%PDF-1.3 1 0 obj [/PDF /Text /ImageB /ImageC /ImageI] endobj 7 0 obj << /Length 3902 /Filter /FlateDecode >> stream X \[o8~N,K\I&`!Ǵ.]i0?f`_7{HYd[m 99<7Dl&2mQ 1 m,in>v!m[۰Ȅh>P^vdTÌ N#7("HLB5ƈ aC&B@j++4849&ǔFmC3թQ hk؀ƨ6s}/&W$ěկo7BwͶĐIvh&p U3%c돩0Gy|Um%9,I'̪t"}lXwZ#]w%r$sHfYzGghGe[FDi&%$zZL3yyꅓ(69,LcUXT3Yx} ^w`tq_#C $Y0kM+,m/=Vnng~Nk)ϠM|erp;;\ǰ4B1f7Sx9R =~[fnt`f(#x<8g@"31d]Ha/ ҨUAVYaؚtK#ߜ^AE ~a|5YەldZF++١k~MyIZ`nb2Lia{䦭wkLH4BFuQv;,Dkd{,}M!t2i[.1܅p/xSW`1=u=2%8=R 60; oX C c{eԝٔںm<#+}6 afTd`NU}wI]㠲&R-tềFf8X f׉A{; 5؄IOzϹa|B.yX4,~' tS VpPd+!!ΞUϵ2J22M+Σ8Tc:8 {|JhV +^Ru5bdN :zkLLXwiKS,v[>[ͺ+{髲fݕG 3 2fWe7T)SfWݕ1t_mmtAWFҝV5X6+4M6ֶ;͠ z#NeA_v/48X4^@o&ݩZ2 48XˎAWFҝJe͠ M,t]Ao$ݩPZ& 48XKAWFO{Y {|<\Y,7&TYCf?ĊbzC/BtƢD`^UoTG Z-*EVT+cμ4F^2о8etp>ܰX**F;AͨV}%37nHtP7*GϣXxH7I `T!*^θ#JCkLYS\=l75*E ih;"UhKuq~/.j-I颢S)>F~WM[/ zdEqi:(/UJ7XF`56 (2Ze ZTa@g 1 Whe T!,?Dބq^kwNVR!(||)o]o`Su@PO;CU*1{GYKñ7s/ESQ'.og$&ם*e^7 Y8X۫u-׶j^{ *E!i,l1lO(t/K*#K7]#R&j[\Yhky2QQ`D K0K"Jl9 F;M`+&|A5\E0M2Lem4E)f)bCs{0Wq,JxYaVf*lT)3;0L<:G<Ad1^eww],O#ahdߏ, p.%!&OHL2\vso@ӡaMZOyeaC]H\ϋ}%){fi$j~EIt/!`2Jzȏ_?8mο|}4HͻG)> ^ɻ>\ҙSН@7ɰ=w44lP9Jĭd\ $(;1]X*^Y tSl޷מt`#m<|A10R}+RxAvȤQS& łȹH/F4}Q[r0 !7S9jXj`FKU3H8$H.˿WV2_4}ϳTn|y<Q0:FØs(n)Dh6ߊg;6esOPxF HD*΅ RHa237ø'\~DB`\Fqa){r!|+[XGNbi 1:! 4=-K<.5L직:H/tNM#hw endstream endobj 2 0 obj << /Type /Page /Parent 8 0 R /MediaBox [0 0 595.276 841.89] /Contents 7 0 R /Resources << /ProcSet 1 0 R /XObject << /Im3 3 0 R >> /Font << /F4 4 0 R /F5 5 0 R /F6 6 0 R >> >> >> endobj 3 0 obj << /Type /XObject /Subtype /Image /BitsPerComponent 8 /Filter /DCTDecode /ColorSpace /DeviceRGB /Width 838 /Height 351 /Length 727730 >> stream JFIF,,JExifMM* C(12ևi"-'-'Adobe Photoshop 22.3 (Windows)2021:08:11 07:17:510231C^px(HHC    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222C! }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?(& rx5K@,Ωǰw푰&WKB8ET?J>$Oqx#OaY_6)Կ? [Cdgǘ=??qZy~!2&Wa~2ea_s'Ҫ~mylw2]ƛwlIAԫsc)-[tnta\ =xJw"_MG4Uܯ}rZ}14#kD 85d:Б '_Ekĥ.ײrZ<濕{p)2yQ5_K4M4p~UAK4LDGQʋDMtTf4i!4/d3[‘=_@ju KOgfˉB:};~rkc@ 5GǿI̓<OS%=˾9ů|>֗W?fHM@wy_* ?%+JkD~O?iQV>XaRA='u} 5($y Ӄ뢽Y}oڭ~ʥfi4ƍ6}Sfk+|v?O*5A{WN_ȷc7SאVD =;}qںҼLӹG1o>_$ݷqVqIt^2nVV:$'?e$N7c p>u%(EAr24/- 5aҵ{x#4L@<8=sT0²]ԓ ==q՟@j{}y{?N 8`*Tk"0s|1CG>LJͽٻiLMӶ8D&i:r4u U2pEx_A+Ӵ hаǽgH2\p%)lo"n#.F֫<I赭25]9&"*Pw5(`؈vVy$xu7Q#Ŏ?byK\/}9cdȵ[O"򣑝[_e|\sОNkj)ԩ &"0D>m4-VKȦ6䲞qkcK<Ԥgi,NI_SJ:W_@R"я)t:I; 3Tk6{bɿ 8=pslHmOd6+<ДbH|䌟JZI<9䃒0Ab#n7Wknr=SLx2{++뺄rI'NJڕ N:傱gy=՟Euמ֯5R[-2x~ d"qreg!B|v_ŭƳgwJkM.yϷjHbH]GZn7mo"QPwH}aGwoR9spssS 9RvW_#̢LĘ~vؑVAl?]M|ؚy]4)Va-cGa+L@=Myv-eXZL3,F4a!@8w3i΍R+^>>qy^G=9/Bw3[<jeA$ 2 ;V9mP-ګn  =piߑkВKkh1Ra%W#AԃPn'aWVEehAc=*.-zcU,d@"sGy#kduOSGbdaxiAϝ~>_QKFegqjE֮нu}fcdAe Wq"FVz~f jt[c-$ s#1d1#WE]T w1 *.QW03ƲFʰ8Vf)մ`I]9wJnxkyLl @ߧjΌa5dѤ:ԚZ`mD񷣩YލHT4V; ƶzOl a${psyBTQxNnV1ĈUT[Z:/l㎁4˙52XEՙ'u X#SGA9l0:Oamhm[\ !t~(NIn%Pެm{ 9,+(\rM.mE9nm[r ՛"ԑs4YE2qq r7`nc9?+g8Z/m5;]FLkfAHctb 8-'݃P4QƚL`-,'?>S`'d4'y vf :zWzd3E#Kq#dăW9Vm+SisSZ[c"Bw>M[$0mvSX7o$A YYbHTԚwF5߂.v+1 a?+Γm#5Q\.#pqw=1bxbyHf`(mS~uG3iV}OُwZ.Yv#!Ot?Qj8sE..̉[}2K,aD%TV?0W.)u)K{|6 r+j6L7je#|UθѲi  2eղkf _>;us{|՝(AҢ*KSeb룂X@#ɷvIEP(k;kaGk*šm"=EFN.ğeer\bKE(] G7EsU)>jLFjD6^ m-# R(ö>e su& .!v4:U*j=`m6eg(?P:ŶchCmck0Ue''v[DQ@Q@Q@`((Photoshop 3.08BIM!Z%G AVENO-Logo_4c8BIM%,7tzSҷ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTprintProofSetupObjcProof-Einstellung proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM 8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIM]^CAVENO-Logo_4c+RahmenC^nullboundsObjcRct1Top longLeftlongBtomlong^RghtlongCslicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong^RghtlongCurlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM ?C}# Adobe_CMAdobed            C" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?T/c][rqeUvnunncd㡁p;0Cx4{qɹjw:4IsnC >Gk]\Yy bә?,zMytONQ"+8O6a3&|F<_/qŌxB5uߏ?+(hOZcc&q i+?И=h-ֳp/?y!&> ڇ;7(?>>y_&XV'??>~0zc~OFXݵ9==WNֱj|f'9}8Q?[p-N00ZO>v֏}/l.!p?[?o~<?Z_~ tlx,|9ۆ[2]cfEFf5y8UiQ4K-^agt1c{Kàw~2ǐ㔸"wù@kwВ\O:Ak]:7FhFkVQEJ:G~-}z% p ?/2u޵7 1hQASmKҔrh\e 8e_TɿS:NٙW[V㽯f?Cv{{*}uzk|=/^²*X4 qEݿYf ' \cbŔfFQӤHje1$Om?K9OU*Wv8'" YΣِ?U+㫮:m>u얇h#mlߤnǽ,oY,5M{]{?5O)2%^8|21GB|q\&>Gݗeu^oNv;˿uJe&w5he>b,~3^1[8Kѯou\q0ie9V<1λ#eu? Oˏjs^TϧRҭhǽCXF[f=VUnO:Oq캍@5ÃzeY[|C.)O?6(G,c`qā # %oѴt˺~8kXNvKwouƮrh>zhkQmUc-fFC$/c>_]nYAyc[ '!N;?Nj3<%+5?vӈ j۴6ѳKf_ֆ%fgi~j"bӿ]²,ɸƍB?Λ?'k\ EˊU tfcc2cw"7?HǷ?\F,،6W{4~&ؽa hkD4pL)̓! Lc0.F pǰoUձdְGkecI&XjCr*u7Y[s$;r1# Dg(Ke] plb :\ߦϤ9qZN=HnΛlVznloCΧԱ܌lkC>g9xĈɔO)#ؐ')6bidiJn|I?\f.$J=t.H(m^M³OHypN,tW/GFeō2[WPeyN.dV7Oh`lsmkl;Cߤı(ޟMtPnshwM]c+ݑ=5_eϠ~&D(!~QrvdX3fܭֲ7ퟤ`߽Vm&y`cܠg֭}_?'װ6>k}MObf^Nn;v5PWs!1JcC# [0?75f=WzX=ҫ%B555uy,SN߶9tG~S}l9<_?Ied~G{/z_kKqm.sU]PVe]K˟,Gl:Ks멢{2*lُ3k/Zލ]uܶi~o8GU+8db2GT߼oxWY{}_LZ>^.-cbeёUN-WF30]C϶kHN5YYcp褘+77 Xdy|lFDDY4;.߮}< Ջz@'\ȻF]k[㾋+\g=c~^.57s[=оtc1ԇ9kϛ/\"$OQl@b]yָZk}= 27_[jdmh'p8aS9%2e)˩1N\R$ TI%)f}^y6:Kѹ]e$O;dnZI @:~j~YM3CC呙]ӫ ]IAc<j2EJ;Hq>][Ϥ@e"̿{gв I_2 (w< -j>R?5 /8xpߕA9XsNuHp#UWs v-Ň,?5?ꓬ$bӐ}zo؜ۊha?xKo3LWCD:"t'a>7;mM=zՏL]nwWQ>jiʰiδѭЗ=3#짃dx 149Z>KHEb+֞?ԞYk~CO^qz=Wpk/v7}5~ts]`]Ek1cCZ4pxh,&RI$Tʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$8BIM!WAdobe PhotoshopAdobe Photoshop 20218BIM1http://ns.adobe.com/xap/1.0/ AVENO-Logo_4c ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$C {/o.s^4?SL}_=/±Y>_q,|{3??Dߥ ?g~(Y>_pa?K׿H[ort?_zX?+9zXd?—ωhZ\Mgo++{'4vZ54Wrt? _˦ۯHbEzF)/a"/+'uC᤿vTC5f/N)s"}}ύয়?-ƧA" 2w1ۉ]~yt>ӗ?]F~5H6Pq۷هN_~>#u4qI56$&OڛA_-o |T2kG͘w/=O41YCw,_)I|471#c/M?L|M?|w~aG~?dFs~>p' e⩧׎O$Gώx?Tu㾞'_?nl4㧍_x߹h--G-7Lo'IAf!1'CftG͏Xo?WgWfk+sm{O[,?3k'Y ?\ГmWx}Gˏk35M>-[}͘w/<'V(cq1dx>ojMa4l~!bq1P~~kSO/i.ҟYg|4֩z ^o?_F#0nC [~yտ W >ZVꢚ֑7X/ ?x?7,WX_ơ 1>,SNh*|_tnvS[:suBϊa?JGk׫uMjZzˋ 6く_šY?Bn:m>5'/'5ij𿈴j-m $y}@Z~V蚿 zwY0JTQ_O(|t[Dg-[j?xvb%(_|/T!|Oŗ+I`]ş_c saWe}B ?>!|b|_'7)/!IU0xu+?@xG?7_&+5h#)1??{"L/϶źktv/?ξ&DR8SƵp? ?L'ϷX2ԩy O>O_" *_\/ϸQZC*dƾ_TC%*~"?//§!ge,z巑 /r)_ گ_wŗSG_|^|0/T2zN7??ԣӮWq5h~u'TpkQǎ5/?§!oɿȯ?|*MN Fu|Ÿ?Gƥ~(?o?zԿOC<38p90k??=?†>9('O!mɿ?3c'`()GSOO5O?y&!/gދ;ŭ0+>_(ǡ~!j/_~2~?w3ߍȻ}6W EA &|'R)WQ?MA_~2ޣ|SoΥ|W??FGĝk(S)~ĭo(kVe?f?N_ًºz>&k_4h)4ɿ?֜/H3~?ȫߪp>"zϟz$Tu??럴 mN_~/!Q?8~ȿdcW~j|G??4]jC"֊="3V?O?!~%??~z?U?&?Vim{!c?!ɟdck~?ȥe_ LL+70OM{oRj?Cg|'ߪo2º~v?#J|O^ ▽|oRl??emSO+9 IZQ?_?T5?_3?Y0?FKs?-_~r7Sn5?¢*kgT9?oɆY~~=>?c||WRh?kGQoGC~C&"<73?e p _-A/ZS*6ЇjV|Q3ɿ?,73 xGi/DkVO)zH? টm`S*7a_`4"*?F? य़[][O!iɿ? 73&&«U_g MFR?Y);?7Y~~Zc|9qWKG<ZM?QB? ?7`,?MZ>ڤzaWKE~9 [O|poXS(wdU$y~'RU¢ۋ|Q_~UF'p+mOZPgV @*Bޣ3 d*Vi+l?MŷP]|Nn*W({x?Կ~7t5b6ӭ".|Qy|T2~ۯO!3oSW|ԣU곈!CAK~_;_m6Ǟ1ԭuI'BmGjV+ "sVQ!Rj =O{:"COCf(!$yr t06s)`ij)kp% QkEJ 3j#$YC,ȮW UtZBуϰ_7j#ף+KVmeEhfQEQEQEQEQEQEQ\犾+kmkNq"D̾ӭLF*v*1rvGGEq?0C9xoU֨2~Ƨ'C9xoTHx/ /*Qe5?mEq?0C9xoT}j/;j+^_U0T}=OqQ\O4?r "^_UZAj+ڑW !7 9xoT}j/Ixb<}ڍ3~tR Pq# &>7g?ZS!cERG=/Q7~LTeaKRW9`}ac"N1Q`ioFOʚ|;ҷ5/cQMS$VZcgzcOh&)nʣu旱jl: u* G[mTn0*=Kf!З2M ?EQ43Q6smc"co?wj7{s3M =P=m0u Σľfd>hֻ ƢnTd̖jLnḑң:2 Ȩ.JfW:~4ZD`\T83)*?Jʵ.KMmiK֤/8\m)qңMRzsZp*&5>%ͦ/Q9@5Gq*kiK\?J i*}M TTm:~u'5OF}<~i;~ ~>˟L{ySOJ\Q6 L:z^#8-bbݫvJf)5W/f(5_ʘlqW{_Mf3֨o7jiSʆQk|E,~Z-ӏ^OڭvW+/k֜􏶨}e N?H_?OĿ:&ֽJݢ#Yz<^g<4Qש֦[.粧7'd{`Eq#?r "?<CaW?̾G;j+^_U0?̾Ƨ'C9xoTHx/ /*Qe5?mEq?0C9xoT}j/;j+^_U0T}=OqQ\O4?r "kŸ,͡nKFOL'GNNђoN֭3rD9VbȿV#$^ mK6? O_]V ohWmK5MX`0~=?]ѭ.4]KO@?,@lV\eI$rAJOQؾYOvk9zdF Vݷ#5y[߶Ե{_fNrdZ#k}94[$νoyX75@O?_?ΏIGG_~E~/?skIG$[#/}M o?S?Ək}95$A?k߂>G5@OgA VaoJMMĢ4ve魎_|9;E7ޖN୏KoX5A6NiuqخzHzGSB6j7j74F?S?Oơ} H߯Q??J5TFSTF?OʢT2)74ק74ר4ҡ0_L4}Ƥo(5 o֧c.߅J~Qv+24:iRY xm?*Oj6r7QJToҦEߥ4?JiRRiܨߥ">ҝ'A/pJR4"_\7jiNoyJq<_ Cj>IQi1?J?7G[B W\@տ?w?U[Gn?M-,cv7ݯpW鹲_\/!g|= O)_ʹeļϸ|Y_W[k|k{4,P. Y_j :,VHU|iWOծsW˄.k?<XN=;_O o?S?ƾY|~tH??:oW/}M o?S?Ək}95$AVaoS[E~| |~tx{07_ o?S?ƾY|~tH??:?ռ?mbG/?sh_,H??:Miij%j#P>_j[_>EM> c' 5  +rV/W׏)p6'ʸ5oV𬖫%\jZ ?S_,.pLE\U%h&]K98Q ɫEWڟ2QEy/ YTQVEYW.>*| Ő[$?>gce>@ |bތ^+ڧ_juQ=ƽgp矽GC<#ۃ/w}Qp{4no渿GCP;O|=ۿ@?GkhTn?5> jiɠ.~W7]7M:?S7_<4J<m Ѝ~wƎ!Si^"ĝ/ݳ㦿5*Y_Nͷ5kSJ׺׭dl_x/=r uv_՘Oៈb> [ }fD:Oԣe߉5[ RAfcd=X+"iؐ<֧?iGOqē:U0_n#'QWn앚ڿT~G0¼^1&4T_Q Q'? _af#F}G8zO~)|<־$jD2$Ո3X0η1V㨯jO楣G!_iru>>m>Z+G0pE~< /vZ+=MOTςY]dӖ]ξNZN M!ZN1 'U񧈴{;+[đ:)k?br>OqGCU0!Nw喱{??Z8G)0pBSZU|E>&}&ݣ`8+! #aNy3\h9.-QAIkL ,RȽ8' z0gJf`ɫ5{nگFyM԰8u6Ҿ^q0~%[#tvkzWS<7kl2Xai'\" |5Na {%q_Noivq61FT`W~!\T%U(kVLnf*uqPZ+iw=φ~$ O ZcIU$W"zѿ~ >Am ?O}+8 |vevlgxZRRU_vO.cQ٤lcmH88=м,⇅ִ]>Q!%NZχz|GHs5G q:i?wq./'(9(ɵfnSCt+7e}>eo_[֙ #4g"wGK_~7?+sZ4V-hY[T`ο/H?|?:W.gkONWEkVJS%?