ;q>Urk My :F(pO޴ U7) Եz_n@H\BJZ[8p[f\hq"@3fDPEsGP*-98ɸ W4Qhh(Ҩj)pgЁmko|_N}V/r0G*8k1;Śs#pEkoFw-mW%=+]5XP+Re7޴2]uco~Y͚_X  N!vD @-ZvZ3 {3FxxI3ix Vɉ)3g!a~C _ViϺz\](yolgS1RBnk$ hɨ 'akw_٤ARl??h<`sH:ڗ)k2[xS&*YhhI}g5DQӌRNi8)쳥B6Dxf^5WPUwK,=#ԡy 7}uHNS䚕tH++?cLT?ߜ1[QQMKrg<[USNm:Չn̜?&6n!ɱ6 oԠc {`f1юO\=wjnY/iP@3&+1n䠐a3 0x W[2bz0PABskt$M[#p^u`jVE!A.fԨظn`pο5]ſ^;_߂ ap)r}xaS~p|Ʒ`ׄI \IqAѣN #jZI5hXfHhg3qHbxJ|9fpʄaϦL/&_3 OZl؈QICsbrRI"-]EE9lAqT`p~/EvD}llx,R1pWܞL!t.KfϏ.D?v~~16< #,fs&8&f3>5&_l52%.npƆQft"-V OPHi49b@WjTtX{ V,6ĊN$*fęPLxEy3PIg3!CDg#O*Ggqf$TF'F?3.:0AVHa;/`,.X`,)2&gTYLwD#$&$,* GhthhM2fE2d&QR!;DSX?+n`i3ZŐ"'J/-SnS`LhHl RfhMtS`l ) fGz`iQf 9f =h=Q×8~>W_2!lN/i=AE[cWFSrg0*X?i>oŗ0?ǽ`rWsVs5́*cG ms6WM R=\621ɑG*=wa;-Zz+?nj=`aKRw|wV[@1bx@W@yQo^ Oo NuN5O2bPh1l?v{Cb=yb/CyE==WBwN _{?^: 0~oKцoqWxx7?S gdo{ 5[3Cܑe]!\V L!3_'q)^NNaQμ!d­Q6k|“D6W yãZLapkÇkƨҮ׍ۺN TgeШ>qQaÇ1[,a!kH\>!9F[so;Q+<7G[vH4R}{Ro) }ガyі 0KJJ@Txtՠm[!6. f#"H-"QD|Wh V#rK ,5 8S1 `k+}?4=m ~Tio;W;{Pר#P-Tx&48sj"0JteDf4FWJ=-%RNGoDG3$5?F&Fz=&56#/^,5,GelD5+{A3Zk$ -mvGtㅒ{=j '/.yx0 {="xXoQ8-K(R|莨><:ͮ`fj<,$'uKx-!^\p? 2i9;wnu bOs3OB*9R% 4lgxRq Hcbb"v y;YJ mC KDcb@KHB~A }ޟ\*PaCޔ82wĨ{_0<.3YE Vch1zLǑ?`~NkM 7c艋r8v'&XoFF޿`ᖥΰ^3V)w$x{Yw w~,sRC?/uOSd2{oߕ P>6:8G;5(:ߘ0oZl>x,gI03d0'$g"D\zv߈렾;, _ g493}kwzW wFC^A ?mSF[HLxxM6Y/ |cuPK}]O8]M]wUb;7`h޴qj~pO@8ç0PԪBhc@$wt T0PbZUK᩸߼#vcGM~ZFJC8D9߷>8ڡ|#1apDgD(選)Hq4l3_jY$(#wPT(h 0l|gd}]ưA;Cv 0H HLyo5ͻ *ICm興YT-%.0#$:4X@LTd P'EpacCJZ6%" 0+C& z:O_cN}Ƹ{);v7~{[e= μOs3>;3r[nޛ7<VfIvGYKhU*a}܃Y,j4mI|e_LI2,OhzO]4USF: ,gf }%2Dv$g{H{(gM_=l+mbWߘq|I t l 4mtqOXP <]OheM ) pT*䌍gXcdFF<7`A3Bc"S̆>ȩs5^IO zֈ I0%Էϸ^6StAVI:w^<\ň@cPclw7ax{7҄>A!@oL؛6~* <@XnLNnbڮx soRY%IbW㼎?^c7(N엳bΘ }F 7F`qô}zX>M8W]Cg "=(ےxl-b1 ]]7-(b*[b&I#t \<0g儸O>Dʾ /.)?+o2IO>b,IX2uiXGZ߹tY;/Q]:.dk^ "r\E%`'L>YCr `R~7dOI&a>p4閈Hsב_G$uy"fel}\F'uPt'>u2M3Orw7'q72mCR_IUS#>_'$nCh2dӐ]*CC_s#>۽22c|/*G4/d^?&~̚1 cƺ>;qf l/_0 LtL,?sMJt$L*:y/._O_MIR7#LZDR6W,Ӕ̝ezf8g6C͞I3gu|8{r}Ւ^9K6\}_\'܋^{kK7oW~g{g݂|S qr%%,J_4rфEًYtâE.u]$]Ȣ n.,Z]uq~%JTr_]|qIђ҅4ۗڗnZz҇>K_Zo/pᲐ_,Pge'%/K[6|XȔe9ˮ]pYɲree sIU~_WU~W_-sU,WqVW)V˕/W٫~[u:_WU~_WU~_WU~[1+ #-6z& ;>osIKԣULL]z.R@W_AW_CҩHgJ:V x\-t6\E‚p<ݏCS,yAχm1y :ybP'ho z!R,FϠN#D.1B 6@N#Az*lk)g^hlP< NdX +ZL-M&ê/׫ A+Uɰ4tlK:X2>z:LڡHW> =`ež}Q\ aU& j%$2aU t94*\}J:t驤ILJklMtf3z~wyE: a=c3,~ƢBgC.Ro^RAWwTi3HO%M},zYb\l7El ٨zl`;JR\*KrT.ʥRT*JCR"ݬ>_dE`2 zz: Lt%YV|̖P \GXl/@ǑNKN#Az*lҹ[,W[ĵ,KL͔VP%`XKZN#( tZĐ&u=FG7BPÛB3j8vͨk80܌XSI =t6\*JՑXm4S[K-hK9|u4+g hDEa )@HgJ:t.jKx:h/f[G?mby tZ]$ͅ}5lAa>%].^zl)tZ!͇-ЩHgJ:t. ުnPwAQ_n~f惓{eeV^Hx庎tOLj:CU:SJIT#tgWq]GU#2F^VVyf^V𲲕ml<kTi3HO%Mt:a.evk/tzzTj H^t: Н]/E] ZUG)( Q5,GYDH(~1@vz."-':hi$i"zw^a+=mbCOKjq/]+}mrsX _nZ#1L(d)i_)RT5$TDzyb5YX {jZhZWuKVQVU4.jԃtbETd6"{LL*1sjN_oC$8= "F8DpNjpZNς9LbP#& +aZq<8NӛJpZNg-pN?SU+C/EIeRT. *)jit4L]Nnm9p8}ӓtN%qoGy N/&p8=N]BhncR21׃pz'8} i+8 {$QhBf)A/ N'әt>8]n t8mTd+}/~G:pVS78 NԹhp NG#t)8>Nw_J,[PXN'ӫi!8ųp8#8}_Qb% qb"rp.i=8}  8=N6KP/9-RU/(^t58> N/=mp NςS8 z9R<@zB.IgҷYy98]Nӿ<ƀYГq Ni68]NWӻ~NOlNp > N{)^DaENO1D5Np;p48 NGwrIjs+ZiP6Iyt)8]N?ӿ}(8=/4a(*r4W!͓KS|T.IjNp8}C+p!56Caa:&cE:o,uH?σ7Ȥә2iM] m7nlƊn6VԶq^"Jۍnʖ1~dä :@N^$&٭o m&`'z*hl|ؼj7Ыb,=hr7RzwYo20åip&MJIq:MVfnpmpȚuve(),w 6SƍtkqnΛxd;ZLrzV[!X[_GMϿ͋h1"$[@ t9{l4 FK6EWnh$Z-hݐ*Hpm FA0Jnju xIn &@ r&/AB8Enok˷ g毬,: r%m29 C ޡ_1qTLzy~%#C; yk]Z,2Ր%KprTKd S?? n>Wǰr1lL==!@xˊ`2gLkRE,=[ceA0+nl3]0F3V}&=J[όg{)tWY31U0y K< h5ZR ;>NwÈhJw7¢<,XAdYތK%J۽"3 SQp?pz/:DZn#b Xxg܊YPl~ !z^xh$b&nq7G=DP|( ݲmۖ v(g+j6WSӘ~DXb5)K e\hˊaC7osІxa6n,(|,+<`nY4dU=^F6Te訰K.: e,FDz0>W~><())Ӧm4!ĤׂIMB|]ˆGGdf5]T󨢭 |X̂8Icç_ld¬ "Id׻q,wU 8ZDtܡ;:KxpңS1),X,ߝ^w;ѥR:Rg'|K:~~k@CDCĶm)iv:ݥ Rܪ {8a#ٕ3F ESl!!