_?N}}_v:h6';7,9+*K^:tK-+=3)2L//c'44֌i,{w1kϷ}V*]O[WšyͲ}+~Ϋ]Ɵ?i#Qfo[r7K0$pz5 {qo }|@ԭ +BD~Z'Vb&ͱd=O8KMl /4 O2W|k8bhwW|mR|geCWIpO~&I&'Z[IZ5/ A9?Jusqs6ï5uĸ NEJϙ7ѣxʲK诧g7_\_'_׉UZX$rʗ#c{Wޡ_&a5C/?.K1x8j,䓲w}=pux]>G.JNn+KÞl:g[{xSJ<N0}q0$HR8г1s^*9'ugk0ܓ_F.J?bo ~|]4a ?d@M{-ަų*Ye5$ԯUo}yO;?$ bnnIB+vk Tb_"xx_IO aI|H#??W("~wU^w#'?šH@?_D?!`忉|=lGjJ;m/x~ᎦmKg̥Z9 W=S+XBicFQr8VM?ppj3޽fش^ =>h QC OS~U;R*\)uWK5iz>F8:Y/񧉼/kjjZIpcc|W=JVl WL[6=u$)5K9?j |F>&z~k޵1Bmx;M<+`k_tKǪI|!2` 8$WU*nrUbis])+9E)4HUBP3I;wJjSQjާe][-x"wk61^A?xSҽ1_;ş*/Io$ƾjb;ek]b1p:6 ;|I R/ί&R؏>q9e_k__ u#/m|/˨FjmlMz" i:\Gn5U2phQ]91Z> (P()ËAUɠE+y" _{V?a\C-6 ExZ~H|QiS[_ V~O%H [ }fD:Kku;դwƃ18װ 5Eumc 8yOVJ&ϩdm\}o]r\cH᷂,ǜ\?<+(;Ub';m=ҍ JъI/$b.7b?{-?Q[~l@~;Cn'bhۉ.r<}}2So?4Tmo~c"o~87hfs/徱z.(q0Km緑࠿$O^\>^I6^_ ԟ?Pk|hScᖫQ JW& G(~뗄xy6e Z]^tg\s }c&u+(VEM'S\~>գ0ZLm*N2=\Z#5B%Vj?Q*<;KxVs֟2ʄwQ>4?X#ɾ>J~?[׺~|Cq;Umu"g,~( Ů\ w_u>Q6Oot'ςWFon!겦N0s^)ӁUb!(4g츜<+ҕIYƺkyQцXpAʺۯuLzh۾k[uz_=R4񔶒OC6΄?nԍWal&i;[j}"Skc)a0Wvm#zI^Ri/w3+ȊvybSl#XB"PW^U11v[%V?2,,0WdEWR,6H ('+sO~˷igC~k*O>2rljnJPyn<}|WÂH<'Zo4Wzz/36:^lt.*;W]ц#j 夷Uцl 2<=e"g5W%kO:M\.:zKi8;s>(DE}ӥSiJ)6?UTp)t'pQB+xͧ??9_kATG Tе?j~d2Wve'ޖXq?r[f~~k?}~϶M1Tu_??/˲O8?嬼g|ro~ |m~mzxVG iA1{V7 ?d_/ ּDzs~ܾ S16\mZBaϚ!۷k6նzv4?Msy$2 tuè#ظ2zf8L5#{_WoVx8]LMWZ7 >#qS$-?F<[//ZWAfO1_}1/?DO2^JF 77ʫ{UǸ? {7G[S^AZuW qH?57)hOYG52z؜le U+s.wm~* 54潽WCTs'+n[跤m.q7C} \~jUXҋ/GZQh[е/xDlm.fvR)+ F]*aݫZDQ-uJyIEC8E=${?{f9}LgJ{t}+6<#kcju/+X 禋n?_ %EןYH _-ZkymRM|QcmBǸcFo>6 W>*dծUZ? Iu#?b#_3_0XZ[aZGa28*"qv|MG?;j2_{7ޠfցHqڟ|Cm?:Lc̓ʱFRx(ࠟk4fSM2P [SA^SG]or;J`+N' N:lwmυ8+ʎ vz4~> /t> /uZbu'ʿO?ȸ$~/g̎|e[ mCx'_Mu]}|cžc@%Ze7r a*ÑȮlOM^Ժ_I?֏bԿ{tR0|Uo_;9U[tW~Zxz[O;yFjAT_<+ 3Vu2?6>H/_o>|_Wg\᥄'5L">YC+iSM~2Jb:[QWGCtOC|7½~{W]&*b y'׭i>/_/^զ[gLvT^W@?b4}O+ :{_u>M"(o5\m!#8S]{h<3ϭM?e؃?WYO**8}oI:uEf~)f ( G?x_mS~6Z9%|?(|?+3G/ 5_s3/y_2'<  gl#y?¿x\ό?Ѡp# [ ]s2m@NkکkI?_fx/V𵞗j)oא~ȿ -lj a}?u+c.(`t~/9g_V ?W~?5-R_C6bəozѯn??i˦~VdeQ;6 袿?<S2q8ri'ms3MZ8I<<\VMt2_\ny$bf'$a 40\6/Xm>O O8-9heJf;jeU>Y?~:vk]]*]׺knCl`/\uWx캥y|ۼм+"+t+·2+j;uMt{=okJ5,vjy?4|q+(&|H’ZAE)Iv{jtr+g#ֿDo^Դ=N%TkyT0G>/ Lռ!gf)QDZ\~}c ާzzX_eYci-%tǖ4Z_h դ4.:/"N} %tSMn}oMŏ~ dɲ<p+ػ Bn#btP+kώ8rY.k<4WC/?8k7Y5Ĵ=9>Ʃ| 1}?4m:9nN?ղH?ࡿG+_i+O700Ȓ???igkYi{@EhX?w> xMKW6算5т?2Mj_Tʤ ۲]('/i!Z:kw=C(*4H_9ZV\n=4 sy20?_XlcW]P? !hZ}gGR <}e󝣧e_#E|M<ŏq#K1ym_#onߋvu#n\84уVhV??jH[|M NMwV_+_Le %8OuTm7 v? +3Tq^aQJ@|Ay'?LOxv0~:|.|-G!㑫wsXZm鸶R+5@x;Xqڿ$XF41#iQ~~_e9*,:Š8z qC^g5M㾻7|RU;6<$qk ǽkC5~"=Fc^?~__o-:kpltG]ﯵS>iG?v|1OJMon#ǥ~ƹi>2[Ey4H7,Ðǵ| |4Qn+iCGE`$zW~E~h:KXķҮx}z{?| E~vaGqXgxWO껟3”*QUUZIk`y৓._PUq5MZ?*,aY {Zz~=־=un?^oڏRT}cҽ.\bxCҽ(1_;ş*x]]BN¼gz,sԧ+ .0W}i~Xvki֨ȾS0_{|0!_Fx?WOs^(Eٍ{'5GlpF%<#sJ0M=~8SOx?)l E.10F^kt*@<}ioOioO_^hq>0FdOۯy#y?y#y?¿x\ό?ѣ}?LO?nl ?l Eq>0Fo>$>(Cg fYdRN?LOe8slxLR}V~|6_񕮃xjo* 08^I٭=6FH>a~?A_tGk|UlNWmvcƅ:5:}?1QEzǞQEQEQEfÖ+w&#ov~W AgQ۽U3b> Z) =gTY.7{3ʾ72kX>Âʹnc WOg\Q߭z?]gG-27M=Tג_FSaቤ٤ףW4ZY&i3놟~}Yk?M>iAYk?M>iZocUayg7kK~#_?-0UviV6Cʜ7N#GէOgK@5[J~~v>xҮ?_8?k? e/{5SoWP+_{'J Chx+:eoH>9h 'PݾG)y?#z8XyMLg~y=KVK, ?ZuoOU[F#A=jCXx̍Xw濵r–7 Mx&?19ʍEf,[3G,,$FSʰ_TPf_@>zeP2~>~?ůV#n' _gW*ui+գyG_i|֫#3974~O='AkỀKKGהaC]qF2kS BkvZiO+RX:sWMY/aW[|?{B&MofҞEiZig[fyl~*xCDcBVNGOtoj,V:=O!'8QN$u>+j&75ƫr'"$=p++ i [dG>b=Ҿp}ѥ+0zW_yG߿̸7mvij9J*66C_K;>t5Ӿhm{MM~U!_#H. vǿesk?nMa+dl.FXlѰ~lDRHHmduʑ 8{k;wL;iNPf{~Һs9q ϧ+D~iQIWj[tÏ _Sz1VOڟ.39mS w Fj}/MOPxFҴnF'OڐEJo̿ v 6OKo?¿JIK4޿X:cMq^ p$I%p*3"WOHt)--mmo[+T$}O^媳s_G9}mCV{d|iak;~omڕ%}kyWD߲|,Z%}}'?DOҸnKl_k's.Sw`^I񾭟 }~C_7묟}xG BjvhUmCO5 lFA^y֯ߵxS~"=.$o2ݽ }8=k7vO2elGc 2~8ߏuGp"c*O8IHGOxU֊]ᾦ)s%zŇtZ[xMZ?*ɢ_^ 8gq[/?1?k$&v^c=l ߭|ga^?GKa#iM(O=kSS䘊4- dU,]9kz~(IxsKwC(S=Ou׎'˫Xꈭ[[A0,zF_'7e8*l%h3JV?"tq=O%zvsWYˏ/k+@f19x\4=tm߭f}G53Ϯm߭f}G4{0߭mg4}G_mzCm-}œ+B vg>4wnQݪO ʄ|?jmcˏ6UoN"x_W~,_zg[|7ڪvP8yNki]qleRNRr(Ѐ(((wo5>ib&#+F5`ff8IN;? XcggxޏVOg?(Oҽk2/&dȿc_y/~}^  pߓG2d_1~MD<#~?Jdȿc?c4y/eGs׭ke f4u?[WFן(E i~ɞovo nX\3|$ּKF\v`o_*z?ik׍t{%\ײxY#7b^<uU7J+'#7>x){KM<7py_Z[jzfmwv0 DmP0Z3C"F1b+|!sK;&]qW~~Y[>=?ֵnxW+|g'$N_iik_u9ʯ9emuFE(}`} L~F޾ȟl~?PǪi8$ ρ??JRw :_O]_MѶd${%kb#7ڮV76n|]JjmGK-/h~tZ4wcTGNA {\U]h-K\Lx<56~5 <$HpLJ]BeSk]UO9)Yw0GPP3jO#sctJ !bڠf_\:MB*?~KIJɫnK}B溶GIa]?7Ol@_hk??4N5vKڟ-??5-q4OK?K`j?t6'Iƿ3ᛅL>?/?C}OIGm.c|QXi=?=CfAƗi5?yió|5uOI.4&~wy6{[{t>o5~_蕯}>!~xn.r[F꺞WV]Wuu?c4!B!?ƿr۾s[j3/W_ƿ3?Q_'l}?/?g?%!Bx'Yui ,r1Ɔu?u[j9`t"4<-.+ܒR-mw0qdНend$r11)ҿ[+f~_SK hv.+U[k#zx~#}ό`/}B&}Fs_}ڎ"֒y$2CFHLUIғդ;yMlM(M)G?n"g]Ѳ=UyM_|QG ^*ѪF ?m7 %"%/Qqz4yf/K1^I_W~J?_0Wgz~)д{ i?}9Y׼શWcb͇c}W~)ˏ/kдKܭW׼S}1գͺc2׮{XO$0^>?c^2ʰc l/ZdXhL8ɯ/C!%KiW&EC?  pߓF%,_(Oҽk613_ 'hC"K?Y_K.&K.$t^ >hϱ_^ t z78?AWGl>8 YG"Ä GWl`ھmZ( ʛeGc')6*zۗ[]}w*ZZ{5j-;|pޚ-5|U?k mV?ٟgG!w*Wfo/<^4w/Tv RJr RJUa?~+^ }{}j>R~u&b1?Rɍ*l\H~z3GCe$,E'AdSI}jYYGr3GRi4~)2To֤= 4D-Tr}ڑ OPh5M7iCP\v = Fr=*6CQH oRkЍC񩟧Pk>mJR*#1 }1 EDd?*ROʢTȤD|^x^#GJåBuj^#oԒTr}E~'o֧**S*YG,駭;YgIdr}QVߏ_Akr7QJToҦFr7MnM=*J[ 5*C*7H78xI}iK"40 j1ґdD~Cšzӛ4JqM~ 5%GƆ?+S5?J'!тw?U[Gn?Y,xh_4\l-FqV5}i5>?WXeSՇ>ҤxWm>x/ĺV=t^FtI?g»"3'tfb:gkdtφ˖%pOOjSCD43Qb_/_KF T佯 DR ''GU/P ?? zV97O2F ''GT ''GU>G/P ?? zQwS̼/'џ¿ IN?Iѿ|K?-†d/P ?o?y_򨝠M@OMvJ0+I5|$|PtR0;i{"v}]{uO٧IZ/Uem*;U7((((((+ /4|iCr1m}t+ ~W?ZL<"*%KUc>Kgg_ c/˪Gs"As8=k֮vs]#fݴ+U^!qdl%Px&h}(/2}˓*)ǹ~Wmgڸ(U?C㮏 {Bj祳m_ gYe+UVjIے{y(W]D7^:]k%\ײ=}s5f>*WAw_|?+`;O_u ҹ_u ҿ?|A/APߩ*̈u5{GSQI:TC j#U,娏TKbG/CQ|1Nk2OyyA@X/o#Nş_Mowg#WrxrQWXSZa>?G /Fog ?p,j~̷6?c?3> xU7︿?@*ch6{|fb?"t??AxQ7__-*+\Oʗf##E> ߲owN#__*kvSS?ȯQh ?g GG︿߲_q0j:Oʚ 1Uٵ)bh"?CN'_Mo'#WymBOʣmدͯ?kG% '/F OW?︿:EE~_)"?DAq54O7//FΗUh'S["?G~Ox;}q5~r6n[R~Tg?j??G?Cn;?_M7|q5~po1TҭOʧ>Eo 8q57 G!/F4䟕DU'S[K!j~ G!?/Fe?r3j:]oKSJKRo/j~ O︿߱K___GJKTO[RT[K"H)Pb'#S,x"ifDdկS_CVb'?憎?N7'O/E?VDt;էK5+C\߱7S_L?'xkDГ*q*_Q?e\~;?m}Eȵ1*R?eWG~Nli?"_ʘ֑S:_~ 91'//E[ Ǐ9Q-~_8g}N@ 8'1/ES G1/E׵5cTS~!qn?ދk_~~>"~^ 7V/.K `d$d3@W4T(iG8;z3i wƚ𮢐M=iZz`Fz_8J@}cC~?O㏉Cx3ҽ %/Pp_;ş*//dJb+-yG px["}_C)<{OZw-?jhe8A }?Ob=?J#ZA[xgñ&s| I&-DX2eJ)k> .kzŇ uvxVT35Υ6b(gS䖿žt=>`*Ҵ)ikf1IYIŠ(QEQEQEQEQEPFEPct xO2|Ta7ּkCڽ۫U-w:?/_+ǩDz㏤G)f47rO__g!Ԕ$>lUߝh>'>gkʲ}[:G{oۏ3Yrtu^y_gCjo bbdRg5kZ|;U@ޟ..N=Ӟ=5/WJe/:w?/q-%\ײ73^;O_u ҹ_kNY# z M/AP߮dCߝJ:OԚQd-D[9zGI/Cwj"¤¥Ȥ> MM'Adk3HF~Yvooo&Hwsc?~h?m牼=cE9c[t)Ӿ{ka;0Zȶ?/~{{' Hλ z5wkHh|l~  dg޿IO_5GǦƚ_M[;뻈I *̙#R+* _"~+U;V,5%NzKo1ƌPZW {h'OuT/֥y>_[vrsӥ{'_~+i;ltF᝹=k9feMVr^4g{OQ>5SVcSK\K=3&:><~Ⱦ.je`[ LRxu `)]RG7CQZzSKX_0́:g K<i)kK4uD>Pq!anOBM Z|v_<8¿U:o^a#`~P8\˿U%x hf7ZA{R߷qXoҺut29:4I}i'D*Cң4;MPc}֦M=k0#=iҜz_ Cj>IQi1?JJV\т^|I_0Wgz~Cu h6?0x_9Uٕ?)^_C?WT+;oE?ֿƏUn6Q+?,o9g?}f~v/V{Yawʗ_ʲqտ:>}[~>!VꮵGs]J,KOS[a׫&]*J1{ZG \5'_I[Bú (!^޾Wg}Nef~9xW4(/(s)ƺ܇QEEPEPEPEPEPEPEP}F=Bh&UxC ~S|n/e?XeVh&i V<?ҿXk |@\ދ]"yk5ݢJ}2GJ%9mgtMYsI`9魏n\pJ~Ѝo.8-+?>z+@? Aq__˿?F b ]pn ( Ϙ0^k5V/?֏?l8rvEn{Iy>_w?g _bjOt6<{(=o%_n_W#)Gi_kN7J+N[# z M/AP߮dCߝJ:OԚQd-D[9z3>^LQlE7}*3I7}*3K*;I}j:NPfܓI;|A?3"4" jCt_=6z_}x%յhجMzunҾ+im~Gd Gt[-bןjp:ю_Z^78|&º:ʸ a~RB=|Y 94X#m'FVf"+b N4{^`]GqC; f=5y/ 0JbxRCqlE(=-uoO"pg_ xj|AxoZV/l&0̪Ҁ˸sW̞/>94<-x᯵/x&9/w>䟭xXŏG?J$CrBK~fk}O?5ŏhwhDYU?//:7xA<7İio)@X/|8L:J[ ?b|#kڶi˨C5 $E@,9S+T̜9ݖ!E{?SZ/爯n kR[,ŽW$Bcz ƾ(+rGHAQ@koQ0G_?K{TOIW/pg )V)(zE_jo/SGOn&~ZE~&^ U8)Uxq|; \qw">ic;]?xVemZĭKy #ԃ۰[_]#X >W ȏ :5)Fg'BvWOKAo_6aÆu?'6s,?o_9[1_{~Hq[(,eT"Mt\@_Wzno?G'm.Zk{yVG WO3-x'_j~}]glA _jLda `uYRJ}kc l3n?~%gɬ kH l.* OK??MOu /n%'΅^W#o_ؓ=|7zVx.nH.A˱#J~?]x@ޚ7[D*aF{J Mlc{+kW߈0G4Y~oQ$F:riw4n,~FV"3_Z*¯(< gAY;wPBk%$!~%~Nk? /Q h']?ߍsWgߌ~֟h/[Ev:C"?PWY/eV;/\Uj>8!gz]0j+5Dϙmdǡ-~W ~ è8kګzefC}gTC| |G{)ojD..*$&} >'/m+qOO_9Zٛ~O[["5@ (s0}*`AVmj,ą5pr@#q_D7iiGK3J1zTRVm??:l|3f[8BO1צx3|u!/Eu5-х:öM O/_u\tY_х~R>(’?d5spLwPs ^iZ5/߲„5QK{xJMj؞F2 ʾue}Kkh:_[MG$w%Շ"N>%|[,WOFڗm&[I>~=l/CMڳK( =qXzqSwSjԋgs>|~]KVO>`\eW>T#DW:fa0*+JGR[QEtQ@Q@Q@Q@Q@Q@Q@Q@Q@#|xq҈gF~߰tg?*Lߢ8 :I <+ο8KH%e~:]7⁑Λ8 ~5|V~F}j6oFq_?~#ӵo$ #j^6E>0n5;&27 oҺgGry2hmՌB>xU濨~*qqQ^7ݟs BMԤ_zb^oQw`Cڃpө'<{1SQI:0?7A 娏T?Q-֙ޟ/Cwj"¤¥Ȥ> MM'Adk3HIs ?~cTƟѰᡙfhЃ^ axxWR{Ae G5[WVHZwexRRR~>O_e[+K{b~!D&U3xgKgA?d?5O ykQ70oek81ňMp_-w5|A*b MyC w(xVVjVש~Zw> څڼC,?]сkO &nIqIrѼۀ +o/?QCr#v~OU=W#w-wn&A#jdBբ{wR!?Q_w^ ?=ݹ<د?_ qV%m*M #ŌQ:iVj﵋tvYSFqVşύ>~ÝjR<Ѭ/\2/UUE|T6AlmmdX##'֫q# ̝)fNj/. a0݂z?* qn_k|PG c޼uUe67>f=*#e|N*2޸Lj<;Cat-/)RC"pĞkUX+Z qY"Epz"A]B}3_5#|&M+M֠qbH8|xx/M[7j,q̣<2Z _z7|3㯰Z8$ dߵy$4oEs[':o@Vh%sf\/~"|? m$=(x5叅?m^>4Y$Mt ka1 q"JAoeյ]}DF]۰Ee+nϊ߰3?ђc7g=k9+s~ I#ˋ:Z"4paqAj̷:/2:aOPi-ֹ(_;ҊJ+c (((((((((((((k_GQ/Y+y-n#=7R?#_kg~_ufWT3iO+PE~jt ?쭡zvb mExySm.O=LϘlu;8線;y7 =Aw{W3~(~ZxRMkEWȶ~Xt<WPXA_ ZJ=сVֿ/dx<(_|΅exߵ >)R,oכx77w5LǣZɅ?ߵS. XC?WK<+[ EyK:w>OWmY^DZ8(3-FѼWf;oz0Ͱ/woo?-~J׺|E<2~uFx.[ɌQ(|!MGMS̄1^}o3[CsO9[6gKLT#5g?q' 8+3`_VxTcc}c|B\FyccC,ϦvCr@2&2%?|_kE/<}V޺mSྱf̰ ) W:ƋZuk݂n_q_yFU ^2}g;?NOKNoTg ݫq*˚qtZNwϵFͺ;,j۫j棤ˉXFGݨ~?S$:j~jGQ?ZMDmXnQjK+fڣ}>5nL>\d+3E'bJU23sVJ+&F8ZG#t54 %cҢ=jjfZخIF)SVQ??J\HJtbSڂG2nSUw}ڳ'OʢTHJB:T5Yq *i `T/ZiGjJ}ƂZB)X= FjZ4D>H EFb_JYBЮ3izTΚzԖ@(n6HͽO(!Q14XԳWi٣^9 >X[ \'?a*[{='M@9[KU-}5zF+zYVկd^ txQVVI_qS_&5SSRb~h,k1W|3GZMuu1B42HRTp#n*Ѹ+q}bttOVI\DQir;,-FV2鍨ȿw!~}qһ9oUg~.|9jvks4|lv"&z0҂>a< +[5 JUpO^; ~ ^\jrᶈձږ_2cp$?JQb&OSѬd;kxWs#UNGō$AXyOߎ ǟA}pr-Gq׹|)R95y UlNt>o4 ՞#x>Kqmv_{8.Z<0n1ھt٪W>F;J0(B(((((((((((((NGUOZu"<]IeŴoҼ\u\}jb{kI$-&{7sV35M'OVpuށFiR׫GA|#'=9 Z4 7[L^XqF+~~nYoI6iƍ^ f] wqO9V}IUNCnNw˓#kͼO [:ݶszђ?&8Zc{?>L^ 䅊o*L}?Bk|gş\ZѤmx*b#'s>wpǤםև>zwv=7Z.pAQisck}ƛ'QNod+2\5}ʐ5}:CQH F&ߧPjg=ϡj'R_Ƣ~ccTO ~U¦E"&ƚƚ:T/V*S-"G%Fw$4#= FjCo֧c.߅J~Qv+24:iRY xm?*C_ӥF%ToҤ}$O]ÏCG obfϫkFP ?ѿ &m|&Rz/ :_qx{|KW[| ? ӧMZ /Dy7sɋmg4 WڽM] փL]:#Jv8ֺ`U1KM l(dQ@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@P0=RQ@\6JϽmT^}rRWKgxW/q^Fj9-Aҋ0eg u|k FAN· Y CY?/|k ZhX6S ͧ]&οX56w߹^}mt+ҼFQ|8M/oxm?"d&庵Ͼ+~ϻ5~-}-+nzћ^Q*$o󍯈 lǃS z}jNf0 N64G+% W ckqzI4c㚱:%9tT&{7h;Vh)W$5n{swu 2H3zՇKNS[0+5#+`<ꍹ7>|0>)G䲟QA/_(]/U,OdqeQ`tff+eG&V>]gΕKuͬ\=I|:h :dumF_id5~۲+}%-l+f  }]kKL](]U#q\d'^`sM8wŸ?{V7RuO%~U+Qxg.4[[߁*lƾ/k'%JW_|o|#qד 1o_I|CQ|\XM6M=k+?q_ n^?xsY37?Xr q+F~IqXw5nzhW5OơԮxQ_Ƣ~+j'H?AO?AH~D_Q?*dR"oiNoiPiBujaҡ2$rTmJ"CQZsȪw qo!ռϺ2l|E:1%ݻ/ڝ9M* MB_d/$|\G?.4?Yk{|rC˗^7N;?xʛBO')`͵yf8 ]Ïw7<9j@h_> dzF>yG>LWK|vծ6ojhasv3ZGwĚ;vK7&2$W'dG\ -y0W+\Ĭzc\}b_OfK/3wM_ F-pD&>1]UKڌ'`r9)=mdrkqjח''M8 I/- in[2Jg[3je5;ߘ[K!W°R@Mcw-bvw73Ad>u>U-GumS+O^M.OSέa)SMj_2H{GdDB=[5xǝq$jǔvlN42J|k0Q^^I_v"GjP3̮ln[eK9 &AzTψ%-]CHԾm zehm_澃 :?7+MlSgoC {u_9!h%#$F{v-2k~ζs ,~*ѥIZRV<ڕ*MmS ~*ч^fvn_澖5F}+VC aG^ٝmmrF=kd/^Rats j[B>oJEFʝO-D(((((((((((((((((((((( FEIERaWץf_"ƼJ(+cs \W?gkkBݣ)Z$QQ]$xU[oRZ6t&#i+k _ʲ mu5]ZKA>~ELt{Q,> ־݃|A:[]bڼO:i>O(昺_ ݼς|mO#8QT. :o^7>k~ʐAfƞ־t-ء"GzNMiV igZO+ǘV1ܭ1_G>/wyr}5貦^Fχc]1LμEƑ3tVbCY:Ūiz`fc ]EX)֧Q^g7L|>Gص+UO25ޡ=ִ3\VhFqJ|CĞ o4ōz?Ȯq6d4wٝNJ~ b'ùXܴx?y4rɒ=֟?V1V/+vo}ҹ2S^G7  XzomTMf>ӟa |Qzև(8HJ';o~} /HO2?+mJѭ1*$r^ȷfz%@$ǀX3iZv2)>p E f5aLuov ٦59]#ᖿ1ƍS~5I[DYxKXY'= `%]F!,Oֽ?ז(+.Ǘ[)/A]v[xy^u8A`Ӈ};dA^Sn~ݯR !w[9aOOY7Ec̭bZ_>J.c:hccۏl?ekNE{.Kfmjt+ǵvz'K=zq{p(+QHVUޤg~0^?V(vn-m@UmCWos;X6֡r=+ ٪}DK4H.oNc^m(r1Y]vB(((((((((((((((((((((((((((((Q@ hՇJTQ`FCa*U-AkWGGZR9־ޫ~*G:Z)½ƭQ?5 ?~ʐ܆G_Zo4iՁO־3'Q}kwƼT*KJ94c/cS>:~F4 f Wݚ[rW/x*?T}֟G4N_Qw2p~Q~Z׿bz8]Suhs+ WGV5j_~KlB~+ptwkJ)}"x<KC5T2Frt>VV^W{lZk3džoej"ωG۳Ipb8s0T_Ju4xѶܤngW>y9m=\ψ*uM'^%܏ǃWV;UV=*uQ^ ?MOvm[GW]2y]fo&1lWhO}bn $,1+uGO 5-b74PeoKI,> {kk"#~f >S:Ous,5?kxτxƻZ:K8cڽH/II/IeF~'}SO߈i[XB?* 7p4*eTѨhs:ok0?vl[hEh(bqRv:p((((((((((((((((((((((((((((((((((((((7NSQ@\θ3U~C6}b_SW1:kK߹_^xo |BKh.N72_k߀:τi4Bŗ!:W޷~6Q*Z~U2dfʋi, Zކʟ¸͖[y8VϺb;|qo}j[ a%9>kk ^R5Sq~z Qi+'{J;cj*J ֹbyo'D FVSo|iP7f;qG_S-m@}+fP(Һ9yOonWt wZ [@_ʽ>->8ԫj5 >Z*5mZxrp>EZ@`QG(sacB()h&EPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPAi[E%rSEvQD~Tش(VԫjuB1EP (((((((((((((((((((((((( endstream endobj 9 0 obj << /Filter /FlateDecode /Length 108327 /Length1 220684 >> stream X |[7E7߹溊棈X`q B7poZeq[&F՛l*k,߲  W9#kO"׬X?ԿҋBZ) (["Ĕ s6A #|Ic(HOvTkA|^CzO.ti컧;-Z5Tl<TH=s #"/O@{/'M3E`TiӨ-bP `cT_Af.d`Ex'{/@s!>EFS*P8LdOܣ i[ՃHSw?w8{=)D2.?r-Ľ`/;>\ >sd| Zc@n0m] V<콨#52-Ce<ރ!\a:X>60daF;6ePũhe 0PhZN;{=X v0A`wnv ځi 5wP7#!m?n ue~zq8{=gq8{==LK֙||~I֚g}Pgq8{=gɃM3}?W+=( Jȉ(P *C5 ucڄh'=Aq*z\Ko)Y*,Qʾ~}2>Zs %jFuy9:m>M!KR 5WN| _3ħo۠{OD-}ϟX lNBO?_?^R՘ڹьZXzݯZARȋ|(QZ5^ȵ VbV"7m_7;!'q7܂3^|) :AK͖c_1AiI?Ѵ [ _d@\ *A8!_Y3C,OS0g\,{wnyx5BцeK,^9}֖ܶXcC}]mMurNEyYiIqQa0]N!CRʥqH(XzWC}?y]Xv-)vjggOgҜɜXe@yz}:}/k\1?.(a7~{`kA}CRIv@$R8`kΪ U_6Ġ49 _jpqkPX;(벯#mFWۇr9pͨ VV-_3.BT]u;1@s]u~T2xPQ>Exc'bէ.N ғ-9-WF ChiEAp`D׀2m!}#jXs;!%]Ӯhz DHN^0 ~Su#=yܔLHst "; ۴ \ ]`4X>:gŁheWӪΞ =M;ɭQ nS3;x碞Uw 3rCZv|,CbI$ R|H"Oz(F|\Z2 S%h\#0ɰH ޾gWdp!ADr3B٠5P3(uՐ*_E$^uCtҁ~)dTYR}tbi¢At I=+vRViZ b4 q!Vo|=p1wOnڳg ʀN({ & Jbh1&R"d.HZojshe':եy 1%%Tȹ4@#篮Ld{"o ):D?$tYHD<(4-OK!U,Ft4QQ+"=YOw\:R\`" بܴ̈r>4(hH̎2[-QV?߇Q'4czQ_)3)GOޥ?;V10lIxkbxsx)oik~C^+ (/(W(˴/Qx ~FoS'~Ly ?psC Px'))Rxa (P8Haа9 0Has0(|o؜] rߡm ߢoR½ wSV}';h)|mnp -w3(Hknp=hP WQO \Iap9ˆMRC SMa(p!S6 [)l6Q8Yp ΥpQXKa ( )S裰R K(,BﰱB (tSIa> QKB+ ((4RhPOB- (TRCB92 ÆR (R(O!  < r(dSȢ֗)D2SQRP0S0QȤ``wȠwt j * J r 2 R  bZgRP( OPSpq _P?(-F~Bc Q)_(QŸ)O= . \Ma~u%ְa]~Owúz^ЪMUZٯhe(/heE˽B^)@VS ?1~48J ^44.Nzuy;QuXp -~3(H5z k;9p5=W gXppR}{3\A.9/Y.> WElY? l Bx!<aABxw |· <p{!; np+[ &7BkmCµP-fN0_\la Ja˰f SDa#(lp.s(PA|XEB) (R(V9ͧNAMAEAIAAA> L2 R  b iDrjat1_ AŸ!=`ހ{[Cx @xO@XqQRz簚8;(lpmj)P:TSRPIaB Yeb4(E-Q\O[A< s)QhBBF )QpRp)(X)X()(dR0R0n)wC88/ | C §>1p#.ށ6?Bp%/Bx O ~( Bx 8~!#Bp4Mauj0Z k(YVSJ +(,O2 K)," z(,B7. A J< r(dSȢࡼqSpQP( HpBŸBc~  +~e lv9.=ݗvw_n-YnE]=ۙ\޽XvAl[w׶w}ֵmնnv "Dlvt;:L4}[IyÞm7lc2 A۰D;I [c<\)d3~k3fBq :ٝ@rne666G76vozhc7^Oo\̣pD7 6t' 31J6a2>.{CkWVu<{e`E@w_`iv/ ,^Т@OBȿ PWwg{CsB|[@Xw{ 7" 6YX?r~& C Ąd^*ᇡ?Fz=G%6Ig6:~EC{Ռz=GǑsQ#<1 )H Ez+h2\ dz~@oA>8)7uD?@FA1IJ3ω?w'MO@|> C:9vfspO2c1f0SgS|NKb,2, ~ϓhFt2E}Rl4158p&6޴`+av'SnIɲ6ȡOɛCx;gA8RɃ0\AZԎVs?1/BU41Y$B E]O"9j~a.-O\2Ȏ_@i@LUB5lJt ӅRzi%ثcեcc!v`D" 0>oQ$d . +HʰɘJ\c'nBGyg=z&-Y垈]*piBV&ո7;_|f ǟ(H8;$ҞJBβj9-r\03͢4B[>~{G/=f3^O|='@NE gw=F'3L2ȑ+t^ ;jK5*E2d>J:rD݂ndJח#jl̶߲06-4Ql8l)=jތC_[~to>!R.[T)"dB]I~*3srK?P!*We>WsVcn\rB}ۥJYVA#5ƨRkЧLZةމ?6WhL2ȷ[#p:C J g&A|z)tO_@h+$D!b%9W_5ڤL N?*Ճ%O|J=H3-je)q VJ OH3a8hщB![n#Qg ՎKyEz'e)R!IKԋ+|y#V9q9fd$,5+SJUR~[r}RcPi}NURj4GQhA9ľ4Xyan$C=K;3x hpAR>ƈ;vt .C6IzīͰ[TOL#TfK`n '5 '!8J(I tȮ [ >g'^HsVl2F39y&)U-@U-IR17JTicq w01ɦ[¤AS͘uBppZ}Bȁ$M'\xy1"oC2WMQPDW5&MJg6NׇgkPfEt\V]]j/<2a_VMnߍ/׉}RT(ZW11ҞJ_crX6%f.}&jIR[ jWZ^~A\/]ə^E~W [ 6%:Ę RGTG]:'#C޻L]&&+5mW!RxCfKΐ-HAHԄ2lSn. |Ɣ`9H+ 2b>d"48sJJQA:Q>)%2#Z2?"]eZNɤB(d ] 0nKKXPM=o3IcJZ{.N{25VV,72y4\1Lppkn ?˛YVfdSf.]:XB:[ }q=LD%d>( @vp,V )F_@Od fi6yۿ;nmmm{_YNyͽWg{uo.^U]ߚ`ׂE}UH #݌ўFQ1R{P(F'W?v&m2ނ IbfZo\Ҁ{ML1,ܺ+7>jhtAUwݻ-񕓣`PdE]O4]' Cڄ5'qg CّtDlvaT~'y%ޚ/Mid | _Hr`F)!7d49.-\ޞy<}n4ڧ7ϔܹvyvG>貹}/;7,F |{{ul7="ENHKHKCwSlyb*5#6Jv\Ѩ~N2bGr~}lF Z-)ؓDJ5^MJX[,ȸڬhbt^4w€#lPJ⏔dD.WUbvJVjvF2I-DZҢ۪(J^*ړ.ƿfʯ#j=XyP: DH `1bU$IR1j S˘l/HQ9DAt#C_$ j\Rt'/ L\ WB˾vKOyū"Ҿ)ZhX-T aEr4԰kV]57X}ǚ͙dJY}N7*ӽcK 5CweZ2efI)i d;QwB "!$U%EqqKDPOkj:e'6o/ܟ$6OJ^@lؤ0idl5(%RhtNad3pmˌzFF| =al }&yX#EE)FQXX@ gfb.~L`( \q!'H .<̥r"$Z~8uڏ'ap32 7XQ-(].i|TmB0#Lm,R}C "}h)h4cΗ.5Tl  ⼂ J+Kv aY.IVrtBN_d*1'帘BF] >ޅ&]{CмZrYAyLGT{)-?KobH_+X:TDKp?Mu7}Q_+//1K9׈xPdgg*yk XRԨl]蚓]pԲo[#6#!d;CΛvy#Gs٘'D3rWg6|T!T5VEօK[ZJuv齱XCWՂ akvw |mU6l/wƟH,pZ]]e:\[,v(^FZ:/͑,GܚG|EfQ!3l@#/ p݂-N~jfW3!:T5~l[~I٫ŖHlq싵]VgcY&HeKhpf5 Td"} ;d1u_r/kRkE.gtĦ.reEY7y%ħCÊUQ?$\JXͧuo(9b[9gsqeKaGox|y=@W"OyВ\4_خk8s+wb| pRr·4=sV;9GH8,i(S?Kq}BqbEZMYMn81eztx\$ ޅ"C~,$Q8VQ\xоJO8N`B΅[8b%*u>\MHӞY^o*ƛ*D1/lI;g}UrJ ,S̽ U8 aqe I^b(.AI3Xj؜X蚚*Q(IߣI Ց絴 h՘ iuhuey~uK{םmpQ1E|z"E{:\֓+.Ѻ33Zq#>u*q ^4fKF^+#("~=ԏx F힡zSgɬaG|;0?# /Uؤ6 , z|m}w>3yh;>m" ="Q řw@f[ȭmS7dˉDŠ PMA^CR~w+AǑH^$sXYRf! zTtYN<zABzc+Nn+.EO](f04ŦquS[L `qҐ@T0@? W |Dt yx<5|I[il2\JRQ!+AQsJPl$WA;AI^,Q5rIYwe*ARB^:?`#kT7X hx7N+xNj y!+癕l zA$}4/^ޔeG|SBgj%؀ilщOg窜YGҜ227;9Ϊ(0H'h@']*0&t c)>N )>j١;V0Xlq:t[N3O bc7s9U[b8ƒ_2Ƙ}~?|4sc7hͽ5GLL?Hj^oX#S@S*rUS󚨙q卭M_}Pq߮+(d?}DbtqH!]5i0Rô)?(<d)SѱI{dY Rckz~F,fk|49"Y捾BR-I _P8"rK Wj҄ &Ȃ}VMWOWuVk *eER4gN{qgvvdUFKRkٲ Ӥ嚝>GVqeM֨RLGF>S2tΐ 7.@A680Dꔜj41 a w]\j}DpD2i2XwI.͡Ȟ' Y$3@e=$ՀiJUTfS`bhn92KCYKmf5Zmw[Y}ǥ,9ήbxn 3bڻ F#<83ۉ fQ.kG]QTo QW)$M9"^YU ? ";'5iR*C²Rm:uWv<+WiHM!/} *Jd"GΨB7=. , ⁜Kʦ0O6$}*. Ş;;&(]B --(lfYA^$ae~La*~ʌRs$7,9he flZqu8˜P)9j r[E-}{P&"#LCQfH #^WHfzey^6I-'BRєx,C#6WK T2"PX yF+E6; 9?7R!U4rX-ǭfsL%j5k鐒* #=>T3yɇR$v$Q\Fa~%)X2ꋱ#uG5ɲlܴ~_6'PBeP8i*V~_簻3X KnT٬.c!'c/`M)L0M-A>*e*5~TVOl *(TbC:dNqN'gx+)qŠm/ AT sމ8d&vK]?t>(f&ϨrkgD#R061)Et.ґ2{A?'/[]| Cs.پPUlM eҟ9 UB%5scsrr2N"ӫ-.&{ߒGI|ۓ章b_8$؄rtkG~抨i%ENJ:C%*6TR kTЖ|PEK$aZGVi*q-RtM V\8onc[j̱ڲ%,2g]],k偅Yڈ1)./̯lj_L-^?(Wt\ V~~YM]c}57UT|6lFH ؆lw%]M3|Q%oFŴc1~0_>_K56RH8`"CY{-BXfނXxH[+D`ˠ;2U#[=Ra,yۍ=6MbzD`چ\ױPq22}}>VVԇnl,GYU#VԈEm:[y}̛+d?6V!?t%F ` uu_4&LEnvhQzdC5nsnOY-//J^҂ Oв LXAiO+UNPexg5X{KTǫ - &cl)}JT̴eRX=Viߑ+uϭ?Q*[ $t5p 8]vph/m} tth5s&͕a}l=C3 ǤHVV#]uL)6-_O E|~˖Jd2DIS*9~55U9QWaՉx,Jtj⿉eX( G]#hy(d$VDV;Ci *VJқgKô8N) tSD!`9YNE, pK~`Sg#~ܛ ;Fg|3 +LLwH Ȣ(wַ.mm3K[=%6٬nh$jPTď*%x ЧYTt6MW}eGS (LzbW] Mߠ9iP7jGG'`,vw؉lr;bmdV4s#E!%V bV#? -U%y 3-_>1:{Ғ H+gg8rGIvv]9͜Һu./* JԚ!嶈+ыN:iB 8TM)&l) ]6ޞi$wi`<̏9Z3Z :VE6)Rf.n&9sl6sy -@'sh xZ/m^Cg& ZW*{jT~~D Iuc⫖ CҀ"<9ݧ"S&~E}I|Ca2$bK\͑Y[3nOe òvbk'6tοz-FZQj%{n͓5 5/4+cŨ}зliҥw %pU]hwꝥo>uk+O{eS-ր} II'MS>L}\B| 6qޯSi _埫i"Zw˶>m}kjG]9+is`ZA{ē-hcU3mҹ ?0q̽ӯU:Ic=*j-^?