&Mڠ"u-tk.h4mϔQI¡; v/jKálVshAAX$,MMMM{m괙q"UYLj73:JM~/M09UzS|>`($N/#V\r{Z;ֶrn2vw>2.!1SF,Remx23dFd]lu:iHue~$di6pgϜ8 TC1m6 NQҨ `0 fw3^Nj<`i@N')uL2/)J {6KFmwԨtbM|fi'FmZCXHf%l F%LϽw=7?G5uQEFM%d҅X: Sƣ m4Z}zv27, WUŕKYNYAu9k'̾ŜWϙb3b*,GkHdfxK;#pXNc̞bvaɦ F`GX4Fb`vb#W a*FMo~A҇I]Z\YN>M{dN=!t?cI!]Bz5{H?l鲥K D}҇HF$o}reZi'VuNDw>7q>b;F1quXoC{C_뷏8l=z<89q%e<̢ F&LyJ/(۹\Z{sWݑu9-.?ѽ3FdfrĝtSi'%"9 xx߮~oK㩯J=_ܴ !_P#Ff嵌A2F1#I7I:./cm8N俵uOk&χ|6uɘz-7۴\|gH>c$7fߑtm;3WtlV|y?wx霟fI٧fʳqtn^WUCBfkW欞>9ͽin!y8oq⟼KCv;+j+**Wh_!bҊ+VظϮxiE㊏*+*^} V굪CCU?Rsmƚ7jέ4rgWy?Nͯ}ږU_ҪU?[zOn-nYx˖[rˑ[dY浵ƵYk+>im纨uK=Qk?XҥgqG/]3coƥ#8gD~c9+У UbHJ>Qn@7Â~b0ilcv<ό!^q'ٹG#&s8)XMS ޛܐyQϡVt}Z~4 Oiݧ{Az YO n4?Bs\fZ?g\\^ϴ3o).ygf_,r);Fpz&[D㙯]1Hi?W=$tW:tT?#k2I;c?Oq|ZY5T6Zauԛciub<5۝sd`)}*8?W4\.⩦է|)D#%$UqI-k5BiC^ZkٹDbsqU#kfCu;AuQ=G=}iGwEf~|7d 6e%3݆`;߰)}~@Qk/Ԙw{aB+2a."M=6wwM]f >O_>>ǀK~8?xv<Ё#\:@lQ_HyճBgA)8 G_7)i -ph~ET]Cv(@6~\@/7|`VFfX5xwVʽx}o~ {(?H?ߐ~@)#}VUU#}(s 8oVo4pF=| ŵ6=p;q>2E@1Kd$v|w.|^G3p4^(}Rl< lg3[᙭Vxf+<ي_:ixZ</: iǴc1{U`aZ0r`ƼG]E(~Y({6 =r1>!'y9gTS1qFMpy45)?ivfXˀ@0]|i4pU6Lڃ?Β0k_Ubf(plJuJaMt/c1BZ}MgX ˢaY4,eѰ,EòhX ˢQ2%Q2%˩%(iGI;JQҎv%(P2%QIJP҆6 %m(iCIJCCђR]F8~{Wskk7 n,XY~eC3߳W_i4Rci7@? `00 #H`0cq@0L&)߱y0g`6wr~x#( x xxx43Ys߀N`;E}[56xx{2|DV䷰h};~=}Cza@8DǍG)i`;g/ 8XmBcoA]=q@<ԳJ"z'J E= |AA+q<F'LQϚDId0fX`@^S &ۄvnmBMQ@4~7~7%@ $æI`i0粀)TF[\[|KR&@zg(c2\ c|몵wh|9Ueqz4K݋թkgX1]=%Fit]1U\3.`uq2_}גܩl6wwx ~<<lx<<<<Kx&3hqz{ĉxߤ³6krkZ=a(TYnʀrT=hmm̓y6A~/R?o'hv{@}N,p0ھmߎoG۷ h{ހ7 h{V}β ]}v5`Wj] GJaRwttv~KZ`I44˃ŎŎ?7»XZ`] ku-RL)z=S)EϔgJ3RL)z=S)EϔgJ3RL)z=S)EϔgJ3RL)z=S)Eϔ0Z@ h-` gJDB>c8Ţ9h}yt?00D:>>>>6rF9`#l䃍|6F>`#l䃍|6F>`#l䃍|6F>`#l䃍|6F>9`#l䀍6rFL/Cmh}hJ8-\"Q#i7!ph#߈7h!?BC8;C8;aO_αUqRĹeG}n-bz]-)`-X[:6`p;phEl"6ZVF+bъhEl".ZVE+qъhE\t `E?1~cxɸ '0vO`잀͙(y\AHi6^+=KSπGBHUV*SXe La)2UV*SXe La)2UV*SXe La)2UV*SXe La)2UYI2YlVEG䳚܇YɓML +FO,iUe:?N}SoN3n8З6@?o `x< !0 0< FѲ]O-3Wd!kٮ.KU*=q> 죬r'xxRV (sW50E.f}ɯxL 4@s@kڀh:Hm8ІCm8/ Eb\.?>/rWp:~ߠ? x C#`(`$xb9[a1d9@OjߑB )Đ@-p4lSMjXrSM&Ta0Dj؏~ c`?1؏~ c`?1؏~ c`?1؏~-~-~-~-媉rDj\5Q(WM&Un vc`71؍n vc`71؍n vc`71lnbEM`;`T T8NEӋh:_q, 4?G(E{C*rHEr ؈l6bK?GFY( "TdRQ*2JEF("TdRQ*2JEF("TdRQ*2JEF("TdRQ*2JEF(#|dQ>2GFXH b!Q,$D(BXH b!Q,$D(B8"TdSq*2NEƩ8 g!,dq2BY8 g!,dq2BY8 g!,dq2`,@HɅN$g#9HF_H/ ,BEH !$X,G9H1)Fb)Fb)Fb) X bR,@H) X bR,@H) X bR,@H) %)HFJ6Rld#%)HFJ6Rld#(R"(R"(R"(R"rRRAJ9H)) rRRAJ9H)) rRRAJ9H)GRkRD H T#n*r-r-rحjحjحjحjحjحjحjحjحjحjحjحjحr)r)r)r)' XxS_`/ wOSo;u@gtq/m~߀ kkkkkkkkkĿqGV "XAAO:O6~YۋG(BEȣy!"QSXde˵HlbɠM_ V1j?lu-nѲnE"A-RqɄj@,ׄLOrv[Vk<iփa=v̶|5m۱JDL%UZ}di1K|@> 9bJ\X6ro+.P#sh a0ЃdZ>KrW &)mqe0rFX-XՍ V7Fج ج X UXU0Xaa0 a0! `g aK`C00 ` n+*ث** q0USU0USU0U!S?cErLu04Vv[e?lZ,g7dڻ&Wh|YCh{JvӺrv fsSXRy{Y9?;-r_.w>Ī!J|V-yleF(2ẓRll"*72{ɵ"љsܹ07?=]{8KwϹ%wlc~]ir+w2˽sFc~hU,2؎vlG3Ќmh6bZ ؅FЈC# 14!&lGrۑ.x"ф|}ȸ_`Y`=*鿂+ze5T*#ܑ=E;l5?pUF-~7Fq NT-_$FOrZzȇ qJ5$c Fh%FtCܩO =xzsRg03|حJl/+aX°a! %LL 01ˇZخZؖ_>뵰^ [I0_ cI'xy`j`Hk&[v}ɡ!x伀LЍ^`j #$ t9O 1I`{=#pdY ep_]>U*g핬W2]ƺXkk-ÿ_-r|K9]o)g̳ _Q(W+>FLB_#Wr$ Dŕ`ԩ9DBrI.S l[V6vhKa'y%lmP*e K7Cx|3>jZǵzG.WJT/mo|qϾ%)f9hZ +++OkH:.V@w|^SޡxI" R#h5˗shs.|B;9NEby'Vqv G㟘 &jwrcL+B^BВhxd5OgsyH^/ sd7g*o!Y`|z_$>#1D^U]NGǓ)JJ2T}:kKsu_c"zu>Qj>K- ﹁5>ȵXl^^_JT13_/ZC;OV0O >auNCZo݋_."-"'-6K"zs.Y}>bs`')xQnoo6Kff͹DE\ltx$bbJ]-FOWY,t]Cе3 ,> kOX{kciX{kߌӱXf|3Vɫϒl̩Ģ`QSoXn: %\OA˧Shy -S)hnOp5* _hnII|y7ڼR(~桽1w 5Khl +X.^%?D7lG2V4Vv14fv14fbF̨3]f)f6&Y8lHU ЩQ-Ѫ-.* .*  ࢂѫ ݩ /wuz#W2f|b"Oew>ѳՌQ2Cztezuэ>z+ֽ)ޣgz4 /[~ǬK`>0cN lgv6,a% ٰ ٰ 0H%0 ٰ ٰUUuk~hV%*QLiFVqTQƑM #?Ol"e HYF!g)#"DHWC#Ec69yVCt!ՐwȻcD"[ yMd{D"M ѥF$w3inu;F3L׫$+VxSd*-ay:lkY+'=LžΖ1;Oei}y5G+Y}%tW~]2kWJwl3z 6V*YY%+]m-VFݸeQF)*F(`}B_VF:Bq} Vp vպPXyk%g-dK6ْ͜>gNVS1tvH |>lA|:zzd7d7d7d7d3d3s2b9}NFQLFQLFQL6Q,Lf)#b#b݌#(su2Mq-ϰ#.@/Ykvr.lib6r{6ϓb"Z.T.L23\Ʌ\ȅ\ȅ\ȅ\ȅ\Xȅ\Xȅ\ўuna[XX15fL2UG2YO&Ye2ZY:Z2YK&dudLֱ5la !5dE][tSD_<whI`,ȗSvP*h[Nԃ=rrLWN')Tp8g9\'p8\.Aop \ _oJp\ׁJF~| +JJ.WV\ϐwAk:Z DO3!e{Ȳ=m@[Wa!>a!> T*P jn9?1?1?1?1_/z1 Nt2P*^ 󱷅&MlMܼV`&pmnwH(x < ؛ G&pd4|,.`ƒ &<`k Blm!DA)Vr>ʩBͅ6rp;r|s/AǠt|:> Fh9=BDh*O3Yx^EgHt4D_Gs$:As һeRMBIH5 &)o,e*3;] flGc Sdzh!ճW1P*p=xu>ʁlWiamWiw&he.-_Ѷl bSЇp0Q`4I`,fAAAzTA6 60h{ڞi.A‡ [F t'AIlAƹcccc t %Me} t]@WpVFci$shj>+`2g}Wtƚ̏ϥ69,u,u,g3, Ji_u J2kDSo+m AA0W/s2W/svǁ ~X0Nf%(2w $Ɂqa7>Ƈv{ &^` 7[`*L0K4$0p[c~ۏ}yyyyy9999Z'MK9{wQG,xA9{T7[?N!da20@ L&xxd2@L B&! D"d2@///O[ڢ? x C#`GGGGG777777M}xSԇ7M}xSԇ7M}y1Ţ&_kmM6&_kmQH-[AQPlP @9C!r9}>DN"ӇC!r9}>DN"ӇC!r9}>DN"ӇC!r9}>DN"ӇC!r9}>DN"ӇDzp%D (H$ D (H$ D (H$ D (H$ D (H$ D (H$ D D 2je˨%QK,HHHHHQ~>% 넏(f,*?B#]K4֍f˨'A2Jd6vmmD[*RE: Lц(!iFH!pc2Da"YD9(g,ErQ"YD9(gIGȤ#d2tL:B&!IGȤ#d2tD,m} xi`:x̐}}}RRR>(#>(#>(#3mL<&ϴ3mL<&ϴ3mL<&ϴ3mJFjPb`7u`DQDQD~D y_/D QBT a0UB*!L.m*0BHޏHÜ<̉އnQ5= Ki(@E"LE-"Eei t\O{|-UF̠eut%UG ESys)X6]e dI2jD"G#H$R P P /^F^F=b^ |)6uM]`SRfS6!2j ls ؔx C6S;6M#QC<_pU&QO6M=a" ɄF -lj ¦-lj i2!dHC]v|'kL4i6YlQdKCȖf-"[Q뇨C!j~Z?DQ뇨C!j~Z?DQ뇨Cd]A YW+H$ uɺd]A YW+H$ uɺd]ALGpL8 p`xXFЂdhA2qh;G.eCP%C B$X[BKZ|7|ߍfpZ?*Q` ؛g),2>",2>",2>",2>",2>",2>",2>"ag/ 5=^/>qWSBܢ7k7˴[9[KhyrVN!_ъ*Xt"[;e"^nN|$׋r=_6sdz?/QjbkPQ$geL.ՖԆ\Dۨ}+WjɗIFig 1یjk,-9Qk}Z\k&*n!OH~ܾεL1ZKGqHxnӘmѼo5DɓRW)VqZEDn%je"J >eUԣZ3K~F{+ #I5VVwB^|,M@ST4lqH ē)4x< σe8\,32[р<&~@s@kڀ 8t=@O .(׃ `y`>X> A ,_-b,r _o; LY`B`ll  |s~ X n0wc ?Ok:l0 NP*.P @b6MA3v=:dy."x ޕGlkrd=lױ住}9O-0|!$4g}%`W AGO}@ ݇w}ػ%2&{^oI`2o`xfYrJ_׀kuz0F~ $`xOd$x < ς"x &Ux&` xS~i,4I_6RĊx%N/׋7h9U$0a0s9L~mg٦~mg٦~mg٦~mg٦~mg٦~mg٦~mg٦~mg٦~mg٦~mgvKyQj(5k5JB:333S%G6~hZ#BD:хxK{n*5TjpQj(5S?Oaj&ɦflj&ɦFJ4:e*5Tj65BRD͓d<>(ˇɳar09p&m_&m_&m_&m_&WQU5Nߏi&ߴ7 [r)䔙䔙V,Ƃq(Jn  s~&Tu8m8O[*Ծgi_-wxm1\LmB 3=̡3yNgI ג/ҊmYɌc. ~h_>23 jߘC35hhqx(9ۑgmhۓ98`8rNf֙:vLӆEk*gVs#M䄥mhpTjqEo0$ @FIn#ǻ dMK&FfDo}8FG(0$0{SfMޛ75yo޽{"@v[H[X+$7od;Y08Y¼ӊղhJ8f?kvqvsk7ηi#d6IM2{gavљ;:3YHsH%H5YwMQݮl^҄'Z'2 iQ*E>^J7=HLGL(Rop ",O'#Ծy,rORL,Y)0{ 6L|,gvFZ3vwd\?;qBo-CUJzL*걳8|_dG2Lflpg5wsg48qgV/*ͮu;Dr<]oq[lQ<|Fșc$'BOg]٬тr6׊*6#g7)5od0 r irm5ssfͻI{73;ugݎ^k-6f-oc;wў;Dfyyeqv ncv8^1O+w/L+3&nqm6Dm(Z5xy1b]}w/=\ v,PyN|dL2b$N^$xrOrc `6O=9 eUy1-ڎQɭ0:Ww)oI̱K84磊m#b~u̯1:W_8EW`#ƀ@+0bSF><|=>^Uӫ+G"DM'GG/!}裿}<՞\Q%L1N瀁jcx< yUu\oԸިe4booȼmZ>(hKrJr е 6gK9S /ׁ [jxz|V˜\K{jg28sﵵZƫ=2AO6*ZKv0JUj%3j1j=xg=6PV2ec~7T кԵ5BRziIE؆PgQ|':<5LdyݝZbף{и)0`gBq9qauBȃ5F9O;k+Y4[5k+|z{z=:ߙk]vzpܓkv<@WL,Gzo3p{p')8;[8#9}`^*W DδmEgׂٙO+׻8߃6=9׋JN/[BUo\ O-YwZ5ޭV5Ȝo{wdNκޅ]~{p'{qx*MkMlVn` wDXsgtMWwѦ;mzЦm'9r\^ۊVa,s4wݍwgǪX ? 48ZӅK՞#V}z'UWR RGS m6V5Idի>33կ}}Zb;56m2RύeڣWƷ8{cl`diO6V#G{(4"dܨצTL}h2Vi%%ZWmyyռ޼^7o4oԶ77km>55||T+5Gc=x]56uy0'StœfN[o3V,sh~d.ۘߙ?'43۬6+Zޔ^^-'zO={~< z/^{{jZu7xoxoު?};D&yǽOz>}Q?}>;;Uw#Gyy .EoJ 8>}b& >+>9]B;}fB ]9|s}?믧=/ =/֗ӗ}ڷZ/e6o@=]ܟyۿ_2xXXĬF5hj5ZXFk1)#zzjM&[Z'XwsYƹ|3 kqZn\e}e}e\m}c6~7YA+hamBƝV1Ye.+fjz1! q5Oa$tY x16x->x=9Øeg~jDVk!^?|ǀ(&YǾE$C8?p{Ws1Җij 7#xyuR2*WʂQA[d̔1yHD7n0Y*?32ƫgwzȳz^]! C~?ɷ> zSp9xܻz hGk_۟CNrMi{usdp-w7YHar+{[tTcc^Ɲ'vm7xGC8Z}d}:m4yÌ\m!t9ExN޿Gguw2YGGgh_rM/P*^=TV_.mmmQy{;*]Aޞ`PTg*Rv/eS)95㟨w*ej,>>VVXVҩ5LP69٩5PrZCwj ة52PʝZCtj Ω#zP8u6IhW&Q}MbMjU=(ƨh$*-tzř1l!Q#p@au*U>ίAYhMb3sD(+9N5C{DOрF6w59P4S--"Qݪn-uhyvtm]}mk{W_[RF/Z*y>;D/NxEwu:E(V@Pzn ^Wz^-5zA{Nwr?Vf1"tr=\ə̫8sy0kk׼;鎝{Z\k;O@D'6]t30Mͻ̻DOnkE]+Rk96CG83*Ts9QF#y$pccO2h? 8Sh>o L4'r++y͜ędf2ŜSͷk93͙3˜Eˏ̏89{a,23%8Yj.eVߙ+afN0e9kv͈8iFaĴE,e29W2ZmVsƬa&1s7ך\gsY/Z{=`6p4U&ƛoo &ƛoo &B:ii#~%gZE{ǻD[{~wtM@*5Е~c{;{z<3o3ʌ;n]zE>o(4f7XƽD~4zS؟\?h?fߋچ7oXYx W}~u֮Ltm\?\?Ti*mm # "^LK%Lpd'RjT4w` T{DS6tM-}^}O4nnO9hwiwqnm.ڿD}~PhxJ ڻ^/yj}^j^^f^&4yͿt|U;Mszuuqf`͛h8nwޭ=a2hy?x:|qO7ƙx:q^s9{GiӍc=a&x:4%e8^z=+^5_kz=z9Ž;;kG{|\?~??~Ћ\~[f~wf:w^k%^z6kzvkz=e.%}_=>Ns}UQ($_yHpP]*4ʭ /\ R~-Ssǧ4hM4śGZ~ihhCw t t|Fhfh9#0ff~^5TYWExG?