/XZ4<87y/3/ 1nU $dEhX}ak(l)]u$}3i0Qz nB5yt#dڲ"ޗ|˖ll䤧nMwJ3*MkjEt]t3lS;|ۓW4e9}1cUAYb~!؄hC=h)S Zs/EѼfwA,,tLnJx_$u=Ą4.=AIΙ_+ȁ_1O#3* PԨj?퉓fLX6d';g\S]>bN0wЋPkYISky)>|DtJ%_0m|W\yy:~m"S*j27'ɯR lR?pb$9p̾u#%6KKf۬1S%xB*1w(Z,br`O35Ю$>&\j:MThb[`AhҦGv*e` 4~ S\ِWҔjL{GSJsɗA|ʾdj@k{vXf&/8YjW'oIp:Ea.̶sڋ{ꬶ_$=uތr̔ܯio+) l)eng2:6l'h sxlbJ[_257.kNvF۾+3ka7%ƍWI$PRb%M2Rm@D^ޤm߽rGvMɗ矱Ud!G䒴 5]eqUVA*Ȕ"wCdcګdEbLKR 7 7d0rxɻ(Qb?_&/4Td-/+|qtuűNƥRYih /+g^4WƱH&a[9c^[[)m^ť̬LnvFUEi͑kJMorf"ӕa˱^%]э֧Q @h S&vĝh/P5Jzk]DSsԼd߻woa5U-UC =12=;vt0H^. *"ԛ*՞)[gOӔq4֥kRxWqef1&%lhMeX}nqSi4s9N\1"HniÊY7ܯ]ZoԝSNu*C7qZ-/F.nX?aEcdCmT_'xhXRlW'=鮄GvL PK/ v53~ O-]BͯcFa'{殊-[&x璞Ċgcm明6&|e[Fd@ K]0ytVb| '{.m=,ibȕ3g)[bxo||C NMM}J.>ŮTiMru?ȿ'tB ըj8X"^KWl:*/ezļ?11Os|Yzy1,N$wdvie ќ%*}_qQfˊ%Yd bd+ݼop絛xRՎj,DFyS\;O֮Z֒|#[0P絬"_PO`E upnE t4 k忺7Ҥ@`ms%,}Q2oUKuq&-gjЧp>ESp>E)ʮAk9 O\fkTuQ|ri_ulihjos ~fo8cSxӁΣן ?7<&L$;cʛ]t!gWte_%_o&υ'PZό^ :%+W?jܳ=*zcL ӳL_% FvkofYt1Hq'VrOn%p!|1G`4] 'G=EiJ#`4c?FMPn(~s7"2 kl46KJI/Y䟺?Ͻ{Q:/s4]é"q$9M'G*|$ԤWW4o1m*rH L_MeGX%/33`Xq,eYer} ~FBaRs7-].#9˴  V& W.@)DG~)SgbZ"'9H"ϱx4SOԉog=ݎ`zj5"OoUEWOW\EX#bvRω>b]2TX -<ۤhMZI Ҭ6-#7g46}~f\ 1g9BQKhG0'֗' r-~ (v:yy2= %wˆ!TͿRA0ǧfaώ3]+}ie`NYoƹ2SW u55g; g9R*Ԟ fJrVC/ln0hͺ4#"TO{2~&E)*Ɍ >P0sk1%4؁pkb~QRϭ71G#+E;H%3xliIšeK6[^lf .S1D.f5"eEs篛eN=n9t:m(P>Q}aUcaznڛ[(h}f)aCI:{jy&G8bRKz:МI^u1HVI.5zmְy~(7?ğbn(n%;dd[3q,dx`VkFȪRI_0) LSxoLLnjr+"lVIdi[|sF4Z2f{f튒BQO9>=U;RekE[Tm ~r(@CY"hj-#dLYYizOqzfEo˨4V"^OOS< 5i0`ަ1e:#^1?eDy{}:b6$Q#gTo3 { 鴗0y>"7 j 4;$.6A6Nwڑ3Ɏ4#]\x? ry_yZY3@%Kt$]T\:@M$7&wWLD&fYLr8WXN_*OR ȅÙXHNI.qI|L^F%S)s[q],ۄr;-g)R={`sgK[#K}+:i1r 0qW4}8ﲢĶ1%xi kgސoB),T$U[tCE(` kȘ$/eyry?G.Γ!+gZc#* ̲$ӕ7\e2+믬 @A)(wW/rS֦B699`K{ ,!s;B @Ǵ *Qk 3T|\#E*3?e]i6!4Yy΂MsY[0w r[ȳր۬_@y9fWyxʳ1GG$,ʈ4LEzY0! :IqBWW=^HRƠ+2wdiI$BWIϮlb˫*"͞bR ZfY5\D)F@QRMWC#Tr#KFD;7˿\i)z+)/(`J l'$JS'eM[DTAAK!me(ba{$A`$:VfCGP)ѻ N'&ws "猈~Q3 1Kӵծ _2ED$tN(DuzJ@!^+S?"!۴ũLXʄ8润룟46#vy_8ɑH `CH/UTv)5ꩄ,Tjl.77." zg5gѽM Ins;msfl'\\\57Z&!̅fԇfMmf6mFL4UB spKK1M- fԗ?'g<0S(%}ƒz`2G +s]ykkYEkkiph&I0ا0{ʺ1cO.sP }:U}_ h/êPVV(]~UYCvحV2F.А]J6fgrGB>%'e ܫPY0RhAdHUjrT9 3+i!mm:w8] - 3~PUgepK=Cjsw6̯ ,B :Έe zM=$&"<%q>bcRXs,+MuYz 6b&=/Gkowsb,TN9|/m}sx> Ɵ~ }y8rU|Euu2SZ8m" n\xE7,,οLٜcQ>h?*cx~r*ۅSE"n^LY+4I0;5j++~eԈ D,f%r)b.c * 20*BG•RHZ+ ДM{E+RₖW(lpoA[ɵ n3E*R[R/צx}ejsb%LҔ5^kueȲ#2פ,rv6@sԚJ:Ui֙nj u}Ma nwfʽY  EQ8磣I|KoXhU-">`{B\(ڵr dJѹgiv9[aae\l`H^7?~Ř13I^%tڸח7ҙ!P19 j%+ɧ//~UsP=de';2yWs;}Q!d28S"9,uӜ峂JJ&RZ:-hiA7V!ȓ[jJf2lRO4Z ;zkx/"E.~j1 MQ| Bd)U/ =mɯVHSΠfȾhaC^SZ@ۡ9;qvT ?޿U*uOzZjjE%SxByPZ7'gΥѨWg ̀ Y3ݝTSjRl,LQT: [᭻c+j+8W=>RCd<qe\`0q0h2n,c? +&aΤ qx/ISEuXZ5X2c,,E3BXTEEXT,,ci6c։w5oKDyIÔ/WgVq\Z0vun˗vu~΢8'^Ӳ"4gʂ‘iԉWTƃCdb=[ߣ~<}%&~%Vq-(;F(i Z6{xnAcw6mƛ~Se~zu^FΒ z6A^"ֻ:qK [W n= FȈ4pQ)OMefL6ZRrfX$@dU>XPA&:n@7=4M>8g"E?^XQk3]s˳0?0"ijuo^kZrA,3YA;heߡ5!kRMk+RBu은@3f11^x1z:H:4R#cXW}n_Kx;+Y6*e5g"G#e%Jܕ֬:'g7r42o n[BW 7ήepf^D":Jji΂ѕ-"FzMW5(/P6aeheO$]g^ t?8IDJ-ZB=;qu\XvU-y2Nk5C5j}v]nѬ,-5JSkYm5GZ3gje3ZJg2\=-Y%P ݀څQ lf!70")6$B5$ϝ-b6vW~.k|ϟaubׄKAsĿ,kB3fiUTmnfȥ4{QwMSVCquS`Fo3b\Kim3yAEy1˝h,^m3!`3/ܧ^w^UwF_f'oe|s'z볛яkWUs6oV.y㩕ʛJ7<>/BmϠt殈Ԩ+6j::0h%'KeTKB&:/ *DL?g5RCO Iy^2ZS;jcNuVhIm|͑RVnuOg}࿒iӺ,6s\y.YCWsvCns&Γi)\z~LO+0G$ϯJ@9<:# ?:s=f^K ΝG` Y Ķ] 2M5%}NsQ: KeI :V=\^IXAZ 6Ovgn8xWE?9\!ov"מ"fv~{V-'}l6@l? ;WF8UJԇ%^u8H?1ƘMrX탰QKN3[#R,˅1?Rȝs/$Hz)5b,h')MVT;;| j|,_*J0*R,1棸&F3rPy61۸_B=%ogNIϙߟ0p #7k$eZWjI#x`sh=lVU]|f@)UJBVobjm\P2֔2Qrן@ ~]|ϨoaS@|7lIc~-UϙG=I-eݢ$[kU2OV:Gy?zI]EA|yԿƥ+o KV0 .tjRwaW.]&\swǜեkյs:𻊜abA|3ripDd,w6*wӜsgj !#I(T:i.@:7SU&avsFo-#`0 "CU,lɄP30/8 \I] v fES\H{BHR}%@UZ&0KGQC*YqjfF׌tUҦmv 5v)f\ S=^'IM jGikk悮unLI@@T[2L/~ MCg2-P|V3tTMeqeK45m]QZq쒖A5~2ccA$6|80jw1 V +&{a3,K:'k)TTL/YZN.`3BzՁlBdFx+%f\ʢXǽ9797lNL*eK6rqۃ^T( ꕕvMvC<,RgymUg0OItja55V!+Bl7w` Zݲ7p ? 3dc0.$Mc}>縓qީl0>ysyc[ o۴'٤W{g:~ØPXL,18n_(d>m z}`qUoȜ:J<ŐjQ Eb9Įي*E^G4 0f2C0{`&lWsAG3^œ?U.["=}z0o5wr2P6~"b^ɍVBL_f@SC_GQ:u449kJ" fsB%U Mg7*%0{<ݓg[L9Uִ2VKfDj6 hQ):yMBSAo-Wآ:ZoɆV-~-6~`)##짱( w?ϳ:͏'>Gy!+ SeTROZLißOz(ÕlA83/EuSV+[Z4jn73|_eZb~jR,b*'У|'PDGyOf p|o':Ϫ5(goHԪ ےyce+8f(, 'ЬEm0L'U_mw]yTAPQo,uKKWԸ|3xߤxOP (c3so=A:= NNi(G*-B g|\d?}K2tmL1sMk*%R#e iFѬ@YE~U9akEg$@Yc^<;=\!RhdRiRMLO颚E6J')T]Q̊ Z@-iJ$oGOJ)BVC$E.|Hwp$OOs- عoxx1]?b|Hܘ XsB8g',b|T+5G2^ GYx3=G^B!r|)08L+ ?,yMy+_ WC7]L1~*[e>NL0ͅ8csɅ=2MI%FKGORF[.#9Qjޯץy7 :,} &A2}2L簘76ٸR>">@0a;  .` e5l0EږҖZii~euOv?sVYE~TZ*)V__$~@JdA"$.T'ߨ7ä _8^1Wa!Dٗ(4.Kg̔!bQ; /jK=GI/ey4<: <>L3y;JbD!ƑsVü{FcIx8 *yO &AE60l.SFv(s#r𘓓 E" TI "76լk:i{Y(q-,΢`X8MtL{gunJVyؗ':Zͨ/|J3\rdv ~tIQpKj;t ~Ye(O2$6tXאy=EqZ1#͢>&E&(K[ev[ {ZBqfqQtx\PH ~cNb;T){jѤ49%E4EjE|it"N-\~窣pepf~Մ :V{]/ݷ_mYں]+h\ SnDdH8*Gdz!K^$?'qAOfOfS- {ic%kC'-@J \~F{tAPZCښv#Ŀp.֤;oKկϪY:%xYv 7Rſƺ0xܶϴ uzV6"TÛ"}N6&ݯi]_]+~d K8k'7@,?'XaT+[,"GǷȀ{0)DN.ItRRTz&S;O㗒JZDH &ЋSoFG.O9+)() (ς%tm~vAzA%mH"eP2g^~h^@pnxץқK*z|i 9з)}Phu|KORU^FU뫗T\7"oxkn+G/ԾPϐϘ38G3k^,mnc]<z= @1@鶦9jM2dќF7~;9œ sE_k]3ہn{{>0sjuz[j}(7%}I_җ%}Iޘ_ tW翺i= .8кq4@ Jwլ/K/K/K?BL$ B$@{bJR;cmb ;>HxgUCoGc?ÔSDn&w~ |s2KN}۠ooo|)嫠fb.\Cc )b/S\Ln@<ЇJ"p]*=bo|)嫠 Ŕkb %&p;>F`$<@yzʛ(&7R5NwѶv+A0bO **'M3[)_JygC-UПS=YFdr8чe`e2*Zr|؇hGPj^нND"|)@@f r.\n zBFʷҽNwFÔ=|"v7d$`l A JRWhzxp1ravhezݱG(HwR 0=$ÔO!*Vo^zERm Zo[iz7~mϢP۳p?ÔSD؇a1-/ŴbZ^Lˋiy5-մWjZ^ |w.2\Fep2*eT˨̗QBS{V^5v_)V@Ia \Lp  8<9ÔSDy+-s | |7'A.[-cL%GWe i%s`OPXCboW §1 H|EFIO B*BH|Zʥ|Zik &ڒ#tO+^=>1>B!zR^\3̥99siN\3̥99siN\3̥99siN\3rDR-uAF?FðRhv({jP/͇mkZD.(x'zj%zhvuuҲ!7}='or=Pfm0Eʌ@ð r#pt'_!C>MR i!b-lG -<ؓCk[zi #n{>JlzG[$8z@ZX8yǥp~NW}P9x81̸Vy\Tiɩ'#"RqA>@!y4>Zf*~MFEOs2Hr-vB 4\e w-_0Fhcbک־i=iw.etZt5=~C `A&_Yi?:v>KK\^5$Jm`= %:9 ta@R|yLr ԰)vSI^k|;`D}K)Ns6==Dm;I1袣C㺚Lp&ldN6Ѷ:]].OvPv&'!E6.ʉ\G"ڰ:zj{J'i;K=*OAa-"掵б@Be6Wh8P?<>`!5 Dk( ?n|n+R=p܋ p_7 }|j:nanU.]k\pܛ̀nC}pZVa Y9p+w/p {8} j$ȨVw+;9{^ 71pSM'+dϳjQtܒ[ppY{Cz}'~pBXb3{![=}p?  x%Ľ 39xsrpowi3:~ p pܟUv6+[b1$V'WnC}pOPo+NU{[{ p sX`l3L%^ƴU{=w}Y2>ìcxfl bAv{>` z  _[} w.܋Zp pw'h&V{V]}\U:?0jW kF} >~p ?YoeVցwA»f|=g>-hyA.oY$$bݽ[" 7q^"F!ΏÿiqZls/8f(9JB?ZΝ>=! qN"Eٱ}W;"W/tk"#ćY9K*I*&М8 FM= lbat4ĄHDsӧG()=?M H8@ &R уNF%Dl;Fh㣧%tZ ) vq&Jdq=G"bHp;فY &p= #iq\#Fmm0 cA"W, ] 8 {|74'"InϽ&SפQNcaB"x$B&wFvz~ID8IW!#!)d]IJ>?>~fbb @IrEtT8/bR]键BfJWL|'S]M*& ] DIJEH*&]IRVCPl!;@+ţ[˜TnNlbJHJĉXcbqJct[;'Geb1'"EYD,rSI0IN\R"3gMGIvFo#ϓ`Tp9< *(l#0͊&F7~r˓dÂ|m4v3HNO2sms԰D|oGôZUt#ϊH jV:^:n Qs g81, geɩeѐv aO" BMk{W4JURyE$ݲd,Rp& ,z#",~ sw9C.rgd`Iry(Eriqzh5ھ@w-4U7RaҐqxNV-ɕX>>>7zڧ=u44V $˰\ANRSdX ::eJGgQ[B'&'O8~QMɓl$*w*^xC"&嬖xplNd/mBIV=CL҇'Gބ*sQkDt&`D-:19:> ,?P2nт*HqKTgνG)G:]&!. O?%$Γp9r [//K1nI\m=mǃ\my3Qb$Rq66L0鱈KF VIě1WliĎ! bJ~O$S&%)*BVJl}|x8kBCqJJATD ;)i_ 4!}r$;vНSuƀ'B $)'K :tR/sAOTX=k;k;Wqt^UyrqqBʳk;vmDɶm;;~ttDrV!t"4ХIU+U1Ρ ANJQ4N*ҊmρPn3 4ʹ qL\!EDj3?QmDiK'6(%X),=pEP]'-0E:dA66 -N\8 -W~JMrTdn)9(z@G)((5gu G?k%wvvsA緑MctcݵS׾N]?[i]l㺷e{<ݫ.[8CGLlLaʻZҴ}rMZ~d>}3mKg/7vÌ6[o\ִ}C)ߗ5yomMo7<W6^u{7{@nw,hn}mn;;iHO*چ]~;a9>d|b{|ؔas̭-u$H>m çq~p#RGTos]Ιga{g}?:|0>~WOZ4ibS'O6[&5ئ\>[ z3ݞyY,yf3iM$xj۩G֥_h7ӷ>{dN:=8Ñ.cPƒӻL4ӧϛaGs=7U}73l3̸cƸgμ|f3g{քY/v=9Qk˯#/Μ3?oFDy>1wǯ/gJn9.~Efćoyk F4mfoeD7zf46Dwi_O\lIsѳ+;4MؒQQ%f$n]sGͨl\{8o^ߤ nI8AL_Gӻ%쏚y̯ÍdsZ߿[slob!^DHT$Vy>>(Q?[ 1G8><b coiSkQc\4b:G}P%eCc&3du䪆V䡦s.hղF~3o`\_7G\\V i/ z3'g.Mo̔H׹pfO 6ҷ_XP33жc:D; ZfZR+6hu>mjuN?vi];uHcVDlFVkhfNnf`fv`kʲafj3bRv>wfVku̺鍖߶{m:J;7&5*sa5 3puO9cjaTJG\}fVD7ՔQ7yo5Q7ycY-cmCmFb~T4~AqĬnq=wRͳ=&mF*~HⰇZ˨̭y$Ѩo}=dDslF0*2BSڌ͸; +jlH7(5QըÀ9;-j/oy\)_J6T~gY4j݅ʙ/OA> =+T[`$Ndɨ-JEܧ}Bk3d6SC{iz}'RʤWޖ :o7Y{+ V4~{,G2HHWS!i`b#0f\$̇a,WU <~sHP`諌Ƌa^њD6&IlF-=u$KB1B| Ifk-{b *U\kξhD= )*}t@6kCk\_cE=02`<hd_KX/Y+ C< *Z 7%Z2$b|*3ݏ:mCxXm8vWܢݏIn2߼lC!Ng ;21WEbpAciڿrCMm6Aq47\$^ЊV$Z@+Dz{hi) 7asS6de̦3vhGhkJnkA{xOH[zfuDnV*o ؞4[ȝ>fPa"Z̕A1^`> `!~Y/7pp08 l'$)(2_J@ D~,sG 苔AEbFE6ZVjQm TAKB1B| RYo)P!C%Pbiɜm!7zwS{9{ceО ~ Y|~%>`_~ rX+iϙ|G|ldFvldFqFvldFbx J1PXP! !v%mPv(kbqR"RuBdevo񘉗{CP8<ӃgzL3=x<'z<Oz</ 1Q<&D(; w;ƃx^k!9N?E@Es\Xj012#w/Ope챍Z!y̰1qHH[qqt\S<Ƚ=}+7pL,ʓ\9 dryGn%9i)vRY-6%9GDxa2L4X(͕/͹x?tӲ Gr:D$ReTVsL3޵,hpmYY2=Kg,%ӳdzLϒY2=xTlc؏;]Nwŝ.tq;]ȝ)9мɝNtr;N'w:ɝΦ;4i(`+ClRC(p7X*X*X*X*X=*n=wa3⨒,O+rz@OH^p70n?G6!p' `)K5ކw`» x> Cl` | j)QrO vn{9( 0upy;# ,{de/|  pHze%O[[B+h m I-ղĆeжAVއ`#l~7s {{BGYm tnd .+H{/' `Q ,`!bq Nh͡\.YZAkhI.v@c 1t.ѧ^p=0XG9=aL0 f]w}@b6}TqFUdI,cHzbGlKx 8Hf24p%-^V(R3t .dbMwjRk:}za7Mp3 A0nwP pYc|ß`$ĕ9<sa/|xXu(Kd^7`,$f6`=ޅLx6l`3|[c>%<]װ`?[CDQ$D "${LYx"g!Yx"g!Yx"g!Y6 G>OS !_ _B.|`7N pX]"ZAkhI"FZ|^%aDm=g}gQ,mkD3c9 FmF?~!\s 7|lVx6Vx6ǎ:"e-}cUg po9|ƶQcŦs}TCj je=QV؝ CYgOp1K:Ѝ2Hp RD>_3F1X 6C Ă   C \ZAkhI.v@?cg 1t.31W@"bOW9s C1|FdfN>d fu1cۣ{0XPW< 3y, s~cC1+د&iMűpo,V"7:7EI4Œb[s $ɊضEҘMmf]ykbX/S; 8CZGԛ&=*iKE᧢;F=0/X,Ű,V*X oX oWx2? =#Y O#?