[>Tnwv+3qףGgDSz;+ȯn`0r nd>Kc2I'-VFWr7y]9O8r_9]>&u'eq1_6鍟dM}DB7>"ᾜQ게PQu 9~w(UQN~^y\&?{$Gi2ыroWϗ;hFN~{yrl9':T*L/|Vb/oWK6ɝ?*k_by| rsckoQX}q+~+Y՘~'{%wH.ы\7gc&#nsIJ%R~YOL0G65ˎEֺ3՛X>~ݐ_}Z<)j{/kl$׽K?Kܑv~ףJ<'|y_z_e/Kχ}7y/~bs9בyc[Î~?;cO|io[YUGq;6?x7z Y>Y;Mğ(/Nty}!o喝s[1/pټ;z?}Z3wijld߁ Lsݾyq|gx w%;v?Di;}G{0!60pZ9 l3~-t#JSq!??d:o颺j!~*.6wrmյG?ìuy)?o3=*({^ɘ98P*7sX_gdYVOTd?HF9g'y{lwʕαJ.w^;-{ՌxyeCLz0lm i\$?Gm|8}Q9=yķɫ;p%aߧx$wkr.[\?yu߸ j? }^'}(zWcy I:#=-,jϮdn4 (Pg*^ K6xu6Tm Tb_L?us'Ry7J> Z;4_&Znv?-Xl-^,Np#n_qy+g{%N-w'+n.!$t'{eKC)eX aìa@o&:Y64%}ʡ>;Ňos=QNj+8֯;]MŅ^c*E_uYWnSJto(ÕEe|;X|;X|;X|;X|_g93s怇("!BDB(AB!B1^je/әa%kZKPkXky-5Xz5kԒwu {yso}kYg|2FӑggI}"nCΰl9_&6v9 ;L~eG>bc# W?؟?!=NncMr=Ş" 2!ő430%f1 Y,r**Y0lYLlC+$ЬoL"d˿'?4Ьofzc 4cT*f1&EbcޘfYo?t|oJ |oL{cTYEs1kh7myxco6yxcoi7f|H iv7VAJݍ-YѼnl׍MyGh^71'iqэr>bhF79эZэҌnl}Ye<+?|,l/c~a>"͸ƾA34%~!}]cҼki5-}]cB󮱛h5k4ͻn卼:ͻ3};k/?~?4}}f_c?GSY߱^Y?Ѭl-(3ަYؿҬl2&j^T,c͎JʐG-ʖ͏ʍʕ=TS=8TUU&ˊ*=UU%ˉzYzRSQ(4Y&{fwD*i6fklm.M3twdߧd*(QM YviMi?@ɓh64O>1h`2H8 P_<}B/ׂG~c~9r.E;}%1L?ES3[if=x^^;7>;|ag3?%E(xYyOOЧǢOgѧǢOG<'ѧOO ;woaS˧? '@ŀOG1 $S6O6,%I] +yVǀ3dQ,QBgdŲŲbk0 Bk"ֺ_"S]DCUb̔)_O>'[̖Eߑ+*&'$Š=K<"+XbbYHW I"SB 88Ef*>T|Hӊ_:gW_A˸b(Vsso!3Db=/).Y+~O`e0+ gFҵ GI&YOpmz3'P/XW_aI%9''ŜSV8%łI E nq'.!9> ՝ s <'q\ %aT.Fx{qiQ.?=Nr\&/9e ?= p90Bn!rE""44p+! 9YΕ%""\+p_uk08 }8#cls9y>OJƵ9\W^\`0n2z,\/,|H(7I[KQ@xn6D+WIO{ $怅`wwwr`07 ~E^}F}±}n?!w;DAas?&٠3~qǠO(39ƍ;}>>+<w<}}HNsX(p87#5;w0%2Gs OOܟnqGR* \(E"ػXEs 0T3\A3f 40h&`L$j&2j&`L QD\$-('`PN$*'4('xo"A?5wAPQp,(h=C|⻠ %p*tzhy7_ /Q-H4UZAi=Y:11POO追E QLCQFSQ*,z 8jN\h5E%F%'G͇zRTaorT2:h;vAm 0h;`vAۑhȳ^%~-5/^ף_OF uP}@A?`;H* $,U?/|<(, ,a<$4 A#hHBXAdV0@(I0A`>6uD>͂7^ ʲ[Vh} )t$I !%g ={^8c k`dРpZ/ zm +FU*$lׄͰEBʕdrF,3) ߀0}ޅK6v aw={>)'@C ]`л?GC#$]cyT8 g~-c 0J8p 8ơk$To`y$r$tԘxJIVcY b1͘dA̗cLʨ$iO4a= zS=MrAٕ.G=͢usD1S}B}"Eʸq%*8TjTsPEex޴= cQ`hߣ= {G{g&Q`G{^=Ug6=5eS{AĠFGbDTRyhZAai iPd1h/B OӠ&%7@.]Re~{ UP*@6 eEd˞= x #0Xk ,zݿġO@?|/(g@&GI)i9i&d9j1H9T@!cp(1PWOP\P\Q;hC?%*8T )n(nSM_^>5}9jz@+Q+QC^z]J=/"/`4)េqh Sʗ/WU0>5| y"|-_밗3%|#ףpF8eX\4Q. xx}yo|9̍k54y"-9,߁_h oCpy }D>3q1 y^Ę߀iS yf`*F;G@S,RNF8cD8s =AS|gJ!y Β g C 3cü LE^ꥈ*K!ieY2hEHq5 l;h'7 Ls\t0E7 sG+3H%Q9Ry<jhy1JyL%O[z6'A|'b|"F&`d-O_L#`aLr0&ØN8& ǡF&'I_ g &Y1ɯ`qL12 4>Ih<H3hS5|/0faT#M*>@b41C4 >I1`:ܤ1N ̎ -4`f|(&!&\Yk0s f`ԘTK3cT8c1{".bVŬG1ZqW]oA}}ע1N3c1saf.̅阹PNדB ~jkB40X?e'a 0 NN7  +X l:P@: (װol+ű^+ ZY^|8wypYi@=*8BHcaP sŒˁƒ]]M{+5_6 Ӗ^]bu@Qc]ӡ@ s)v8@)mxi@ GVc=s&8S:ӧx3+xhfgnhずۜ^jrG7NVr!WF=xt&YYzLչΦseک!|>l> a/`5.썝MWS|9smnhmoװyTs\ɚ@`-O:w@r.l;|hʶNzQ۬3CсՍ[Ak|9Ķȴv%0Hjȱ]r+rNGR`5$p ^..klmXO ݎ&$evh9[vʎޣyVo{!e.}uK׶/Gnhl<p1Ga`定1GI`ĺ <Ж3bħ偃g)$> Z#j_|}#-'۷i |}wE}.9NX轂ZE^oXNCi{}M~*p{'mgk-3Xip= 4?45ch]bTRcwks>|ֵ R][`ĺ8^rmG9W]oOkuus\c ]T(ƹ\p;:nu ɔi \g1\Ks]i{(O #n 5=$&ZZhzТYr,D"wp; \Nwg7sXf!h֬o :tw=ltM Afksr]gvN]lhN trx!TN5IHtk@6ֻ8&x-ࡥt -p*t@D!nJք`@;^rꎸ7 ut a: u=Z=LC }&#^v_s/ֶ#V}slzQ!$Rmhz`g2l th'˶;=;AZ~(Zw}:Fw=ZgBrh^AڮaOԧ{T,O|h>ד:/𤀾{v}'+tX_ k { JOqhS:ոSzjK@xvq ]~gsW~g[W~g+YԴ+<@ʼn: U~ȳԍ]{=@Łmt{weyNvztӞٞsdIŮ"QixП\sF՟Z /zphxW׽s5[$`'p=ތ fH ®RC$4A@Wa\CW0zCwiW!ۻAT|ܸɯ fj*Pq؟(S)QOR>iOuETEtG^`?+Xi<E"|8/TDҎK'eҊI9|8W2e2`hk~ʇO[t O"-7a;xX&`kCwAN)?ԚkSCݔTۺSmk:}yu=-=ՁAΎ@mwB Wb;б+ӧu@4t``TǑ'w[n1ާB`vrnۍk}VD>4`'l΁ |_שݫ댏p{Bgb_=3ig홝Y}k9}}E}[쥝e}}; #1t.-Fyzhdo\1]Ywj:}NGa۷Aٸ=n ,ξxcLJ-F|[OvXڹ!pBq2 Ƽlt&v0~O綾1Ρ+ vJ~νQA־PYΣ}x>y}OɾsnG:@L uU~AzĘz@ϲ*Nd΋pGsmJU ӝץz2rK2' V;oE +B ~me5+c\96ec"7+ĸrU}250ޤZ 2[1W5Lc UqvWA*wSB!\ڔ$p)ke9pJum*XYO˪rO㾕KW%4\TRT =kW:=\PwT՝m*w?]h %Zr3S[mZ]gQbLg2t/59׻[zSj*r(jv";[ŦN@˜FӒ6mI7mh^RlܽŴ%{gu4 v6j)gR}E |0ǐLG[v^2ow5lvәgyӹ%Ŗ+--]F[-kɖufybniַl:̱-;f݁qq#hvj}mr33'IdI63ZNugV[w/5\4\17LFjFk%=業\OyyScַԛ = fgkroM1;[3{pkNߚj^ZH⍭AyKkMO{ygkCOywgy_g|޳|ݳ|g+}=;c=S=V泭{Fwg>:s|u}hj릞#['ZwZHp ׺'\qBeZǵ9mIh$Nk\d@%BeKQkk֛=7-5{n[^2Z4m|blSҶxioKUIgq[ZC@[Vo&\LhmJt`[Yoe}[eoey{o&ekے^rm˂!ˎ6moe[f譴y{kMÉ{Q`[wH[_^3U)+81{/wώK@oem!QkQJQYN Nj6'7]2ػ֜Զw[.m݌Qg'a\0dn`B',C8Vr$ d"12MdYl*fد_#seH\"ITG$Y }7-M>d&|d`Ɖ7eX>&g1kkw1}SM/}L<$3m~LMLH+Lי|E^{̀2?fc-c"(=I-?+:fbb6/N1'Ǹǘ\6Gi  ~]|ݥ|Nig*=ʵ[ʷdm&Y]l6wUesS%)G?%ӿ+<-SQ^(>-?zX_T˵ɤ.=.!]BT=/yXe5oqꍳoR၄䁴9E uW޸7&7 ĩK^Ђ)ޯ0``0x,>Qz?Jww ~&a]췡*wbQI*ߦưaCTW3?C4NȘSX!]Yll'K%D; Yy3,+òs$3(ܑsLlVnSlKmmzm0pmmm#bmm'mg;`;l;f]]ݰM؉ 8{=ٞȴER{^ookF*ǾzZo︫al#} 0ew j7&IchoJlJiJgOh$$AtQ,(J$B"EPI1{^>*s&@br(qd61C'c/1$՛d>yʃP??Dޅ0Jރ>4(%A+qrf˯dByJ6N>kELI(Q<&OjLԁg#K~3@> 2 gFf!: #g0?&F'O)3J,h6gv/s ^ć3_~iutHnӼ|@PP/![ k`XVmmX{ Z[7YZwX{#փ#Q i6-ޖhKCɲ lŶ2[ֶĶ̦mn ٣m}Zf6ېmmm㶓3P.ڮخn&r(9$* ,_P- /?j(3cgF+G+|ZyZy"Z|$dSSA+OC+<1(LhYhhO砭/D[_:KѾF vO--{1Zv1zYКKњk^ s aP\\|2jjD5Zs Zs-3 v\gWH=7x o Ů$5D,{##R(4`gY:s`~!an6Q1`w/w9hI)Y[s=nm36[8;Z;o n9'l[]װ I]mۭ.v;duYc]q9k+vB{TWmܕF WgvX\wZ*;WX]IVZ窿/(/S)]h쟂h≵]NWv ])oq͗e=`]s͓]8:quz5)NXON g]wg{zuzu}vֽpLpݶ7{/vroqnfܪ)Ĺ@'RCXOwg܉xޏN{ًGoKs߅Lw֧@-ssu-"wP.U+?wtؗE|]Xg_Avt?2e'{<#ԳuoM&KS`;cE#a:\Aݙ Dٙ:MC۽I{Gny}Xc?MV&X30OMSMaYꋚ=wJ mqkZ)2GE{ֽ*_CMgr܂t֛yuޛXMiMWMjM|H;no#[o#@1}9Ҽ#^#g)py[`8o9*=A:' wy0z{w8aGw]{"@Dc,:{X=)w zG'[9vx/8{#ޛt@q{qRNZ8S9ND|^|)˾t'8nrsrͬ5|TRD :34J-Ͻ9ݧm򙩝5=6׎cBԗ7Wk}K|k64k};mP׷>v^ep!~Q{hm^;޼wyL~y\b.l|n^[t|:O&S5֛Oci39Q r\[]IUC?ߣ|OD??|Z?oVe}@*7 7 DC!ݐeȭ5K eJC~P,x 2za !Caְٰ0deko8d8qpppNZ,+^"ړg31C`/?Z se(;h~AsX\b_CkC54>_Ci5Q~ Lf%854.¯O|;{4J!~}.o7&~}IfI~}7h~} V7*&fV2ARt1]&ZD_o%0ӿG^gc# MM MQZ`B|=y}'f7Y/0pVuKInnNPN]Xׯ[[ۨۂn=q}>MϡE]S[Owac1SPaz~e8w0T|Mc ycF$į xYߴd#9;CS>Kޢg"EC{@*-z^{L;&J{J{J-}>E{y(hѧF賴.\aBG‰E_t8E_K%O4W*RɹXr,|]QݺRT[,Eȹ,z(irOյih1 ak#]Wa:#TD.Kέs[2[?],5pHzj|IUkG~n-ewD赺oܬn݈]j`{0rGpuD?;_oННEY7.65h]3ΝT9U4bߏ{LHm8>hQgvwXQ ^8z|K5ONޡsg~̜[L$>hk цX9`$]!l9NmȀgg;o!P J 5\18Cyxc:ΰP#.7a,:khOiзiO#vۧ Pۭ?gk k  [ q.aa7}Pl*XØ==,\y:' t #1r ?:3q`kho`onT7bLm239qc>_x[XcX0;>A_k1C(c@K|WF]wpoƸ67n2n50W{GGOFㆫ P.noN/Xݸv |2śM)tݔl{1BouVEx*x[ `>l13OϚϛ/Fa{ja0[9Tk,%Β`Ic-Qi&N9ߚdFC5PB)R)n)Ӕ5646h*jjm ePh Թԩq@jpVUz XFW5(\f`"U杉7cY&L>ցL#ƽi<=)UxQf E4.3DtK?*Y.`FV&R?,v}TXsu`[b=PC῁c"j88{QCۥφnJ!aBDUVk4j^>jq >ȼ9R@}Ps?*Ͱm}*ail[?*`iY+m76C}sMG6>Q9u[a_M {#Qyo#2ǎ/'Sv2FKl}MS>eodn!| \]6*.TNhѿ6d@R#U*5*OߪB9TXϮ koydd y8NXjt]{z"'Wz-k8NemԖ= r}:ms]c#:pg5pz7U-[UcR;*X` ԾI\?pS3U7D_T5!͋<"yܙ#}QEέ{Ք\Us;W ӎ&uxjXt H> A k:G:{D>x oӭ^?9Wi#ai_k~jvچo56S?&FVɗ;ʼnLM=}^&9&2'H~50^ 뭡:&D#inxG32'Kz]) >a>+>,p>W zX꺈Ffw;kƢ׊y&[05W)Z#H?Qk]8%+4WҼSS>t^M}h%s?"mޙtNaS6:-75 _cDY} pSC}[O5t<@oD_T:%A@T D\],)eJ@qBY|N5퀐jX$T s ZYmszHڷKc˫A#V>S ztX5jS[}EcK[=T TkDM4zP hT]5jQ hi"kk>5j5F̡1;}+gG=FE2 ӶeJ@-` `@ 0/kCvN.J7ץ-$!\lҵ]p@ Ulfk3_(8|x>~)`9@/[N_5u-퀝vm>iE:cSwW ȳedVv<4Dq9i\@T Az|g$ߪ9a.fbJQ-$UTe Ne&Ϫ*yAU*U@$zTU՛T?P !QG$&q߫k>X̄J LSgMJu,ۦMo 6uwԟmۤ퐄]ιWdA%le]"+P5RQWXr;-+AaNr<`3pT\"W*' KjlQ`Qȃ*CRT$UVut~~q7u03X_E <۵6szcb}8//<'E;奔>z޿b?kc 닰yJ܎>0_#_|NxUx}Yʹ.;u<҄VaL?Ƕh3JEV`|czsnz>ȋpo.}Z e {"u#>m?Vw'';uGɰгO(4 "V"YBYfĞo)tqY֙q%h#B;+N~֙?`Q!pCnRf*2| yg~#7q쟉ȇ?7CO_~0)~Ihǀ*Dڇ|#e,qXsPe,#!%_F^!~䫔 p< b^SbYsaܻ [NcK[ց"!#_E_žxYjX |;GK-CW^*ъ̔"Ǿ)^!~d:›4D6  cs89zGQ)DnDFKP\=!_ m l&qIa<=-祖`Êh3NFSFK8'~@kPbJ$lI–$ItdG2w=#")Km~.7\_Cv"7"|y=Oc GGbuň,Zַ>Y'Gc-OXdzU[ cfǰe7ΑtB ѿrAlX_KWѧňd&z>Y8~WwH>gӷϽA}\C ֹ,Z]Bށv;GSʇ^99PyIGtv<7qK1bw9Q\χ2jzc{ 觫A#< Q<ˇȟ(+Tҽ/з 3%c>%PO@9 o^TqmrTdxϙQqC + AY)8_FDz,<Q]8Y|dHچ;ܹso#H"X%L109dd`r䜌dsu=3f~w?{3553s*PDC-< x)Zy@ړsf𣴲yt-D{̭J fwљDdG-pnd_(֡Si5&q/ӀG_.R$4^LR$QFm8暌:P#vCdH>σ.IsE! `( E0R٠ဳRN&~Ð0ڢoQ: -maSW O1h}Hv.>Ek36d1eQ/S֪ A)Y z%v偻-%?.Fݺk}RO˳hK2s鸖ITت,Yy?Sctv'cԎ2Oeh`O$ u c8Rb$  8|U\8 4.z|"js="F"F\@WV1mBwԣ,'#SC61 Ѻc Z.~|nj鈊׹1En%EBr37%6흍`ZsT'WŐo ?Mc!Wm9y p## Q' ِ #I9#{t[fEi xKihpq c,K"6nê9Ag;гxxxz.cm:uv5toD'XPfdGwҥWcwv^ ؿ$B5:;2ca${ h$N5  vVvBfgYI?p-HX8ס9+ @J{Rf2]ˆf@OPs+]\ \E)sh+[`]ҏZdb,S%<>',Kh]so?b'`#v`n7g8C)ו _"N |e8A@V<;@Q9vѶ%=F%qT.Nv6L2ޣ=g4#eh3!