^Q~<.[.={q/)iH2"-"-"-"-"-"-"-"-"-"-"-"-"-"-"qwSqCN w0#)}1,UM;=qgu< dƞس{cby=1<ƞd#ECWʣ_y+~ѯ<'bt,NX A:oI =)kΦLϦLϦxwޕлzWBJ] I2X&ˤct,eұL:I2X&ˤct,eұL:I2X&ˤct,eұL:I2X&ˤct,%(P%(P%(P%(PeP!R!THD[F?яZWz]ߴՔWjʫW5S!lu[VPcjBQ1 5F(HETHETHETHETHETHETHETHETHETHETHETHETHETHETHETPcjBQ1 5F(Hv|Ag,F<dO1D}>M>䣃 ?f3>g?3|O?G>ȧ#~ӏ|xe=xHbxb0&Bsn&1c̀0 fx^0^Gl#6㈍q8bc1Gl#.㈋q8bq1G\L/xs9^nqgΞi[-b1w{G{G{G{G{G{G{G{G{G{G{G{G{G{G{G{GFE1qˆ29FkDFkګv3H)Ff~,BQF(3e&d2Qf2LF(3e&d2Qf2LF(3e&d2Qf2LF(3e&d2Qf2LF)e$ 9AF3 8H^c$匤#,b$[AlwvAF2U`T*Qe0 F2U`T*Qe0 F2U`T*Qe0 F2U`T*Qe0 F<i㾌cbcy71dƓxOcu)o*SeX 6C Ă   C \ZAkhI.:h:hOna [0mp;c<a<IO03S!i>asNb1*+d=4O~ԊX!"xR!'D qE#Q=,Cd&D aBdGP?ԏ~#AGP?ԏ~#AGP?ԏ~#AGA?0a0F8xq O$x ɀ6AFP7ԍnu#"uOQ<<‡ jv ji4E\<ϕn_L%fqlYWx~%ذp;ED%4343434s(!bBltFltF(b\lrQ.6F(b\lrQ.6F(b\lrQ.6Fȏȏȏȏ̐JfH%3R dT2C*!̐JfH%3R dT2C*!6>`6>`ظbBl\ q!6.ƅظbBl\ q!6.ƅظbBl\ q!6.` `{`;XNr:ӱa; b ^ҋf,X+`X?)X+b+b+b+b+b+b+b+b+b+b+b+b+b+b+b+tc%+XIJ:Vұtc%+XIJ:VұR+R+R+R+R)V*JX+bRTJR)V*JX+bRTJR)V*JX+bRT*JQ5g< :V X uS5Vn5Vn5VnuE(FQ7QԍnuE(FQ7QԍnuE(FQ7QԍnuQuQuQuQZ\Nd#2ϐ+U=W*ίu̸:f\3Wnjc1quh]uh]uh]uh]uh]uh]uh]uh]uh]uh]uh]uh]'Gb.Azlį ,0 fb| p)oj񯽽{cbQ=G1(أ{cbQ=G1(أ{cbQ=G1(أ(D Q0A 1̆!l0̆!l0̆!l0̆!lXȏXȏXȏXȏXȏXȏXȏXȏXȏXȏXo0U)q赌C-AQ#(<x11111gTHgcAMgD?ϙ 3>B5fzws={~ _VZ{h!Bʅ̪|&y>榑unVJVpƻxwa;!|C(BʇP>!|C(BʇP>!|C(BʇP>!/0x_ }a,SeL2UX Ta*,SeL2UX Ta*,SeL2UX TZ:p~ݢ \װJ>_\ZX"}KѷԌ2"r*UTek)k):ܠJzՃt]=AWzՃt]=AWzՃt]=AW>ƧT Sa|*O0{){){){){{{{{{{{{{{ OΕ{ԯ]2MZVoP=+k D)˵ZoY|)/j2 }j& E K쁯i>EbB(-2X Ex'5;k8ZYSe0bO<LY? f\ʱ`މc`%)i#"?O8)߷gL; G߽O>b'㫡VLp҄ :Ѕd^|_ eYkNL:_#O\?W\fnJ_CG8n/YO8>8!'ٗi y{>C6*؇ s+AsTiĤ"v`7bZϱ'yTm`/ `- fM~Giq欟ͬ/֜r C pɁxhu4:V.\; :Pɑ̪dLϱ i0?Ƶ^(ܷO힐ܑdLfhfx?P& x0>`|*AgUhYOsD.K {+l`=&„Hq982| HhM{m& .:N#f# Elu+*&7%!17FFF6F&h|3l\x()Q!J$ "? 02ksɷf3c-#̺ۙY0eƼŒsY `޿8}f?)xxl cS?"Go[ޥWF;sskcS%3d\W.k#=Csuxsxs ^y#f2ĂĂ^>e- ׾P>"s`d}d5B:ߧwj d};_WUˬ2XU6sF~#~O|~'USڈ_n/7~| v_;o-?~u:cf.T.@G؅l?1,,؉/a^|aѼhnD=C#z}e(nFV(((>%e|"k5Ț"&#r%"%"E0Q;LKKKK܋a^^"^">XQ((C!#&&Z&ZNED"S)Ct:LT*"*rJ9D">QOd) `|,Ot9It9I9I( ZP@d(RG,upP`#,ˌˌˌˌˌˌa0ۋE"f{n#fyY^:ب{:q-,ŒJeF-gF-gF}35uv݀]70[5]i6bFDl-2FGxr|9#xQ)/˗͵蕅NYxs-ZeUBxu-zZـ>gZ6{#xr<1o`Kxl #oFozE[F[#;N22?O0l?3Vg~zwUIzt7az7'Iz^Iс'U(O:ğY<٪>SӪyѢVE5OE<'E5O<^ӋX#k!F}'wn9`vxs?m|2S9 uD񷑨ZsAb}yyi bq 0ْf*n3۱n9mesEy]!Ф=ѣgd7 \>RѦӇl>l۰t/4& ߻13 5+osqcҧz*_%~Ї]γy<8=<8.>\~6O 1aI76FFS7.q#1{#ŵgszpf <O>]XͪONTF%цR[QPk+jmen,-.F|Tgy ̸׆8DC.O/C0<)̯:A2<|}AhJ_׮'DG՘Zv&ukdy<^Qrx9UWrp9y<\+c+cq*ro_ȻUTEr*j`yW%b4jZ* ,H ~`jC-k.}{ŵ}#񯽰id+~\_µPň;-Ɛ6w<ňC8t/`'Wt=_KyJV Pq/<M+ V 48뭏k^B$Y0%>}F>CZ0u\n@omCmKƟP3j05W+L ScgWajjuN:'L ;'G_ \+:sq4~QЯ Яjߩ֢a-a@Z4GZ{ а D+T;j'Q$JPGo/JDPÇ>5|C JD*P >іq2RXjq-_CFN^З81l6ȑԻUX܌M}[8܌8JC)cp37cpIbG$xgb\"0fi8AלEÏ\$;\W@ WUp5\) zõpp=0n&-`00p Srn+a| \bY p\lm&7X[.Y`m 5$(KAJrIOT-ݶXn[Tػ C 0Zg |?%e\Q8F1c`w ;&! rz 9="^c(9gȂXڊHxE Ze r0a0Fp`](X#Ltxtoތ7oƛ7͛- "X K`)o2`XV;ܷXC12>8 @Pɱfj[,8 $AW`Cc7g?10RaY,1^Ń6}&:vt`mcmcmcmc0 Θs;s۩\),T#Vb g;E'z0Nk5:||>_~>?wIl8-W`Xt¢;,;9V]UaEXuV]ūW$S&MQo+!0BQML/PM/SMƲOc%3yxOѿ]_]{;F)_p捃y`87捃yx bX:`9 VÛ[6c»)mfLa</\/K0^^W5Xa o2X+`%բM")1VIt@hCxYp|!'gfNh4m3xHDhAu{%pPAS|T>"_g"_g*@J @%P T*@J @L#J%㬴x&“0 2:L)݈:]&&&&&:h :h :򮟼'ɻ~򮟼'ɻ~򮟼'ɿ:W'_uNɿ:W'_ R(P!C%P%?!o'o'o'o'o'%%%%ϥR{^jz/5KM復R{^jz/5KM復R{^jz/5KM復R{^jz/5KM復R{^jz/5KMU$e td"7M&rd"7M&rd"7M&rd"7M&rd"7M&rd"7M&rܬ%YKd-N;YKd-Z"D6kl7¡7,HswdN5 l;llAu+/j]&ٌ$}=#rb;D+k, r,!e59^.d9'YIsd9'YIsd9'YIsT*tJ:@%PIT*tJ:@%e7a mxG&s&sfݕͺ+uW6YAuEdQYAuEdQYAuEdQuNSgԙ:uNSgԙ:uNSgԙ:unAKj8 uP?s<<̜FfvJJJJ[HLF&O'+}"&;Y5 |R P@M8NV>V>V>V>2deceᳵK3ǺkYe S8mWsDgV>*TNV>V>V>V>V>V>*4*4*4*4qFGm@LT b(Y/Jm{[8l$a/26lɺk3ytSq8Tn٬Y d- zx'l{`Mͺ@g].Y T)Y tT+KA0Fe}'9eO06bgvY;T8*k5n_o6ԩz't: N4*AԙuN%4JBgmY[-t:R*THKwbXO U'TM۩S-ͥZZJji.ՒMrSuT]n.7UMrSuT]n.7UMIOz|{0&S2@BsScpbϵȝ1 j7V$*8w,cHfǶ=q?9i2Ȁ\<_IsR9T|N*>'IsR9T|N*>'IsR9T|N*>'IsR9T|+>/*bT<$<,+86q:^ k#-[fk;8DP3;^kҭVbQCȒgnyohz#pZH$5SxS%?~ !ڗsi+Z%yra<}-Owm<@hnȧO#@iG9!#xvTrs\ݒ~NsEGvټ{:L>^N2lSկzְuQ?_%?A!fxR6Qv\NZgDdꗛ2iM`dVƨ7 ʰ'al`! A?a\ ̇a,WUX$V-** 8Hf@TZE@,Q% D!(X;bBP C!v(ءt`,PFVLa</\/K0^%2OY  X)ԫ7#VbnϢ,l|#ߣ _iҥ6hu cv'5p\6-ֆ,6|Kl&kknq'r]` ,L  `6PZm-Զj[ BmkPZm-Զj[ BmkPZm-ԶmwY`ِ/`/!]8 c" 'X*l-_rzQa,U|gxlxlǶ')|9 96n <۷ @9PDpB3hmd= zSr} ́a)V{Z 2Ys9JW y̋ycVq|5 k e^3bWXaa< i|w0w|w0"X K:^7`,VjxZx X.dqwHwca<'̀0 fx^0^`> `!kxހeVJX+X>qrZ!ylN|fLguP?OĪd~Y?묟u:gYg~Y?묟u:gYg~Y?묟u:gYg~Y?묟u:gYg~Y?묟u:gY7>֬A֬A֬A֬A֬A֡}uuuO͔%d dR5*+ZYaͦ\֝FG.5\k,pApAp͚IgͤfY3鬙tL:k,AYSXdb F0 />@7:MmvSu_Wթu_Wթu_Wթu_Wթu_z5H^թQ7tCuj uNSoc]G5{Ԕ>jJ_LY? f˒Hh \ s]O7ԘZ切hh_.qCz?"wjGE _sJ8zZ^bm}2߲SxRgn,dW8ep(#n"՛՛rsJsgv 0߉L>Gړ-M&[f- z8O>M%T&)צC'o6j")kih ;RqZKY÷M/Y [vXp@C$DsmZQ1Gzh$-[De*ó0 2`:<3`&̂"| k)SX&Oa;6}1MMV_SNfї'P݆{hY-|qrXtmsihMWoj&뀖N}BtVB,ҝd>\/.]Q<*!t|RO( nXJ^[ѦQ[[(k(k(k(k(k(k(k(ϼ4,.5ֿxi?C(<:9T=7%dXBAZi\k#~Obڸ3=kƛ8R EWӢ8YMA=?nj<{Pܧ 'YLtK%W+T=hŴs*G|$Iжfm!G0FtL()(is,>JbY7=:dWfaci;N p u(SM_uyOl/wfFT"ahXc=2| q qM:F{y_?!1?IH#(F4`{Fzq^cAz-u^6+Ru7'LlO$x 4kXM[M_J:W}3o&6 ì| Y r$jI=hub1-GZIX!-#\Y•טn欗#^Z1uku ޟ=n,}l/Zp>RϪTgAS'Ka^i:FĚW9DǼִ {fvx<:DKXZjᰴ_gUKusʹn̨*-hb^ʾ7 \wsjhG̫ۘO1d>F_V-8ڈɕAlOh:RwN5]9֍ϗDZ WcVKOo+Vҙs]8xU40GچvrŨ׎wB@'wXWwlFA-9JVZZc>`v<k:p5 ;9M]W釋~$m'7ک>CaS=k]_wvO}Y{O f{wuf *.Zkɑpwh+`Lӎ#1G j6pXؓc!]5 ]ذsPOTkf6&6$YjXbv.5"2]oIh'1P-$HM>iiiW]Pł*=uK#t\ׅr]7 ed5H3]fUmOUbnOdKF_IW?]ƿ;tܣjh\kx?c^u_\Z{ۖT%pO!D?q5@q"׈ş8:mx\*&;%R_x˚Po£WzcʝPSeh"UƊ*/8QLT&ZeJ)oWֲuPfT٨lR:*_*jKQS~MJ urz:DYUnUG(TWG*(CԱXNu2T}L}LW'))jr:M<.P_SP+Uje~LW?U(/_eUO+YjZ|J%GRk/ԳjKPj)4לZ \JJkxZ'Z.Ӻ+'ZODJJ9](i딀O|ݠݨvvnnU*0EF*mrV=ɣhϪVm6CfixmRM6kUU۪6>>Wk۵]j ͭS/Jr2-IՒ,-7XnPG[,, -ԧ,PXZ|g)HuauxZ`-qk곞VK~_=m-gJoVAkVU+zUdU6-Q554[ [KbkckuEuߙٝlfB!F1FDL"""EH)"b_;͒R""""ERD"RDDM >|Ι;wܹs~i|@@zBX>&=).V"JT\IW2-Jr2@ CCKڧ UK(*JQ(_he2A:LRrJR(T(~s%THR Vy +(s 2OgHT+ 3$9e!Yy^yՐEypw!S9 5CjvWo4䩙j@E2[ S!PM38=b>~C;w:I7TZl(SjP冐RÆ*NfVRgGG 0]>exH1u0[=~ax\RzF=c03<c1Qb OǴ3,iְ0}L{s1bR cRcR KL`6e^4r +MBßLSLS 6Lvj41yM^˦)hXk*3U^1ՙ^3m4m5|dz״pt/iױɆs]bgScb5Έ]8?Skd|K^OmV`lԦhNY\[6k^/iA-(ʴ9Afʩ,m|͖֠ӵ9B:mHk_i/jګ 55P m|]%ߧvc=^m<^P;)j_hgdvV;'f&E(,WcfgNI,s9E~ԜjNgSJs<\e6כ5?&/5?n#?o~)S gϙ %Nb`JnrV~1a(,v]zv-W~v<+;W`ik>Y_!zHhK[??KJ}Cィ-?e&,oٻX:~ͩCqOa9[vs!~\K|z>z"<:~B?՜'hj\V(70k i=Z>{> UzR4ow˳hop77qJ[qQ-?YY??CQ+l3MDP:۾h+c1Oe\g#F㢑%˟eMi^jG{w|ѕe~o% 8:}e}^p3էG^d4V.gS3Nre^ދ|/of~7tlVy$ssy|bhc{YO0࣬Z<&poՉWl {{lLxñlc=.dsli"kXcXSxc<{K~I~m_7uYgos{Wq{O?q}'vOO?zTǔ̽(A^`^`^ǽ(!{QBE ]% S%(QU$ ~YB0Z$Ֆk˅7&񅝜 {89s|}񅃜 _89)I8p.|pc%K[K;Qc`7d7"flSl1r~EaK2aU2Y Zbk-ٖ ,}`13 {ב}>Ǩ9}:3XX;lMvBv)]jdDS#댇u6C,Yj2Yj;ԶdRۈ6&^EhX[X4.;Kb` dɰqAq:8鉰tXL00#l8j8b N _Y+Ws,}}G,A bʝʝ̠ H0b$ E c7LUct}8qq2bX0Z`qʃ2^Ҕ ?i#`L^Vʼn2Ŋ 9%J Q50b1JWRr+04:W1[a>Y,(>acڧHNgg(sR;2_h_ }ZFJ;2gvj53c6 f,x5ǚcQF3Y`Y$Y{h, 2Y#jdtsO3! C>9Og ׳gQsŨ?! R/Dp"O"3#~#܈&Iw{{HŢI} }m b %'Z &B[ \n =]W*1#Q%d4FplM/G H$JcYv^ ^4^ sL!LrI,?f4SzX ]{»(@e  $2#aY;p,G)$Gb1bb9J$eJNV&C+B(7r<@4#a!Z9)@J#XV"M!Db 29B(5( L"SI5)k H?JwpoGl=/LN;{SԷW/zGHexiʻgQ[w⫯~6?Z۾hj=;e?f}!+uon?Y zE8k"ܤIh-is5|#s}ӎÕW' W:v_5E6_%}ґ;DQ~\ȷ'žcs *"R? 3ǧ^Mg}(u뤿y̦;|?VBOE4=[q͹u 4w`:lNݧi-o9k}θ{kmOtE[65 0f=#&7dǢ{8 =xNZY&^S|hH)X6F0c:GKW\JV˲O0[mO 9^}؈}?!WG^05+hzhz'pCg*{"z%#@mOoat](r" zB7"Vy"-w<5Z;`,/+ʾS=zBVd;2Gﳨ.f/~k!39S>_wsMzLzX!1W? u/Ы҇.џn9@OenWtsXߣoojxY33J(`/#_~=O5K OEqY|Wz?%_/~K:sϸק?kewϹ͹x_?K߳?}- ??4_6`5t/#4LeđL#W[-z/ǽ=;=+kW˙ǁy=3~ j~J'5e-=6 7ڜ~/|ߦe+V=FK6] w?oo7Hh:^_:iWݷEeIdǿy?KߒhRt{]Zv.Gjw{.}riU:å.xg<} |ϣ=Jƻ~^yn`ѧ߳Wni ǟW?J_{^Rg}u5{f_t1󀾈\w|!n>yVx{'6N}4MwTg׼#W+j'}7Q\o&hOOw5yTk!DwP^#}!%} asnYeQ>J yMwbZxL /py'p=!l0뻰12G c}3 8J6\MF#yDq#tėx,eKG\c鈯X:<_t <1}LEG+#nQtĝ<*wGGő#<*;*vԋ! QqpqZpGzÑfx8ң<Hy<9GZHpUby<*#H[x<<Ñvx8{<Ñ}>lx40f#}£Hh6)F:m-EXsxK6+k%d& o,@V, [[3 k;&@v ӱ(Zv=SY7 Z 苹sjFno=dzI#7w.˭ `I`AVڲJa"Pc`aIuX{! |9BANlGyNxz#a荄=e/XO^GӀ큪^,qv0۝;!lwBDzplEn*yo!пʄ_BO۟o&oYL\RXGq!r'B䫁_._E܅p9;WwB}aUѝK@k%NR'R{UJmj u ͮ؍,R_lUeqwvwзuۺ;{ہ,21> _0e Oކg ϲEX; K, 2kc=9gcYw>1f]jf6g|{`F}0`L54dmb́2GGY+'OX3x)ukmrJ~foD`wwFl}LPO<G^v쓁r@T.Ek KB=UrjaP-W[kZԏs3s󣬧 7|f0C?s,I~Rؗb}|By!"v#QeXB^}_W?Uu,:|U^ y~%mHMlFNj.ڹGÒM^y/W@,zPQsKi__=gsiҚT6c$%ݤ\td6e} :6H\nV)ݐsr#E@ =(K27)7ak,% GE~J?ߪ܊oHZ؍@@@@@@@$ZX{ZZX2g-H>v JRa͠%`3(Rga/pfrPa]\)Z.e8A)jBeu 1ǀ!F`8A4~0̏1q1qxO'&!&iӖ 11,9CLSbRPX VtFF1t~GF#[oc9gBNi1M7-G i0'sBc&Ɗɬ?O,3%,OL  ƱY+m6j eNDm"m2yZk(Sm Vƺhv͎2͉2.ͅ%]NC_# L+.*XR ZFɩTjpz!ff7Ak~L2s'\6駴P~6駵Qm>=ҵB9o1^=M[e2y^{[_^^]Va럵]CΫګSS~CҴhQMm FWܪmQko#g uG=(O'H}z_~iX:g*0`jf5fg=<͌20`#Qsj~3Q䀉9e23Qh0QFLs&n'FLb"qp~LNw&N@-qDI-)LQ£)ꁑ(ꁑ)ꁑhHQ4z`(`zGQPԃnz0Ǎ4 fbnL⸽q,~w,!Oc@{ e.[NC!!