< E JO8 2ڞF:1j$5t(,V:e.\HKbzvu%JwA̛izvhy,-_R'fFFeT,g"zѐq1lDԂ@J27a\v@'vr 4WWp$z7{v[L,'&3f ̎|@hmkU6 X{.Dk wG0`Ak׸jXr2N=0PΉLfh+ ?uL%5Eϧo`m BtCc ^A~,TFn3 Ch̝^~E~B|㒻; )y]<(FХϰf^ *e&#.Zs2'omgqg +yzX#vܳM$y:5 ^ٽP[rLnJmE6e>:a.LEĠX7zP?Ӿ[Lڏxhs#ƙF8zz 2u\I>h7HL{dٵmbCj{N˾0u,xQ)2i?n5u;pZ2p`F|Mr#;YpEeGЎL{h%7Ҭ\c$u-?wv% rW=$4fK9iF|@V=kAyޱ̤RمV1CO0-Cny ]ڭ(h./%&fQH9>R{qxCN؄vwԞTgàd5i!_R=`؃_DƴOIAoD#wGYF8YƓW/lwsKZUS>ڹ_i.>)qZX3XFM{Fh$bF;4v(1Fc3vUTDȨ7Arp9h 4TJPwN#;8d+2c\؅[+iO5$Oɐ愶T( #m7L][kk]]1G/3;tfGOwVF)m /}.;Tb~ޗ [344<ʴZQt!ld=Q_k* L N1c;Զ i0 B؏ꚹpYX8b[A]`Xs`{xN Oq=і^*53{ Yt [23B1ʥ1.S@BCQ,1(HGJK@ s h&,qs6y!9ehcH2a5<끇 Xz|I! Eq4 g@28xN79'y;C&2霾s /%/u{>$WA/&Ihhpo9tj`2 ^õ 0,Z`d:>I|tx}]|x=4OwBc 4đ<6`:ILO!6mx UuzNrF981987J{C[oh{,ypZ@s$]ˇc.C|9P+Zx#秜AO; 9dJA2b -%nTBY,+nQiI6fyaxBWM}W@ӠBa.žz}8?!82i@cԪ>_GiJuĘ9%P8 `x0 3#v'Cs hh\+D}0[aU', z!9 >fsg' t;udQQtY@SЈ"YrS>X).,wf4@AЉA[U)$> tbE`Wc@~w- dghyYS0?p4 p=/x%^| K[JO@Pt`'B/A(bw:" QX- BaqxVFH.SBr4h| bv*F߳ ēڜT]01ACBWFq"`CH@/:p6E"<?;lpbdI|.q1N;0}v=Ad6 ew-c.:Z!Q<w<\F/0٦l S jV3#;/r-wLD;BI6-v8 [ )M{yуҺfhx<Q]lb=u83pBzh'';L4;CEfQ GHIoeiжt'~' ɛQ* 4ٓ8\w W,ڶh~푂wg@ !7/=Uz1'Hub\̡D,k-虲 y>XP~ qoQsˡ!A(  f +R h4HWV'd V[H%B'O%ՠC24ģ{7srO%sq GE$E3Ci}=HF ~V:`j`.BM#z09ZOAtut5ikZ"^1F=6chF=`i-ByPO=! X ɫo #҂ΌҟU^-@V?!GkE1}@f4p!J^6*c#}6~ɗg=ǀ7ښVAH?襠&AwNfETm&8cD3)'N/ԲQ x:%( ҂3ږÁmGX v6f⊰6RXRx93khgogThGdA2d.IJw&E;%dA*`(,ȏC)q2Z;8¶0`f 2{|2ָ3:=ACR Ex';;릃LƵ?,@煆Nl-9\~%1wԂיlrz2>Of鉅NU 4sʀop ИF/ 17e jn#L_L#9'rA]gL1#/@59 z&/-݃R1JV3F13"ׁKM?,sـQ)躐 0B+-(\Et_`5p{rVCndFt;eo?=qhl< h|+~zs x9jӁ^ z*ltwt`VM )z J;nD_J#u1X~tZ茸ӯЀ :1"| !tqH:c] Z^z2a0@3#ͰDO(XF9^x M~AvN6g輨x  tMAM\34l%0nڐq+u(KʔbG gc<{Dx  8Jh| F pp>NT-9\ jOLmSqFv#5a@Y"xbi8 ,00-A/ 4 x|cvHh p"Ha4%@Yk܄z`C =ԀD|iq]4sCМw r$T@4v DK?Zݛy#넞Π[CG׭ 3Ƚ h(qbgS]q(Z@`7|O(؁Ѡ*K2,+Oo$c恞UwH '1h~2bq1 tZV"]Ao}@{AFVԺN Ԋ6E1QJ ??l(nzI (At|'2#KiDD'b= Ä_K<`6@vCƂn z>x2=ABi;AlԒg=p=Q4o;mb .6E2FxzC8JKd#9mYOp6G_#~'PzJuit\9OB?Zm;ENUgzS- :z"_+'pΦ/2WAЪh\4D /z 6! HF~GGH2#IDe!ㇰvj\˄`n<ݛm틯C>Ow;;`2$Z@r4=c>39m)ɻ:`?D+/  '^]9X 싑zxhȅkFi$ u|q^C]kPK/`du!ν+̋WG얖h$8 : õ yv@fp5J7m^>?5g#vpzMڋpq: ^ kexkh8^H%s"jA-GBr9<3hOKO[Oqf;GH[Q`cRbsD]3IѪ3Fns|=z<ˆ:/Mok~'nDom[Dwgtݵ;3G;xZ":czBz{1vy|(}">ΌՏ~g Dߙ~eB.Ӥߺ%hG:0/$/P.8mL,Nh#3Lh@rQh_p[<80p^>{`>zIHfG] :g@g -tVCqB>8Cm 4(QҷԵ/V9<=}R3FG(M1=s# AZH}[K~Oe\h؍_GNXn͡_,pÁ Qq quTЗs+cwkCTt{pmԞ(PAPkgevoy+&Ռo,V^| b3 &۝y72Xh->e5LZ3׬Q*%!%eY,eT4+J k(+>c=X6Mv1/KDzd,{bYm>`Xg9ˆ)|0 b,KbV}ZvLl^eS :gY VgRdd(6Ű/X6MӭU+*֨a8kZFp6Zf , ˡW UguY+A_)5fdW֋ `t bYN E`Ieґ8K kKcUuZk{6}˺/@ XfR">z Q<ɀ,\h`a`wVDNn^]zbӀ ?viӡg5p#ppL:y.oZ veeF Kjc5vGikM\ ܥ1:<<|ԥk. B/z~`00mx3#EcU-퀝=rq(KoR?WQqbЙ3:* ^#luts Pęx댻3$; ;⩿RXJJ $_:gcF_8rU:(e,͖mq Ϙ\o18:8=\9fqznhKcb&{=r?ۭ6^fys}w-ywΫ=*jT28֒OAn?LԱfbB!㯠v˫mjڢ9~r=ML1* @B4^BCR5sdzGYv mV3/ﯡF];¢:"XwwTq:Ƅ>;q:q+yhPt[7pܡ.}~ oH^v%W]kVF{?D{((fڃC BaA`=lA;`T[UioRGidSp/_>M>l1 ¾/K6\a_X$fE2}+RTlH/ҳ"ʦHQM1+(l=fͶb &!l+Ʋbv8%k^he)Y% rʥcl-2ɜj$sX+sajT_eF__1n|0ѲQfc4emuSg6b ُl-n:gA= 9]z- }1cLPű[P? ǮZn 1Ap4nACp4Tia8}cנ8v A#cLh[78vń.kPnA#4v7,2=4޵2]|ZfkɮEZdkEfZ;"s\u-2ϵ|" \,r-ص"K]|ZdilXdieE~t-kEVYZd+k\ˬu-εz2\lt-kͮEZdkEvZdk=EY O7-ߵ"]r-k_]q-rԵ1"]t-rʵiWθ9Zke.͵%"]\q-rյ5"`ð x"Zk[EnZkEyZk'EyZkE^s-Jcs,e|±O܁E"/S`Rq7.鲲*[VTv]ewRʡrJ_]EyI^WUyM^%o;'|$!}ikYIVbBVUe fֲ β3Âd7Mg=df^r r2K",4/w˜Hkg#hd22StnvMd2]ǹeY\toJ%5WղYF=纡FR#Ha4߮+X11,k>6FPF"#ؠ][H#bo4J2r/6];.[{>,Nw9GkGZ"mRQmzhEt\' rYnʹZ|9޷漏κviBT6ڌEB=] l !, +6u$FY ƱlȾs~2¦il:f{ l6yl>["-aKLGrdjFNJul=6&YGlvlۭ^gAvʯ;ʎ;civeyv#%v]aW5vMvfw]v!{'){ƞ%{XdbGc 7}žfnߴ#~j?/+;N3? ~______," F xV vT Q 88H $ $ $ RR "SS33f)5{1];3eE'볓lNc5=+;N^r.ɉr" ֭XaݺuwRb7B2 9xaL4`{yq}^A6TIIJFUr]q3 }]4T[%Po@IJD =jz TED&DYQIQAT`*2b' Kk_]7kfji+eYYu2:YW::kc*ÿ_ V7WW;.NbI}PdwTәs7xu1 9tq^F?؟O'''SS#YYt R>eUw߯* Vniwc qOg*J5?\~]V)TJ/os.xR YX(kx枅7-XvފbyyކEOy{w=YAދc$>5+ATt1KM|>*fH1ox=Ӥ_2T227[/di +G{;f2fb31Oa>133_/x*6O|#<<yf$T3ݳ,,E<+=;xi.!^ss7oYoY[[VV!oo?mm'55|-|_[_ ouv2ٟc> )/>V]'..g 3{d9M.?KuV0G:mgg޲γks /uRWb'-]f2Si̴{fΌ0ӛ̌f&3jf39̜f.3iFy̼W~q~i~y~/K2¯k:7-C|"g|!_W2N˄gw |#1R돡-Y4rW[ꏏfeUO"1ÆšOZBYÒYOџzv `J0iYZ󞞯XX:<ՍLMv,ޗȻn,P>e_,GzOb9 ^rM|3w,X^oˏ":5]ƯmsԖJ#D-QZgEE15tXGa{Z0x>coF1771qww]ҹt/7KW, ,^fYnǏ(ϲ|:gu 8~{k忳:dEtLLj*"/t_Ҿ՗BIQMe D<:,˫XCW[AGJ } G#||L_\iz=-׿9z0O2erz]z*U)NLGD[+}9zk`޳{%^srz-dcl.ł]K{?a>XƨacLyoHR=J3˯wbwY1}3BCX{-b=uvk 6N'Tj66~l+]YDZz=:I&;slJlvGg}Ƈzcd.Nm2쀮F5]#uȿŊ VOC_ &}S|7vio{nj.N{ҡ%ՅJؿYuͤC q#I!qD YC^ġ !␍8GRCB "%EJ8Dߢ{Zm9>[<0/+uMy[މwӹKG3\W|iۜvG!"H+2lںy6,9qW?:~ ؐƱ/cc^&}b86qlg[8qlNtȫ8LNGcUfJ:^f ǍD8yq&1BG$x"Yu$HyrhW{t<н>1ϣ ϫ)y[>y~-x-y)zS^Fc;/ݫ; ?5v5Nj«hl2T*|=^ihfZ^ &tt-βY@:ۋ dX6fr^cvFo>ӞBzKл퓬qfb*jXc&ZXkckwuxj+uS_bzZV﯌6qc|&5`1=ωGϫ結qv~&{+2[}쏎h ) "1x&xc<c_@bLEVYlf0[m.fWJҫ*ʪ*R** *JҪjj:TW]}~jUjƪjijfjZjIPNmTV]T^_T_Qu\Tyu[S#ow. 9K3zr=y[ϙ7һ2[5wd^GuE{vSI{{s|@#h XIG/֟}9֛OS7?O?)KOT=M{>z=x?㭏۟;V|:ǎW?)Dq{oܛ^?굾βkzz;ά>(6^~fle:NhEY?%{#~Ӯ^a@O88ϪwB4=ODN}w ߥ_ncDOs/5o 2BLѴ%qmw",[PM'4^USi:Hm"Wft6MEvM9%"M5=ELT1Ud9Bo&eE3 keW+rL&fMWAf2izެ-^B!7SЧ y^P zXج-ޡT,C\2;Do8cdk~/oG‘7?ʑpd G #@82 #@ !yG‘p!yG‘p!yG‘p!yG‘p!yG‘p!yG‘p!yG‘p!yG‘p!yG‘p!yG‘p!yG‘p!yG‘p!yG‘p!yG‘p!yG‘p!yG‘p!yG‘p!yG‘p!yG‘p!y;WHoҌf'(%fO3@Σ ]If&_v7x3jFV'}SaNQV5e]XGB[GwE{C:mb;}sR&#W蟢VdcKdp\$yuY|lQ)୑׭nWw4S6џs6`->9\߬1-fFyn.(vʌ |9?؋mwQYCFԛ%Y{ͬpTѶo/3[/7dF[EN2eol[%\,N\^0 z{k3V\yiB+1O6nM Qr!aMn{5-׫sOFM$Xjv_M!GZ}V_v5ywirE*^B5=BϾٷ^ŵe$K6p wyF4ҹxh{4 oHrą I>.&"2YN(wn/|?%EFV0܌2?hөp:qլcܝ>mCܝ:wl޵YLܯF2yiFȊ8޽]E$ތRzߙ=Ǿh[[K|#o}@ف/<v,Sq˻s?X0qhpWirsLБΙULRuذUj<:8u٢,N*;NVbTȌً{n}pJ>{tUѐoDm}ֳ_Ŷi5[GX%23{ymZuZ)牌B0+Y0**OD;o1(v [~UƯ:x ˮno ͕vtן7lSo4<K0AgNq%{%ݺ6I&;WSEn-)YaƑv˸dj؝Aw-bXaόyG/4}Ú6F-=}_kwjgcM٧{x\^}||W>jKs/L؞iθ;!]<϶d~XsπY[C߇n%ojrMF 7^z7cMl\FB- Zh$#kPqbCǢ"D"mgi1>ZFTtd:5dϓ722*Of#k$gt9-`yr6׫_&ynXC+_/L^@ĊtqձSDA.ڏk&mD3@ȂM#uF,?^(DL~|UDww=dڮUgUqnۮ mE/RGSYx!m˫LկO֏(^nwZm0/_ЭңӬֿm'r4Ĉ,Xz,&ZG#~7mp i7r4)IQ)# z ;q3fuԮۦeSCq|fl1 rDh3c60֐%}'YfH$R!LY*d/e )E [%T:|s]}]g΢nuqv 0umN߳h^%/{"iJ7 9:: Qi)|ZI7l ωКwi 1"- љˮBk㧅qWhpGqOXk1^~u޵Ƭ8} AJD4eeD/2WOP&('V:aK[ny&fwᖔrJb&>2{?/+9+r S .3{k'gU nT;yTo-Y{Q n۩o=Sc(}ϧHUq&=r]9p1>z  }fR"@( g!I[b3K94MsI"Ps Y-΀(`:T(ϸ.@0=l?Qp?L_k.ʙF[mDCp 2਍7;,64s9ۡ҂* 4$ *",mQ &15 /'y<,aNoF ȭXpl)4ՋrM&SigE5Y[QP2)?ϧ` lmӸMJ2MWABGUg[66^io~bU&'?TTD_WA[buRwxdh ɾTk: j{[]VVlڜ9(qp9,|iXdղ^lw:@BZOzb>w =d3\X]^fz -_C]߿ ګӠIs,KMp4D]PBXE#r9S&Ҹ 8_FM | )Ňj:Hgz sؗξ1аfW>Sy6g&>UKȃaW>d 8;7P4t_b4| H o 4& X7zBuv@\ª?:PM+,Ҟ+Uww]PiHg.nV} Eiul%:EH>"Ut {qp`Y)lcѳk27BXzS=:"446bL]=$C`R[2K'%B.ՑSkOm9XTXpmk.C <{naj;,44j%v1F4Cjr7n*cP/)-JR9љ!gqNLiWSٝ#[0DŽ_h7M+^qU+M%I7y\f"Cl]v]b{MUXj3,t?q`V@C|e5ۻꏫ8'jJ㺣!/0M B/Nbbz )tgV+C慹F:@/쵼h[@nD$&mT?tJ'ASw|@;,HʅF ϋOo-P:_Y:;'on^x!;@f@H\ 7gG-=X&%=Û0g M1RË2() HHtc:_,'_c7s!}_;Т 3yA~Eew#H(0{?>+1ŨDAdW_ h*cRVjX'=)wѿZ Gju]YrXS)bvc|=xүZgMۋ?zeAJeRߞ]!:i'&,adk}v+m_(JGP 9ԡ[bzD Mrm6ʱl+}ﴉ `xɲʀQC1n>y11炥{0C27C B|ayAc4ڙ:D5 ;*S/,.H=Ρ9jذ\\([W,v;c܀ -6CZqGJ2r4tw(|9+$d^H7V)|TXnAg"(yjwb49GSn'eަB3i\ԛ£^*mvn6-f.?趌hnkا0u3QFx9F o3 7qofOKĿж'. v`O ŹQ8V(%4J/IkٖOe:yʠ}EO)Ӻu±0j\d o:ÿgn |ak]eFsUBdpS=xQ(;tp1Ze)yY'l!!| 9hMS.3h"ĿOK; =f\E~,J?