\WO[b௫_^b kױ z;ׁ=k+b0W\!0_6m(.C$b2X(.Ct(8a_X¹At?O ͣB!osHyQgWQ HhiQ2"cFtX)9o ܓMĘKs||RWIoboFԇunt mm3CKz$q{C$|x'[WN$ܞrop[77 mĘooH,4dG,8tj1t 1fB\9xx,Yq,})!&+km)o'Nyq  +7+7Cs9mm[(ފhoEx+R#[1*#8:b+E]LQW(0Ҏ+Fb+FQԕQW4R+FQc+FQ#E]+(ꊑhu]+FQԕauHQW-)ꊉhuHQWb+E]1R)ꊑhuHQWQԕu% +C)ueE]iGQWue0E]JQWb+(>X,5?kkY_ ^^zX&wP{DyK $V@sv P@VލچAp V-?p:A9(M=!(Xu{yTTrJ }7hO2CRg30,q@~B&y}ggν[O {qʼmi4jCv+П5Fe?1Ř6Ȋiq;yȋ]LJ/ћ1c:Ebsha kc ϡiir&&~"SdNmrC;c;a'"X(Ž<ۙ;4^/676FD#qCq=3/q=iɗ(ԊtЉ<98vj`^͋3tJRk`OO~t<o:Ay'\=''\ ?IkODBnО՞~N{{70\#<#m<!"&xFj%M[AWWz 7h غDpm7lݮ@>zih$ nC?o>j;*njq\'$?E1R v9| ^F"Gzes^D@GӋ!Qݐ}#Ѳ<^I튔=C5MGz 8s&}!*&lsr\XA!)ΐ HHdB-MGl|MۇAFB@Cr!E߮qB-epu=dfZmȹ̃,,ikn[a9#v5w^$ kUSol\m-{ 'ڝ &tH8@'8C';AwtNw\J9*mB[x^Vlb/89>΂e|kU ^{rN{H:k&rI/JuG8kG;g@s6T{UϬ\?>r\hsq&_{LʭeAʪ~fVr!&ZV s8B//8qHՐ K*wO\<^{B}ؗW ľSЛgWUr=a}m *O<߬*Q־ă ]ljN)>^}8Lqf}8*;Pܽ*o393ThN\qt"<:a}gȐ v7y~k6)s񀐉9Ńi^Q6tYٲ<++Cenh,簆f[k|YY'N- -A.GEh5ltײ射0kͺwb؆1=*x p*37@. =x[h߫jzU+BksBr^NzC֪9C⚧s6 ɞXT>gs ҧ/Jo+> Šd.r=߫j~ж9\G]I'\Ч]iًC{rr=V-^X?Iv ݛt쥮Hk!IQ<߱jTX䤹Vdpl Օe ^::cKI\u(?@=ȩZJz]dkFǮЉ-hpWu嚎A~Ic]DB'e搞߬\. hk5tktkcI][váf"} z$Z8ǵ^ 9h^Gc4uBM{'-r:0iǹ*y *҇>q]mzT $zcI2RJq{̩ '*mnz%FgBU|9g2>7IJvN&.ڬ>Y2ؤFpΕ?ܠ1W,ɩ\@[JbnBTnrIjnǒJjCqaKn^% >^ }JbnɹKTTzhɲ;NQ2t:{{hC[OJ6Aә+ S#8~eBY )[=l}{qcU)- fSHR?ȚWa-;Z-jinA7^/+]r0'7Xr$d \[[rre3(se܆ܹnSUІeM+ݝCkãs73+nugpvF?s t sDŽ{=>= 8qksϻ*}]mrɉṓSܳ &wv /^^6{IxL( WwYfPi}d&ro o<ؽ3u0#q1TrPɹݓ'vOW.u.5ޣU<=ۓTyj>>5(gOx\3O{|\L5L>KWj"<>5t Τ3Qv<3r}U)/3rk^}̼Th:>K=aGr;uL^WϢc(=tn^#y=+pN^e9qugz6Bᚳ֩ay=["Lu̼Q!CX.h#'۳7Z&=B>.!<<ByV\á<Եycy՞=Ys.S7ޜ7+L*Zn[M9@żގh o=yݦ[:g꡼-S"y۽CT'=l89oN5 aaoAwkNzy`uR9&,CEo-f|̶թ*m-Zi\ކCȼ@zݤ>g,zw"3>j>XLh#ovd>I9>OՈ\<܍|31XT|˫sNV6V%>I LpP%6WimӉv[]eGZekҭeGXԜN/;_?:P:˔ǡDE)K;XWgXWw[וgYnA"a!c0o._?z<7h=Y^Tΐz[?X6M,/_`S|V-_6KLҳ/%/_iX~-|yz[Ulo)P#NS>W!ֿ|[gTzhx|7eU}FQF_3%J+?]ߖS~H*WVP!X)Zh^rLERh]tt[" m / )Ҟڊ3*z2_hb`)܊!3#\mq(ԶblhmeEvyۚi?h[_afmpM&ui48m!%?N[n\q~"iCEǠ3+Nh'2m- ٩mgU!}@Zb\i -Let [S;h\;Qӱ wjc٪Eݚ\^0̯t'=ҟZӫ`?OxYxmwE͹5 k8j5QP[3 =nR\AxMNL5ywB^5A5oE`\q`U3`_P_Q3`fA6tY5 v,#`~EKWq,Y_pȿfSQ'kvo]pֿfGњ̿HW/ Ǫ|dͩTc͙ Ehy~=^k(՚"mXWPk ,)*O$v.Xӫ_ 6p`[8T8$Ы{@QYcj\P[v`h` kGZj9 Š:uNkڲ9pzڙskg. ,W"jVڅ+kn ][kWEeRj`S큭 wvn.]@`_Á{ G=QC3G מ(]EjT{ #:]d &B'Sj%;LXQz0N.̪ӊz K*VZ4(8.hhpLhvшEUh\sQNYף +jDzu+3fOm.  \X7<{KpI(塳EUuc֍P]4#94lVWYg-S*Z_/Z׭>xMF{ U6u&VTQU͏޽*s6Q%.O#Y;9c—B#7 d(,F5+ƉYl+&Vb؁;]X1Cf!үYq.ltKX ,Ղ]mh hadž[&XjG-e8儥Ake~Z֚bl4a\f3Y5a]!>L=ALZ mAH2( BP( ]za0D+<-/$-< x nG5Pfx2>sEvk/y-GWBre}}}[e}}(6/0AOO:Cn^4G#ɑJK}CFH#V::Vicb 5I`1tv-3nXv#eaaX,l.wl,}W8bi $fmYY;V=%h(r{ K*=ljgFƖssdtl&̃ i|΅s3"ұñכ}G|f!So: l>n&_Oq>3r4.A9:;*893M1oKE_cqәMmlޟxsrqw-r-kq [EŸhEo["Mrc]Oqk,dK؄-1!2obɘ_A?ϒܠ(XQ V|Y}op:/[RE|$CcZ}p>('(\T2;%+#X$ %˃KV n8\!dsp/q2eɶwgp3g✧u>v(Hy76I'^ ? 5qY8ky]GnVr4"?8jɿ8 xo+ߗIr}h]Bcsq5۷9Ϸdossss$_s\K{wn$;*=~s?yȟ<]ti7Yb4ފeDʅ$ThZ5~{ø*w9f$S\Wxc~W"?]C񮀩xo cw@"?H)>\|29`qc{6 d6K.1R?J >c`+=0-(prݮA2^kh ̯kD+L׸lWN` e,qNۂU|4o+X lplmw5vkZZ˵,pȵ2pԵ&pcB3']g\dA%Q[]IfR,UD1"K,! LٍeD@ ,ۍ}?~3N:u2&?ρ}Ude{1D^43By}.f; ]hj __ qe"+'p p8p"p6p) ``i *euSzf`}ネ͂ A_JLS[W0# N68&վRb8'+%.%/8=8;Rp^papIpEpMp}psp[pGpo`HT`ݍ$/g W`}ex2Jf ̨qX>\@=$J$A9h)!ʈ,4NޅлqZ qZ8 {pZ444-JW4.NC4E qL>3чp& gLVQhK™8m368m3v8MОӆDyy3QD;L1H_.>>q&$DL)c74V^47tqTh^$[wCnOOk=P(*b5q|w .~G~s7%|Gþ₯X)-ɇ<39y$+<8D'ȟt_O~wq߉^3珉JZq*תh)z4WTP>mb [&L\[!j -~X(??!}KE_J񕾽0wﳯ@DzAzA8q\ct :po\*?_~/\+PO+_wg־qЋrf\77qpE~WN ]Si%'ߓ_9{7{ovY_Q-Wzӑ韯q\=n\=-Ь*@eg޸>\HӟZ>¿zQ_kU }p?_1|˱dn1_فy遅%7Ҹ&M/a lfl 셏a"G{.׈],䫜>9ت9C`l'X2X6X1MMcM[;S‚݃`.eLp Fٙ`Api<<1j"HaP W3t&-4*eD!|F%˜q 3fX.^nmFJFW22IH8(M˘17cAeq0heľ=2WeHߗqVPAV>Ys3=u[̽tS3/S?*~U2lVŬجYhf5Yp۲:fu,$8՝6E4Z䌥~Իq΄)Yf?=sP˙LYD>4vލ)иN_?)gmΆ-1~!$r|꙳=g;I}a{-Cȟ/rN1O"TQ9\aŜznXʍ-[ Q0%7#`n8܆9WsjAq2*izz\/G\$Sr k\t"Ǯ\l:kJ}e M/5"kDzI򕈬Y8&oɚܗ5?7kNYfZ.kKvٕtd:#6bl=XgWֳckde7n"ݖ7;%Kv@v~y>L6,r} ٔ6;q~osd_׸ot|;e7ݍZa.*h<{0Ior'HE3_8o&{K1_ENt^3 r҄"=Qh3DTz[.lHOKOAwIҵm׶= MW?'5,}Xי]gk\:7SW*Q;Ě^.ƅ5]Lv1عs`ͫ-5oqYJ`rЊ*m;BK;Kwc]2J +)Eޔgvj;/Q&MSBmOk) g:i)m}OH3ы)-sJH8:9o-oIt҉ۤ.&nM팿sA?Hm$blJ](Doۉ^=mOeڏc1b:a/O$ўbJ{՞us{ÞyVg[ά뀭S,o©W~*G'7i=7ߞ}PUND}"DwޅRmRyymҴk9P*:ޘ/ypl9|D M>YD剽 N:q=nەH7oxg\N\X8ىsknvcȸ#8c+щ :Q~=|"?E/q]o%jC"Kgh̍:&JY$r?ܒ±TY8&Nwq&1:yv&I.w\X6Ed֗ij˶̍5OPc9_I[x*Rka4_4;~R5q6OfjG.GZS]j:*?0Nf]Бv"SFy|.؀EJoZf5]uUTt]wcݺvsUx.^&J<D53'e4y;Nc4כKs7d=nv's,+m+cNLs)%se21;rDzNﲽN3B259ö##r]52#XߨBX(PA)RCJM [8R(uԓRRoJ(QFiq&QFi&NZ@i1eVQZGigtB>tRH0RD{qJ)UVRuJ5)Sj\ތR+J |:9(A)J) 4xJ)M4e)U,t[^RwsxJ)ݹnwܐ/[$uݹwvP Oe;AC({{/'dW'$'נck'On<++91crY}<$yD Sg$I(yiJyK] %IH|/̧|}|18_C_S_E>/F&%M---mmP:2}'|g}|F;PJj"whԬC+\:ts^PL\t 0kx1wOdwa/DZa n>Ἇ! c(4Pob(*:NUWT,hgD;5D j):Zֈaj:. r{>!t򪧜tI qr>\tRY'Ѩ&h4۲My5/sOtRBl.5;;;ɸ{g{yzxWxZ=H#SDhGhbx8tC8' Rj oTOꇠw>s&b*JTWOŽ:!bk';nAǃ hݏ0Μ jtu! .FuFǿz22K 3^}m5 ?ӮStkm:#Jz~^;`vBmE}y揠ue7r[ ͨ4bLM< R Oy#mO' 681>4 ~X4 u4~<l[AjLBn=hK k6|/!Xhz99pI5.]tQ,NG8`C!9|p:aehLkW;]!?t<0 :Ba BOaZtc'a"Kjan(^(! ~6k!hXz5rS[-Q0w# &K^2z2ck0_in&LCنykd6^so4m=BTXl3,Hsk6A/g|=9;ٰ<[G6F{1f?s 3& mW 3iv򋌍oy8 ڶs̞?Wk*H8#9[]uIiT#TKg%ݳ@/x%Wu=| >Hhu}\581}`,0e!?ƃNwclʆ c', FR'5бęndAgږ:Г=)Г=)Гk6ْ%e 0FԿ;XFߡV@ߡ@?kOWRxE = f nƅd)pӺ([Nfs)Yf.[VC pry$)fC0p[Ռ[Zhxlg5alCdTX)VJRS_>= /AWz^3w ^3㷶gFmwE~ } ~*tn5,S{Zg5 ܉LDmS!i<9FЮ}g ׾1'y.7ɞ8iL?C8%5Oh܍]O*|!@c|6bG(u'*p!cg:]~[(.QFc )zv792u6ʳ|Q$ ދܲ`[Yq CyVU ]n1HF+V@:=x5h~zc/bw!ġuF^S 4ِ!\ 'md ఆ :J]eqf#׀7ap_mi#7^ 1#leҎÜ꺛=;MFYDnr#^Nzr'}X`>˂ƻf .1r 4OCmP4v<{g(%bc-;W`!Z4;XmmSSS177dK$X",v܏^m#gM;Ǖk7@Ѣg0N(zFpEGs̞*ԐaK) odF ;3ےQ~%w^|7#0v>{a4:RxJ3 *qːFS IQXg켮s6S9Y!bZ{SW1^f٣4\aaTf߹dykxUR _4IH,o8@pRattU9j#Đhމ?XH {f[sA_E+fƏα• g^P1Ipπ1-(Nȗr>﵍GyaFaF~ܜ:]'b*&v4yTYxq`] WzdT]-y84<<er+^=i*k#ޏܻ1lQBs+Ȍ&ؗyN>#1;s+ϰb%0vm>٣;t}4GxW<ѵ,=zp+r;sE<##w(SPY>@?("7"{o^Gw*B{90Fpg|ݴ` qv#xod4zԶ7~XWi txJ /`Kg/qLGM?l2Dˈ=[QƳ9kj ]]I*jɵ2 B3h`߾3nԁhN4r*9\јͧDW w Lf?scTb~t[b%,X հ4~ :g%֛ϒxJ,%+wȥ' "#s>o ~xc@($+b99PpJs ;ܱc>܆<ꣿ$-5*σy<9^ss5F>X`k+ ηY~q9-X`wg5C >F Y5~H( [i 4fk`1Ɨ|@ #6S :Ofuk(O0!q%^f"`&s .@+vE٠Q9 * C}NIfo9Y:X-!s; /v<xX E48< `5AƮ-8PULeo6˶9h\mshW;]J`m-5-Pi4< 7[P% )y j0F;ʌhNYm`;:~ ,ɌFvcZp|<3=3[]=1MP}aa؟YQ5 =ͣ vcQ@7,|/q(%@ vgOTp:0G+84Ѝid+ِ9 k˟GNO׮=sːY,Qk,<5TWE'ku}ېjCzn6m7ˈS䪡^s=W :+x,t-mk0ho{'}|5 ~m1csl"-GfADKkǺ8%/ A؉T[>8v鍁;t۶'^ f%mMox"" Y};p  ip&t&)v6=fسtlȭ,\ oi g|4n#k!> ~3ZS-R7R˜àY^o+='k 1G{g"\H@12[MXޅ1x=%5ﴋgjCzӈLB?#C@7VZ<BnOn&Yض݁m\Ľ81cM>76Ni}X(gIqQ TkFs 4̭5g>NBUquDY\F}Q|HkZze|vFr0Q\(_"ԡ-B9~"pppXF}2Jfg uޖMeb/b˛Pz=V.X*ϥNqS053QKaGԙ5(}5F>3:h]יA.v1A&r4Gstv&9CqQL^հ68(Ph@To+KmO3(hW 3ORA0^@+ ܳ:ךim#p!z, 8e442g9zzIGYெd $ˣlK9:啉Cj1^hlj.$Z 6jHm(8W3cWv([ мڴh մaC~E!h QR7[5AFWWFu:qAЯGv% lhiϸr@^8!ӓLK`A?yHn^0Z@!G D/;3)kZg#pJ]X ࠽F= @sh èڶNh ` p3&JTM7.w@zؽôGL˞mS(U/}잂&E1Z͠:ߡnu!/ٖLҶ sOν + #(v?VAm&d>`]Psۇd_m%mD\ij7uL8hu]l6AkX8J}(lU&Onz$жG  0ɧPjhx7nЎi/oGڏGi[uQT`8j$EBlO>`!>W1(bG0гۭ ְ e Di?kp;";ؑО^D0K1R\vd~28v8&,F."qЎ_,> ߁:FeǴw\5>GYFõzc`Y{<&Q\N9Q A%0栟<$7/Of|z"藁5A_EZNYp^ʎm k9pځ~ga~m[o'4 L{w__|Xe{聼|8!ȭ Ru~%`s+@Ϳ 쌲k@Bpm{Vas5@WvM~@KFМ<use@ϒA 0 cz3 e 2þ' e_4[ :ݏO 4=:Gn IH]3uJsA:z8 {a S@34g$cB&x@#N@g Fc)p`Cu6>Í!=pd:䂼 #zB 4B24hI Ky4Ƃdv\UGC̟AOV@"5F{|?1b_>F|zuC @n_Ra~ vEv_D {WHХ.;2%΄)x D/<=Ow t!>(QcQe ($R2$ڌi tkKNyΑ wi >AUNI(oX&!ONhng4jr{t:5t%'fLpF:]5$gmqv>1g.ҷCp>aԇq&Ur.2:;S2> gbqC8jc2>ܙNw;Ud`ۘjWLk!hA(tI[8CsᲵ=v o!>X@Adc<}7$!w!H[!פ*sNV1 =.Co&22eA} H>|ycS9P6OL@dABmԁ{0oLO7Z2ʾAo!ڊ.\]oܢXh8("pB 1 Ֆk|)q4A J2K!3!Ğ't*ZimqQ8cBk\s *10`mFz*kYxcd;'/n@/F`3x|N:: ,)va|]rF[f,h߲E^d6gp\s'^#iׄi XMsa w(ԭ8|ЍCM>tȤ#wZ1_; |<M)p6{-1ȇoM|2&Bdzr1"׭P[:#:6.Fٯt/~.tǨuk1 gq mxs])Z>t&V`ϒ([c$i׆oL%.& !-J '“YϳQmއmBC#pll ]"ϵ6_ME-zjb-VVgk"OE`# #G| 0FA8*5Ĝf fbaSlIs60}Wѩ;˓\x|2O1 fs~%V0*c!.B}M姬L[=a̧@x&ؾMy`tӢ!?< V(JY ~b uED7ufzHFYe pDY H52a ]v<`5gvgMU}4? fO`юk4Lg6h,q__ 80xE7h[ |gD/Ĝe8*\Eٽz,0`8!̏h9e 8xH,+`Fjzfp+l+x{>2@Vؑ<qdֆ4)LhH|poq0 oGKsѺe ~ < ޱgL(;LT$z-ڸڮ_N$qw'r8 wO"e{:hx_~vvQ AGxpfz4jԵt>kYުSﱆ!c-d;]r񛬢).2[,k>k wMwYe i~wѿYn:o$376 X>$V$ud#oG#wKǀV:N<AR>/^>6rɆ@mc?uh?4=iaP g5Y C8 = $_hC7 o'KDeY=GD37OPIk^IоuQJ(aJ:QxXE Mi1H |1&*{EiQO<(1KwbxUψab ʈRxD)"Md ]t/)ϋ1 ?v4W4g?$ZHB1Uϊ1j!xE[_RJgG_Jb%[DD Hb!jb"IX1 eE5q(OcHO:b6e#b(wdGEE@Ь'zI51@<'FśN DG-j ZxE])^@1DuԸ2X<<h=`i`%`,0:G4fcӀKۀze1^s *`<0&OT>-#0Ca?ۜ  \\\\enn >a Y%`e#s*  66ӫ0e~'`7`/`0888/k pp p&p.ppI`t zf6޾٩F]Ǫ lll ;| sÀcZӀ󁋁+km#S}k]f @, , طn߰h`,6> 9u?X"#3;0#bG.))*45h6dMk?a俄7J~{,/N'O3?3FX_Ļ%:W§Jt'n᩿fҢ*JHҽ*^߫]_FC~z,报bfhQZ:j~m6W[n=OO+~YF2V6meg!X9]. GL,g|_Q$EeB#oskyuVQo\JܪTT1E[ܥ")ϥ-yЭ0VZ"kLZ"YSn=^^nAWbb8~vұνso;Zر~UV[?) qqE>E>(ԭ,eDԏ*\4m E>'ڋ*LHf ZKH̿1K`*)\6jZ֪uqi'$wF;CɳYk BPGhfeK%RġgKT&}.M;> Z!jIGӁ[Wb88kӎ:"^t KoP;NvnP{7 Z^TQk)'7t_G}C!G#yؑőQvo$x ͨp+jx#gr#'9thuzqj)WR%K:,U,jj,TMTYA5UM]j&+檹[P-d%ZU7MVQT/YUt* l-cTʑӲ{@5Pƪg3>5T 5yyFʚj#kj^R/:eS$YWMVezj&jlffFj-9j|@Use5O͓jl!P-"H>>PC|D}>-r\Te+D>֨5L}&ۨ粭B}!