пlb>%,*XEYgpw550p1Ȍ{XNNE'mhY7~w:&\]FVj=֛< -jm"ђscKZ,7>OQepbJ5zAwQ endstream endobj 4 0 obj << /Type /Font /Subtype /TrueType /FirstChar 0 /LastChar 255 /Widths [ 0 506 506 506 506 506 506 506 506 506 506 506 506 0 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 226 325 438 498 506 729 704 233 311 311 498 498 257 306 267 429 506 506 506 506 506 506 506 506 506 506 275 275 498 498 498 463 898 605 560 529 630 487 458 637 630 266 331 546 422 874 658 676 532 686 562 472 495 652 591 906 550 519 478 324 429 324 498 498 300 493 536 418 536 503 316 474 536 245 255 479 245 813 536 537 536 536 355 398 346 536 473 745 459 473 397 343 475 343 498 506 506 506 257 316 435 711 498 498 401 1061 472 344 874 506 478 506 506 257 257 435 435 498 498 905 444 720 398 344 842 506 397 519 226 325 498 506 498 506 498 498 414 834 416 538 498 306 506 390 342 498 337 335 300 563 597 267 303 252 435 538 657 690 701 463 605 605 605 605 605 605 775 529 487 487 487 487 266 266 266 266 639 658 676 676 676 676 676 498 680 652 652 652 652 519 532 554 493 493 493 493 493 493 774 418 503 503 503 503 245 245 245 245 536 536 537 537 537 537 537 498 543 536 536 536 536 473 536 473 ] /Encoding /WinAnsiEncoding /BaseFont /ABCDEE+Calibri,Bold /FontDescriptor 11 0 R >> endobj 11 0 obj << /Type /FontDescriptor /Ascent 750 /CapHeight 0 /Descent -250 /Flags 32 /FontBBox [ -519 -306 1240 1039 ] /FontName /ABCDEE+Calibri,Bold /ItalicAngle 0 /StemV 0 /FontFile2 9 0 R >> endobj 5 0 obj << /Type /Font /Subtype /Type0 /BaseFont /ABCDEE+Calibri /Encoding /Identity-H /DescendantFonts [12 0 R] >> endobj 12 0 obj << /Type /Font /Subtype /CIDFontType2 /BaseFont /ABCDEE+Calibri /CIDSystemInfo << /Registry (Adobe) /Ordering (Identity) /Supplement 0 >> /W [3 [226.074] 891 [498.047] ] /FontDescriptor 13 0 R >> endobj 13 0 obj << /Type /FontDescriptor /Ascent 750 /CapHeight 0 /Descent -250 /Flags 32 /FontBBox [ -503 -307 1240 1026 ] /FontName /ABCDEE+Calibri /ItalicAngle 0 /StemV 0 /FontFile2 10 0 R >> endobj 6 0 obj << /Type /Font /Subtype /TrueType /FirstChar 0 /LastChar 255 /Widths [ 0 506 506 506 506 506 506 506 506 506 506 506 506 0 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 226 325 400 498 506 714 682 220 303 303 498 498 249 306 252 386 506 506 506 506 506 506 506 506 506 506 267 267 498 498 498 463 894 578 543 533 615 488 459 630 623 251 318 519 420 854 645 662 516 672 542 459 487 641 567 889 519 487 468 306 386 306 498 498 291 479 525 422 525 497 305 470 525 229 239 454 229 798 525 527 525 525 348 391 334 525 451 714 433 452 395 314 460 314 498 506 506 506 249 305 418 690 498 498 395 1038 459 338 866 506 468 506 506 249 249 418 418 498 498 905 450 705 391 338 849 506 395 487 226 325 498 506 498 506 498 498 392 834 402 512 498 306 506 394 338 498 335 334 291 549 585 252 307 246 422 512 636 671 675 463 578 578 578 578 578 578 763 533 488 488 488 488 251 251 251 251 624 645 662 662 662 662 662 498 663 641 641 641 641 487 516 527 479 479 479 479 479 479 772 422 497 497 497 497 229 229 229 229 525 525 527 527 527 527 527 498 529 525 525 525 525 452 525 452 ] /Encoding /WinAnsiEncoding /BaseFont /ABCDEE+Calibri /FontDescriptor 14 0 R >> endobj 14 0 obj << /Type /FontDescriptor /Ascent 750 /CapHeight 0 /Descent -250 /Flags 32 /FontBBox [ -503 -307 1240 1026 ] /FontName /ABCDEE+Calibri /ItalicAngle 0 /StemV 0 /FontFile2 10 0 R >> endobj 8 0 obj << /Type /Pages /Kids [ 2 0 R ] /Count 1 >> endobj 15 0 obj << /Type /Catalog /Pages 8 0 R >> endobj 16 0 obj << /Title <> /Author /Subject <> /Creator (Microsoft Reporting Services 12.0.0.0) /Producer (Microsoft Reporting Services PDF Rendering Extension 12.0.0.0) /CreationDate (D:20211207010007+01'00') >> endobj xref 0 17 0000000000 65535 f 0000000010 00000 n 0000003144 00000 n 0000003341 00000 n 0000962331 00000 n 0000963731 00000 n 0000964272 00000 n 0000000065 00000 n 0000965663 00000 n 0000731247 00000 n 0000840091 00000 n 0000963527 00000 n 0000963857 00000 n 0000964072 00000 n 0000965463 00000 n 0000965725 00000 n 0000965778 00000 n trailer << /Size 17 /Root 15 0 R /Info 16 0 R >> startxref 966021 %%EOF