۩jLP_/e{J&2I}^V&wҧWj);j|L~)j/W'IIQg:+;|R]T.="].S]a831\g^^//*zW׫B6{=ef.0#~9 JJCUQUhGhQJŨQZUWEbEYUCTMUSWUm?3uEUOwFnz@TREezߪQ"FTqJSi+We,z>rE OjAj&jShQW^j'j&zE"Wի5x@^xzC yInG?|G>0 p_@{Wp>X; y->űT2˼Xfcp,cYEf;yӱ"w,cyEv,2߱;Eu,б{E9y߱dj\Xdi,q,cE>r,ܱ W>v,ұ'eV9YXfcO|Xdcw,cE69ұf"_9Y ,E6ڱV"8X["9w,cEv:Xdc_XG2w,sOE~v,RXcÎE~q,삧7-rԱ1"p,rұi"gXcsE.8X7"XcE9 9rݶL-ٖmDH2G`SyX2{ ?\oujY2A&t2S@|N/ȱE9NDgY yDqyBiyF*sYDm0 vB2QHK CdPdG~Z [GuC_zpP^DJFeQՈ61=2 }GelMf!QݑgS2reՅP9QF)Q(k3wHsu-%; pf2 >2mC\F74 PW_|P//Qn_+E~};i|KEߖKwdE(YszAyoԻR~"WrTu1ϓH|ɿY(%EgפkjM;`͸_.corfo}!FQb#^qe1ALQ,^ST1MFcu1C!fYbx 抷_?QYCEG)'IqJgįΉ₸(~Ⲹ"k"$kz;qYRwջOzO=U不_A=CԳlO]n}WQߧ?~XE?Տ2B?n~FU?o%w~E_Cu AW8RҔ.i0.OveUv=d|Z#(9Z"_3bP.+rFn;/;NK{rQфu#a4v=^Gc8`d4~6 Caq8f7N'Siq8g7.ߌKeqոffYzjn=bZZGVJ[V嵒-h=fX['֓VznzZt+heXVmr\igXA3V]!Pk55iF[c֋8%k5hM^&[ZS45k5zÚiͲf[oZs[sw{"}kZj}d-Zi}bV[kOg:skhm6[_Y[76[ko}ovZko~Z?[!u:j[')u:k]~.[W5+d]a5zۚoc-Y E뷈ADE<18⹈!C#E<1$9I,i3![1oy正r\.a8a42k'aFhfq\?kGVv "FGoE|2S8oGY.ʊ*4' h:k(:##GS\N&/ poCv'Q0ZOik{|_$ڽI.JFU52Ah*prߒS 9őS▜)E8Zm껆:B[魄m'IŒx%X\Xg"ΐ>ݜ?4:=ߙayYe[YxlIsffdcDs$ώܘgd>l̓7g³k͋h.<+>L^{+^wxiB'h1kYL^B卹SϾuSs'SSs'Ϸ*\E(_uyUTqUOF&vInoǪ*9?y^VeU9U4;27{_5]+E[Zuy*su}_ZP x-S-O4kt MHFsiâHzgh$'ɡ$ *` #HAQWT( *b1aB ,TD1a_u"wszS=ݧΩDLiL"d`>M,KDXWWB{9r`-G#6r9Ơcʱ8b@pG+8_[=w!IC!!!!4!CrD1)`R8ľ+i $8PO: )(RCK:]($]2`\p < /)| Oy# B0Fk /̰ Dяc=cao,`,a_,Cap4X` b ]E Rܽ2dVҟV" |),4X~`ΗŲ/J^DX:JC|!42Eu ,w@xD>t:Z:Z:"tAu8EuH>Q]PrCu"tG8Ip PT^E髀JGA"FzrQ]G|cfKGu_H7~(Ƣ8 `߼6Bq,n̿ oyȓ!_b-싼 z" DzG"-*@=1pcv,`P0Xe܉e8܅e܍e$_HG V"-5kayW|],;zD[-W-W-[n=llōrr6W={\ 2UpW=W৺9+PwOL!DLTľ}D6{أzOr]!2T@9 HD`|ac2ȆHE9/L3,bBj-UDST UKS'T&hͥIGK|#L}RT` GL\B+ V *UÂ[;ǂ&K+APBJ )@(J iDh*4 -P,Z 6B[a/^[GW 't: .iZtDj4>3=1(j'NHLG~4dܫ,Sx@īUP\;#`f,d{3ʶo!(nCqı noc/~8vDZ{#q A:G8R (RBzǢ;f! &)Q*G=k> k9̏H)< v^ ht{c3bOS8Iпe*}A7Ѝt3n%d$Eg3h$[ݞ|{_># :@;x]9/߲'!'>/b1 FMg״~Vub®zu/O+CcaWӺ˟~(HK ?K?|]?)?+ Z?+:?ou/>&dn;(~E l?Fn$|@*ry` E: 8 N knm^IvnDp(z6@N F(&PgK P;5].- FJ+d;?8b~F/;N}O&Cm ʾ )Be؄PPDm%}ל j&maچjeB)afj;VP{5 B^8}S.%U7) !%Q{<9}>9S٨=ڙQd5j. C|}%c%ϓ )JmF}THk A\w i_8c r3 v( b1@@ f 3 b1t!y<b1@C !y<b1@C !y<b1@C !y<b1@C !y<b1@C !y<b1@C !y<b1@C !y<b1@C !y<b1@C !y<b1@C~{H[H7Z@=PIge~DQ,k&XHHC Q&<ȅ-e1HSË9}Aŝ~vq ?4P ɫ#o_dpk Ζ" BdnwJ{ ÌTBd|\+1_D ?.9!^,N ODx\B|XQcP"aI "B7M8G_t\orH\FCIJl3ĽlѦ]M&}?rgBb D^bgFstbTD@_-_vVͬzښkqOFS!*4):,ɀ:;@ Ra.pkvNz먣&&G7lWO[8́wBcNl9Qi^MԬ|[,ǣ=2yXks,E֔{7kW3I@/;:nzU~(ZpAc[:/%wzZ75 ݻOFFC"'uiъqJ-N^m匛S{BZo{p)#&lڭ# *iIp8`[PmKCR [x8Ep0Z%Q:Ruqqyx1b 5W?ɳ^2.WQL׵nH5<.6?ܡ^4%9*99EXRyov2KHfZ$&%%O2#kElD#?%IJ@ f~f̾.0y] "_9ۓ˺SrK'VflU!FY+RgKb^vlç)%8w2|AW>^NhrW/ M6 2=㎖ӛ%|KƏ~>c*my, PXIxa S{LkHakQxo]|gޱE'3 yi]o[TFףVolhM75QNXzeʕMGDNaϦ&8bfvhЌk D({65YFc{MPl?~~<ZiSI2v}^Vk3A5~ef3!iW~UoCus8nPw4 l%%i"ɸW^̬t/?$V&j&yn-}Qھ,eyGϮXRV_nr_'@azv?󎑜,_e=b BaAzXDƹ.>Y7BG|aMţnڐkX*{T-/;op@Yk9A g^jsv_d|u棙g[2sV6'5K=ng?Y6J/+iOC¾^0jψ`k-0]9T1gM*_O?eVCL;;bT3rB/i|{L,`/WBc%^Eg?9nnHÚcu $ w|ysL\xMr'UyW6o=|\ִkj]G8Wnz9{ŭ^hTRᤌ~-ǮsEn[n9P@A3P!Q~`0R9ZMaEFqF針]ΊФ7OBOёa!ZRb+2UK1޴b+|_[[cKy{U_9L{ʞz//^=ђ}!qorUьMtZUS*+oǩ~$Kպ~r9/yalNu7.w ] ez >~d ?MSiF}ޮy3.+}|v,Y50ܔ2/}𺏳KeKf<<{Ƶcf~k5R']gֲbTŗvs:~-oH)#݅8$A]."ddxbd&=ӗ0 mG=)b|]pCq؆=3dlW,\T}D"ƻ3(3(9 tp" 8 u n+3[@w81sY&F}-7v4ggOn87ePXaY8jZ<9gKt?0u= PI+ۯgv|uRFG3gߺ5r2m^P-,<;* 'rU~{+;dO _,xdˠWr _YloV@TdU\p<`ڏ8;Տ2{%[w妨ș+Jѱď/瑢٧_hx*x~HL{4ب>>j?Yq4sJ+!1 C K8p~g#Pl0  ;Kƾ3hM1n3 ⏱`cbs[_}JQ3~=~KP{:< ޲gu?0VqW Wv5+y;Byl)sg,֋-_YK|wR76M,p:X|9驥œ|V~̜5͙7G+u=p.|[|MƢ0i=#!uuw'RD/wh$PFsuSt{yvNTѯb^UZ-.cVf_]9v3.Tۦg}|LН}NA.Y|= 50o?/9ej#B43t/ ʺsem~>t㼺8uUcNFd5UUzebg aumԻIOķj(e5,;k<8Zn}ւٌb糟yI/\|A `qA{Ɠd֛/q/Oz{^zR|Q7ۚ n W"Lk[4j`JJ KKv s>7-90/Ο̤eo^Ǥ/gҗvu9I8v9*ZU6i4%,qyTrӿca0Xr4S<Q\Kgظ̒~ST/_OJ+{/,gSKSK#M&]~)uϑA׿n;cS7&b]_rICM_>v|yOhcՒ+{'/,@ԩoD7.I}ոf IOQ+c4%sz{tW;_\iYܠ7tJü]Yk|qsvNP5'=yA!ko ֊PZ\۟mƆ2EC#Gw }woL.7X_;'4V=6/曶V{]x9&lQM]Uh U'i×w",ν]HzɬLӼW*qtasҺukNBsAiִȻ"%UyS=:wF<.e A>_fE)qaK.:6R8UR{jTg9aQS&bNY[]7DT_Lw!~>}m( >ߜX#v_xAw}K G_3#l_vۇ{ ÄwP<+2N3CJBC]DI qhjE)iz:$&K Ì`m/ 0UNⳔNJSe_'ZJVxQQ :D}_E&ς[Юk0I|~2_浞}3eMkWeu21Yҥq"3- ,ݶ|2u6[(L&][&WΗvs=iWh.*+N1N[J|?ø0V࣋k5W*TcZca" }3//E? ;=uFL}ݕ5dvܘ2I480DDﻍx BŮ迖|Oa!D:Bı5cm)#|L[X ujmnղze9on-r pSjc4[+n#]Ճfowω|t3WaEgdfΐ5-wGۖfIG2g2\_)Ks϶uf#٬64$9j5|O}_9BFϐa{s{\7-VIf-C952uϼY?qO[] endstream endobj 10 0 obj << /Filter /FlateDecode /Length 124181 /Length1 248904 >> stream X } |U9n7 \HB $,o#Tu֥I j]ZumijնƪUHngΜI~ǹ9s<33s #l%-Sk~Ug6.C' yp>)D~1%.]ak7""=V47c]N9B}gܼ&X U+{݁P]7 {^(x~ͺ5u팈V/0|\JDE"sɡ+U)!B\'Gq;U99/tQ&At-ZB*(e7r!*W^)gq'caz_[C(>LˠIM!whiϡv0= TqϽ==|!z@EsG dz 1W?'k@]_'n!lQxo#igs8~PH&ƽדL3Niy .rs=Я~K؍V{_71ΕJ>GZ{Їga::5`q=ljBAy)*8+E]¿FJ3NieC7М)V9 O ey["QDkE%(u_ұHz Qq=9ap4N"14Ψw7ү* r_0ik覱;,gxq㕝{| jك4siyƽ7YPPQw_W dg! wY)\@_ n(kTFܷhBxo!G+YmU:YRҸ(ۋ\**>QՀ%*k_wqoxM KDq2f޼aO0'<8u?OGүDrГK[: Xrt_ѕ_֟F7{"@ЊB NM<XXz]f_Q;KQ'ZOET?,L,tHʗ˗5^/şы)Pȟ\:Ý?Q ?kP!esͨҡYj eq(͆!ﯛo`T<?>O{]]}p+!<]daa%vs#Vs[ln Vo"P7֌z?q8?A֘u&l)Xgi6Mך:1t8?q8?KpibX;3Q ɐ`Փ&64uh ڊ;уBGoџ[St gs4_/7W+@e`M`k`_/a4dZډIr?GY\ȵt$ _ 2&%U05h /O/:|FW'ܿ_6ysћo7"&y/wo4Rt@7#$L[u|&2!3rBKDQJCT*QGQ;k>Gt s؀؍p2 F|!ށWk~ ??/B xAo2A.(ԂF :A/p*5#9T,gfœ }AƏy_51AD;p[_'HqUggV|EwGwiͷA;4}E_z_~ZH3ŋt/1o֙-M3OklZ[S]UYQ>%VV:xRQaǍh$1;&AQ L9Ҫ хB4\[NN7Qէ ,NOH)c#)1PJU@K|e=;(F Q1@0WK+xa¥VB~}uEG`5}8K!ܶTuvhjbW*ļHѕ]5`DjݝzNh_oeޔpeoַP޴peUoj2oEO><1RyX`AѩW`hVu Ww90kѾXlߚK'#1r/#0r7#c仌ȝȭ͌w6#72r#o1r#2r #W3}\\^F.e==================x#?>s n?a]4t; vv*Q-) 6*@lB*6shh=h~_95TbMT,VeT,b  zh.*QIB*P1^ACK*کhb6hb&-T4SD *S1F*3T*j=u jԃ4rzn .FETДTLQQHETLQKsɡ",Y&t*ҨHb)T$SDRy&R"DRHG ~4.* Ti +PaD0H=:* 5*zNI ykY @O#9T Qa*bwq?i#*>z4>TGȿR.P6Mzޤ?Sq7?Q:|?R*~O~Kū ~TTWhS2|xi)R Ǩ Mczx{ǩxG8JM =L*Sq^>DTt-<*JϡYQ1wQ+e&-T4Soo%wo%{Zu~k:~+x* RQC#;AT[/QoDEu~s5)TĨ( ;LC%vTL7QDEaDA D~i\494evT,Df&tz4*RifH%SDEHh)03D 4? :^*Qn/Z]+iVauㆍr#ڈ9Ѹ1nh]׺Vnƺ]z ŽXǡuX=0ԡujt국[\ݺj .=uqawk֮E [v?:pN܃sZ ZgCY3[[lm)ljm>:pZ4o,om8XZWX:`mkMaukTyހ7LBIgyb7<x<ͥ\b v]?wr1gJZsǟp#%ٍgVb]h 602a۞4 `6p1$7z| >ڠ851Đ3fV4~ Zb&=81F0ٱ |7%5~@{3{#-;4W~y/j30W1J؊KG^_K[]@b A>;*oO~ k ?$J"ɿ L>0J҃&`=X/OчKSKP7p1`"Nv6Vf& 5ՀU KK=n@`0 hffZ3-f@``:`j5j@P(LeRd@ 0 P(y\@ diT@ "D@ p 0@ @ P@)8 ԍ!CS/'> )ǀ>|A{+];xg ?^#~-Uo K/~xE ~)Y3c~ xI<xp0x00<xC?|p^=|pNnp;on8-uk\preKQ]?ac?ac?ac?ac?`l`l`l`l`l`l`l`lac?ac>ac>aOGtR܎P^.@.EIv݋~z9/JArdAh`^L?&zYh̰q3ޏ_?lH-^~ C'a~p> s7W|=P3tЄ根h@ Q'ԟ 4@+*1 -"["T:mDg R[+7MٌhڎvHߛĘpf ؉.4f] v]+F>t% jt9B:- F[ψ3}b98zAâ.@kT#L/ElSbM# u'u't3sŅI=Bہ M\ u|F4tXرZX[h1Dؙ7`D}8ew|l#iCw{-4^ؾDgeT>~(\/C: -0z _vnCR|HQ(z z)4?=)h'&hYSPϣЋ,~ B__W/_{"{ doE#%X)PjDǑ{;UV*OTΡ8JqE pG#y~Lׇܲ^z}\93_; /2sO?MAS(p()&E!='9 oe1 cӇp٬\Y`eiN/[FJ2| ^!eJErAy~EU fJnCO~$Q!//WG| P:`1 dW*&mr弡6/kѼA-NPv%{Xk D?8aD $&,b$:[+~ǒqNp4Vu|a-C'?amXk5[e\Tarr9\xj Qjjn*O⃼LPQ?bQ ޾W[^_Ā_йzadG/ ǟSTL mO $`] (~7/PW8-m6MIFi$qI( SGh.h!$uVc;5Oi8;lE+ݔ75}lLE8ㄨ㩔@tjjT^Cщ hFs2pD:e _8kn8ЕcO2a⼪pN]|״HOUDKK'I$̭3k ͫ80OzmR[?^-hFu he 0TI+V@G}TI+O[8Q[Z4e>, p&7Dz"V|̰ۤaJ͚zn%h9[mil^0ڣRL_;}]m\ߔgP#FYoMI̼:<[`Goq^*)3j۷)̨ܔ#kmʂBzl1C-N1s--cܒn܏_<8'8Ģ%c:5bGmMGV߿+n4ӆwoZv䒺S]O_fBP4ta;Ij$IRR'INL1vESQJGry@kJ'kA2E3bzY==4AZԐ[)e2qL>JZ1{JZ[c5{L*bvl#{$?Ꝅ),R-R-R-R-R-P#:J)j,|' 5fc*fV]~&TL)")3dUBUc/ԢVa,j/ B&/ARKͲ*Cߍ^P'Nbۜj-aP 'i=z2 bI $TT4 H6H73psBEa5j_bi}H{h6QuHvxGDZC'ќ_`"vQ[&bGǿ lZp9￰jzJM7hfyҼE7Y?nwO[-̷,hFtھ'VoJo %JSn>C3`D˲qX+H+H+uED^Gh_C!k}А9b6Xbe4AZ "s 0 Oi+Z=}65Xa8N*uсjc{6cTU9t<5tJQܠ}rZ%W:cƅ36t3./9;rHR!T$"IHR!zlzG@jcX]!Uʭ-!)b}*1F>ܬz 2 sL`ЧI̝ђ\-i2J gCY#EwVLZe/i0LMSI}(gP\(f&:L‚jIjjjjjjjjjYi6yel~Th#I*W`l)!O8ͮ'ٛr#v, 9ނ_6)Ĕˍj-#FmW=͕ A:chxfEnT{hemRemRemRemRemHeh TiZ™/v3 banQ sT[=2~qz<f@̸tM)rdf3Nt H$$fkjbGĎQ;&-&<Ԙ&ӡtfgMVf&BE >q&g/~̨ c⹃çVsI{*~#hQr\^cYm V `3\Nh4@VS7^u4x, )eM#NHԺ=f&LpiTM;e&4]z(`JA:Q~@ii!q$1j $9$%63 I複#;KwRm+wF*aa[|i`8t4w/3Il'wfeօ_NFюNsdܟR;RC?Zؑ9t X5OwxPxWV+PVZjuR5Tv*ARnS$ Ar $&<ν0Ȓ:݁82,Eu7/[w++~$Κ5Yukox۩ΛN>`=]9mU-Yԕ3y|xWEc`‰0.(mKKKKCQ. ETA9G3juGV>J22E:$kC&gv`L'P?mUX nlиleCʑiw2mIu"}筫J#Q6o>O-?Ev|*FW|9""4~2idPY]^ޛ#)'GRN9RH!4պr HБ.p%~0eg$ $.U 3jھXWZRJ'L]UlU8sM`ٜYΛ?'=ۚ\&"d7V=~崖.]U}~$A$Ub SZ@V }bQ[Rf"ftf:IP&Ig&7p, H!lq481;E7X2:ݑKݎI(["jwЪ6Kgg] )Ӓy ze|r,Wvd7,< +bʒ铬Ԓi7}  y!X<lw }q*z(2a7LT4ERrOT5eK,Vܐ+1'1Gqk=d: .9~ ㉜s? }ϛ[5%kb'/9+͒Nm, Ö^U#ESmŞ'^XùyrBF_; UvMIWNh7'%OzKRY+?Yh"*w4ڿ8_hX}>2Y1(~sw>8m\9=JwԎU:"sv][f&Z^ߔ9kɳ''J_Zjxn/^]gmR ر܄pXpb["O7B# WD`p֘J\\-Gt;}?yӾT&^kmOWw Ur%OljɤSg|TR=! eps*` X/D3]wg3_#ȇ! B"/Qh3E7*AU ZPc6 br{F)I(qeLfFA^s!|v,=@ԝ_H}`0ķ5r-)VVi!U J`V] 6SIkD+rP JH08KQa+'?q&? ]/kWQ7k><@rXߗ)T!aeì}y]W4et&FSpY)=w>b]kU_eݸd݆@D ?e)ng^m~O|(Yy}a-I#QCp rLI$#QutrF;%_UڠVEqօocѲz( YHV{RB-q=n=rCr`M<٥`mr$pdO]|p&2y+7p.qgQ)VO;!١]%ΘjZBh=t;VD~(M!Eant{adXh8+#5!{rOHcFڏ?9I1/ݟ&39Ycvy:Y|Y-ZnEk,U>INE<0 Cy˓XFoUJN-Y6wPO'ѺKOXI>s3~khJ*:"&hTN'AT!]:==&! MNkx_۷(td3\4 B~:7G3A/dla]N&/ekϨnwfmrGw{akwHu8r塀?ionׅ[i'6՜:+ud.^%cZu!~woդqvG|pTvߪEM2$fM[š |Kf&6d{#AcZ->vեr\ z^|42>Ҍ/}%Snbu%{SNA֣3E>D.**W!K] Fpe,`u@rXsσ_ǝ*^|uKF!ӤWw7St̩7o{lx^PLnM9j̟S6LO3{Ff*_gO)LΌLȭ[Vb hws"Ҍ /)}n0tJp>||+5'T*'̽KڅC$xjH $\Ǥ FwglA(YD9u5^eg/ߟE n]= z(U W(0熋5l^2˹6nH,hޑ=X4G(w# 9j Zewf E\ŷ>JP;V"  &B5u"ۨ=:Sw:i r͊2ZT%ZS 39=zdj%TLg4Rn.jlXYr-҆HՄ;9!o3HuC=h !hQsJs gM^i!UsrF-wrH5Q}TR.=^U>\4q"7JPLqqjŭQmzOTkXƺLQlɢLOM8ZGet[boNv/_5'y=NþM-A{\P[nNw8=JӢs:kq"zx'7_Qj`pZ kآ4(2rAQG(Q&,*H q6Ƽ61!Z J943ŭZr^iƃ̰' v½$o).`,C!= e FjqcynG~wWL ky&IO&I"LLb{8ejrkq^3w.ϘzS˵9eՑSEfL4 .;쳤y̑^RR^ WԮ,bN\*:rZM uKXg.IXb,汥ש1iT'(̩c*dSO 2pdG<Ɔ"}Fq:FS$sVvun׵Sf5aK626yѕ͊JcUI+J \]RmNJY[=JY![ %0lwc 9Zftmq54C}^&} wWy_}tzw㏩u&OTZ)S5_)uPykg-Α}'SJ2;o8eMM*9gJZ'm(()U%/}2\9KZltzӜ&yp԰"> ی6-,hڬ&JJZ`} !jbk&Me5I j鮭s5\|at1XKwtH/'LԠ]UZPFD($i;QIM\sMm!~‘U]J).-JM0yv'1]Ԩ.RT$ilQ٢c+fK8ًo^RS'/sAy34ίLlk8~mJYc6%%bK،.mvɏ6)ފu3e ^'hMCI;1'$ԃJv[;|^dChd˧הLOᲊc\JqJq~ƻZ0 #SM qQ3ʤ s9oGm|)R~Da z'.Mqy0\J]ԤEf'?`'.)UI+K sgxtk.8g#,ۚ"( RU-rl 2;эX}'i#,k"leuYLs@jlU7柸w;kozM6,khj(ӨS,=e ɂSˠFl>v̡τr%OEo#tJ>x>@_/*mVK==Оv >LV@bIRXI j v Ga &ãWUkפ0:-+h>.q,ت{HQ ,> >gwVA%|0-7)3pMM%ح t̐9dFE95-˪ڔoV4bRKv,i\4zGXp4Zx(J}C@ljME^2J[q>r+ù$$Ta׿2Í5=8u [j *k'7׺Um$ r#^񗈑s/m )rG>LFXokdqZC4AO]v˻tq6n-_ >kR^ϿuÚfpk  wQC! wfP ٔ<;؝i۾z_3rA.>M}{}Pi<ΌY* ĉ/?kxvk,UA#sIaԊ*c*F~{M@`A_mpKA֪'r^~F8mF6Vٓ|IڑKH_ךeDZ.p\;⭚).Eoz#."4D'J1:MB3qRCQK3fo&9֑S'&ktq.\ Ul쪙W68:=P4XQ82z[,~D: L g\1VQb?/^g:%$ah)̮\Xw\r_/%hvl_g[ -!m-/Ͳ."T`pZMN`mmaX:5ZyL^}s:lqw.nMIjd<'r+KqpԼ -pJc4BOʗ|Q^נ-w2@۫AMh&\3)9W/{յU/h^> XP*pzFQ_Y0dHKDg.yX+Ρ[Ӹ;#2#=ޙS\|Ǔ'~GKO0|A%g6+7ͩZֺ\!# ࡭FkWVf>?G3"9JO!syb[)>3\s6pvi ڄTT͞Ȏ,G%0Hӎ<8(:C.gNV5Z"KYpJ&kbI'[KbOr=Uոܡ|8/Gѥ܊#,XPxrPǠ.Aٷ؋S& A hdY^d$vabC4^LWee=A͝u_+M^%mHq"f҆:9x&٠NdSЉVk5o[k#t3q0nou ϝ {#J .P$KDʒlrk؉INm5rY;o右R6/=yuXw0A;_9f=R LyNC id %oG4 ܈qYW"~yQ{wˮ%#eZ_s2Jµ/P_+2ӣYuRG9kݛ 6"zrIe҇bH1]ܬZN l_BxKyOThb6 {j 7cp`Ϯ}[MtvfQ%z\ځ!d,-U$/ھ*kwukyoFR:6[( $9v4GFUNI6pTQ#z!$y¨jRpy2Z7U!Z< _ tGxi⹛*ւ aot|eeJj@w]~~(szWy0|XP1<H8Q'+h^-HbE$(SHj,|_G}?TJPO?p HmR"#\w%t PwP0Ogџ?@A|7<eEL% ) 5!>#0xCMКmX4u{w?u%Xnu;qxw̰em'f_?kg(--b]n֦vOW5&j3j7}mׯe9{k:=5q) Zm! Gױf&#hbj5օ2 M%VQ.oɒKyaiaN.B,]4y8]M LQ(wGGaSP9StQַ 4S1VRܼe`K }/rRiw޺'{ "'ɽXB)PH'&D?g Y@&0 \NQiA瓑>oW% V*&kXJVvah&p %Kɺ|~ű;d a.ޓyϰgC %|%]\KyMЎ^A>gυ _Mp p 5wEeN4o 5o4$ՁWq>rT3hK3Q(^lOa}ёLvm btGX3mpMB`-.Nd_]E{!Y'' ' R Jܑj;k644w Wk¹\ ށ~g9i9FUs8G xֻq} ʀ1|f(_/<6DLB"<雯\$(JL*>VXА(L&,E#r,"R QJZ u\B_ژD]GΈQ.T.<W̮.C MYC+2UFzz^@(b/:D7<~Be˥]D-i {g@( &-9!$8(PԒx`nL)ƥY3q5# N4vU Bp441VHQ#W*ްiVĚ: Q-d_4/6LYsyEmlUWV]kī 1GK_`9 'scb#S#o*n#&8{F( D#Cgb^D0"+t,yQ>W ƿXAłP[a;9Kya !* 3#ڰOݢ=ڰQçJ_g#U:/}E'sİ9Lth(8ISAC4%xQf2i8i_OFȦ+"}5&ooY/rK}Gn"G,oP=OP |yg_ 2%gV7e5DSE]s)] qd98L&(XjE*$ִKq篞=}/XZvC(wp9ugMǯ>x֍ :ӐZwBI6BōBG}](3uqu]2˰Ė"],ǺRÅz!0z/e/q\2s醋;Z *%,4408Ac_ ][d׼t[7Ny-e)uyq%lnDMo(\QDآQ _E'd}y蜽L4j[ W ŋM'A$ Ne2ͫ3Ӎ 'rymJ z;'e@sO2)rP3p^[e??sdeT}LjEm(  ?𣂣'0!#N4,/l+  Og2=߿#n>JU!iZ-ߪ[wP|Ug\ ڽp~e}MG(LCcޞƐNJBϝB`alb]p &סϟ :ᖕMZ%cE2z^[]ӴB r79== V~mZ9qoHsnuKa4[$`ztO؆1":[U5ξU9gIyfUܳ( _?͗0| jKSwYW5Q\"rG%R#(G1^oq&CVNUG02rU) Vݰ_cwi.Ot }V}k7t)o]R_B)luԫ̢zV}l`2K &5qiOCmPQWWW!1!.rk'U ˎH6 ņH8Q YqpОKX4,L^Wh/IZVS+Mnwe:M%gF֍e@-p݆djY/eGxH&5OWْ{B w2nNuZc=)uw-<ֈMa'"ڭh"=!"Zz0"<=69COb1} fؽpt:}aPе`7!/Q" aje\C.i墿}Kg3Xkkrs!Ӑ՟ĒnZ=g:?tnuO%T=9[t(nO3bu*J/K.ߓSnGB$_+%K^vvpp.-IbQKTWgM\%E ,;2էdI#iXX+Vta= $6|.AcAy! &yPP'~]_0+ƮP:;g!mz4>f }ȑ֠zM= CډBhTh:"^-* HyK˜vIJTGUDG2Mah'un90ߒMih3ߖ(8qyoj$[ЖGgԨIZBZ<)e]|A},^h[@BȁTg^Bӫ cb1KM^QլiOU4}J$NnDZ9 Ws;^*`9RU tF5I(~VCȗ;YaX˝Xx'zĐvߧr\~ri4ڃJj{L-;VgA>P r\BsJ):W<A(څ菬.Z7NQj=T f#RVXH +R]%Mj$"9vD9GUPb(ԕF@] ij[`v'ƂRF?uW;腫 =FKĆw4u J$4dq<u=ޮ+F e5>,BhR91sa2|5cxA[2D !>Ԗ.BvY8}Oʫ%hӌRcJ9]{j]2\W!#/ſ^XyL \-{$њY>TЍp]χ86‡2{Hdt,>4p1u$!Л ߻-f.Zҋ)J|oQyeeQ+T~с;߳^:=fݲ=O/7f-!1e [Tt}cGHݤׄўYTXވS_lzlbfOΠoz,i|"lm<ڼŝv;.'ct"FzMвƱؑ dlhJ f^n>r_a)Epɔ/_>]Vg"K*dq4VіXpy1 z[L3'.y^q k>nb焫IYsejB2f]tfTQ;w-^nd'kPD|-%SGCJ HV msk ~,Y#=}T?QrFRƢAtb.O4¿)Ta$" xk- k1CeHB;.{ٽʙˌyvG)o뭜΅\BfX7hYD@)(ݔL?W-ϔ 'pq[nQӅUz_7Sta#tGMV+}V>ҺyaoS& 3TIK_v\ z,C_ RaSig{b&\2yF *mǧJŢdizMyk\ԡR*Q؂_7r6&u3Mߐs$|_61 4TpU;`u B:˕* $U*d{z_ gɏcIqШv5яjfÏIKFh~;/}j=q![ R lX1DӴr=}$dj#w#)#%Fg"Hh^Ф/7Z3#G҂† 9ÜrBb*_To2yxoˍ&D ZKe\=ᩬ!TiPův"`W9&īZ,]ypqK悞a@K.<ڇ͕ "0FNYQc4t\,mzt EVS8q.c-mΨj[2G%p5q"$^o;6qJc1m^tviV&mnQj3sf-a YH\ !/3v4MPk䓄L2[\:9[=*OH)g?)kLj8WWͨdE,~dQ"jHD/ *N3( oŽz/anp3b^hQ# r{\Oh<8 C<4i*nOїы; j~Q.&I Xhn$-,(8&'##dEgv08[:7 P E "Ak_Jwpޣ kAc20>;z1$)p}R`&$X~t~` ] cs%Nm՟;#|Ls[nm e`67`(S8'}P0S dc4\RZ-~}'b?Iy쪩Ccl& >rQYKx ;Z}6_}kk (p]j?70 8JRTb-);OnR1i8H^ksӷƣ8*ĉŅJiL;:{L$L r<g(NGю,}N8:tJ'\Y4G\|^xpԏ-_}m%,'0t)/knO)wwǢ(PaKb K~Jt&/iJcיI*:bPZZNXH$߽JNNBCbgNNžJ^⃸|(vbKV/e vKQor2^NpcRvC%Y (L%'vo8\tw9K!& +>( cN`Rů%7K0{yW+8Ey*.1L@ٝ_R.j[끕oC?YU(>Dރy0wAG !qBPP_KmSpY*vD D n$PLY$2cVGXGo8k5gWIɭ}{&(RzxEWNa|)[͋ux]/l4N ޥ+ '+Wd^zZ?!3o9n: Z :+'÷M{׶2 'iNu΂g&g(ə0WŹOʘT#v챩}v\`B-ƣ:{硻"Ƭ.^{ˎ/jjqiWI_oπ`l_exM[ޜ:ÑWIȳ`Sr$vg;'i;,G1o>/ӿH^.w.Ask\MLv rivI* f;`DžO,yqQq E>[sZo WKkO9mV"(tn WS70cA-p ϯ)H,xl-)0իsML$!)_ϞAs Hjg1B[];C|ycmkly8:NFF:gGqn8| k8J.s8z`sX50F gEkk;chmw45nd|Hb|:qR.e2lӛ#e~Z&G &L)vL<"Ňצӫ ^d:ཉw֚Ma'Cb ;bL;jZQWέZbn5n}! $iI⾌]¾]¾\돐ӾC/tkx5٣ށ ׎_؃_9 ͫ+4]U8% B8bq1Su-j3՝R*%>1 +:AoG(9h+Ԅ6\'X,(g+8B«Gn(w<__X<~ql̃TtmGiʸ2[?/ƈ*[/TدnR7jDΨ{NcL׵lȗ˭m1sǾտ2FA^.FӤiH+P'4{*6fRw\OYd0G1s`</zer׷|MfqM_c),B 4ڶ[ar5Mj5&Ww;N\l=3j.ʍVcGo~NgNƪK]pnZ8GtbI k<j;+fe*[M\Cʐh92w~z'6ww5M\-mxtպ.=ᾝW4j޲'֙ߐwMFB 7o]vtLeگnɬ_MgVl77xr6)ӇƱ6-V>(ni)e-2#'֠3K'^v));b^?HGBPJ<2w2[Vw?4Hzz'7uZ5YMk>9'ڤ`5VY SMjzʏ^5?X|xK*7(8_F< y_IM|zs(7s}[m&h]"e$!@q [T& 4j\$Zg;X}IPl_ Z٨"J\%H~ s 4sQ1"aX#N@0Z;yeK0"lr1uS&t>i׊422Z>7 ްy_&|k}z6&Jř9Lvm{_CxzE^-SX«ny5 <jU^;Ӡ?  pƷ??D L$|, Dٸ脧_#i&8d[?:t$ O%M<+(f)j4' b18/'u[Oa:šm`tMϋg3TLr`N8-R^/MܔU}F CesPh;o`F8 JĠ Sڏt60X/P<^Xގa C ӊGV,GmQDef+o [}83/ Mk.whqі*-b6]m}wDu#A- pa/ÿAhS VҋBB_gz tuJinn\dwvA|B%ەZwkjbu;#IB ];"Mڼ皱k0#9錚(I˛Ԥ9rfCFLMFǪUiؒh( 5oaw;$^XѸ $ >`%XVڢ.'6B;46g>&:X  $Z)#lwGA5O rE&ڌhP㣴ZQj=VʚoџYa^ +ŧ+[Pֶzfcը_ q q3Bع%"0R׶Ns` ZĿ#+Ž*Oݿ) Vc*FsZ͙5A-~8a ZdO#/@cg?pN'o>f^[_i LE4!-O$!,=龩޽ wo1pJ!Sm5C\m y,m\JgώRCI#X1p+?9wg_oKi5QBhC#S^Q;796^Do"zkF njAoM(X$j p$oq|9Cj2(<-=40nP;vdž^8.ĭU:6\J}[s:wM[+ ^|U5fGf7n|`cQX 1)2uW\j76lN pn*);6`esЭ; MёP语MՇrVkS0Ηrؓ"OͶl*eu ڴHJa]XH41HCNgnK^4y!.Ϊ"%u}ǃkZj%R)7 wp}}[o@|fǛ|ܧ #`ʴq)7wہi% WjSe7VAŌuci޻27[YxQVN\W+-oq[}]H. EkٹgE } }ޜGb%=͏F9?+o}|m*x4zΞ@P HAQ-0#-!/Gyӂ0UwxV-)/4&㧜N)AH6vzE ʛ1񼉕u0gh)BB;iGrd#RPm9zz(ɺڃ]K-oIإank\C#-iu)pky8kA56^o8ÉnwDr{դjR{՗Wར-?uf_޳Z."/1~|i}W [m^{G"Ä͖ Z)sGp`;Z\ə^%B;uM wyk,8YWH/8c@LYh_MToCXaufJpRgvhOsCOj#}}5h:;Ѓ~ԓ_vDL F1361&D{Sրic^_ uPO[.1"f]W෪.>R;R6*NQq]Ru)4传` y^aU9<%_ hpɒMX"5l͟%.ィeu_Yse%3W95yx,sw˺++@¸s@wfu61^yG1~,bacQiH͆X2)[QcGlPji:s[Zڭ_H,"0†:zhc7g8EuR?1zuhS7"[u?eJ4Y[LլdӚ8ƙÝ.EWEW5 #uVO΃t!^tx y8ʠGȕo:fluRM/xÉkozhB#W]oyϟ[o}o=~gzRyo ^X pl=p 7pp^˙7 =rIC4xl3rekɇO\}Cihذ{[V5p2PȞrrFeR1WWΚֵw/zߖڝj֮Xy0RwauyC.ԡ2 Zb+w7mq2Bx["!h*Uw^ȧ@cL1qYQE-vRL+UdQ):uE힄Cuzπ[ w A.4jEI!hG+쑬k h˟5.~Pg#s8Fp.*[/S9>#O]lk0JU˚XjtkY)#8@z]G8E,SMP sg#̣dU4oE(1 X5~?[Uj>y8SQ] d\[#NpLGK"=y&6RB3S3&<}7?W*hiFr3 ~S0]@p+Gǖe5"נEuZtѣZpnbR)iW'Ëx.HApB01Ű~5FBHd*d0ZJ~W7 e@S ˰KJls\p|ssjKi0>YooS?4?_GfV}'zK8~nk&{_onr=Q6xktByĴv@C  !Q!0$ 4$RyVۍEF91B>?U_Eo!+c;e7֥"9ݙp]JKbgOmq" AUPF CT AȆ Tn녌)p (ɺf. FLt4⊁J|X8+,v4Hy7DK\skʕ`ɝgÒ[uUK,.)l̊D6 2( An $4.CF , D??`[^iA* N@7 0US-j :6TWTR=%N`|oXO0YS2Ml0\澭Y͡*SNQBZ r٠P@]q@QYơ7EЈ# P -#( ~kp$J@kŗUDoNV'Nph_x`"`)q `@D H;0,򧇓gk%󿁋?{ݕpK p/Ly C5(F2%*UR}9Z/T,deb=_2XY*eQ6}J*Egh^I"iC!ڄ gC^a]D_zBK36A IڂN7@< 8cNO^<%"^{mOy/=ퟘmLF3**=TXױR=ij)KǖD"ZN$tǿ _ e˯b*V|kq`ġD:ZWyd] B!NU o-K@q% c4Uψz*!jyf'3r'r@#/dJNFϟqM( jH`kT8mw@w*{ АMH.y0ډT`FJe,Ǒ߀/!£ȁL+5Gxs 7  t:? .!AJi*Y L#ʥ$4۔b 2d[QrL"[ޝ`HgKzk8P!c5iZ1z oҩCO-[+5PI|v{4T0c꾚SoqC/pûWg.o xCs@։Z %LƌxLb< ifo>  tmh0ؙW79'Z)k9Y*\41h6+ Z5-Q@VշOUY6rVe3F(b.꺲b?T]#cuG-8) d /19+gL:[ :Gh v&o)ׇ v h^Zr^+""2Ӛ+%IM|,5jug4z8ZUwMصӝ(llԜB[I^͸3Agܡz0hyz XH ;;0yl)/ԐWMTZѺdٜoWϊ=Ҟ7jJ27n3dk}>3 5ެ/v3`v]#-3>RTuNEdR_몄-iv=s2cå1$ p,XTv#]A@ ! y ZJIP uo$&6#dڂ׿}#-,*;0#S]aiɂ J_Wi9Ru/)ٴqK<(yJ&v Fv:bͪ9|( [zWLL({"3f(Z(^HB׏%"]3{N06l/,P;uZqXK4;c0ӵ0n{ ,VL]6}II%f^Vՙ=PUUa֑#BC$ IBÚ+jeJ>7m@&_a̜^=>eB d2.:<1~$Y݅sⴙc2y3^0gt\xqYQ `1qa3nG M wpa5]qrl&{8NZōSWq7Wqâ2rzBnO[Ʌ$gjWH A\G3b̥fq]+om&+e wgT,\#mU)o. gpaSiC҆Xv=~ɝG%E Q;cV>`I5`EUZS#gL!\fY߇s]51K L697: yFGr'$"1oġfc6GE9mfefs?BYPv:Nu\z2nhʤJKHfADvz?d<8\H5tܜѷ +JHgke{f\|1:r:#O̟4rcy3Eyշ'`櫷7Vs aYYIB7sQwZ7eA\jp<8&QPbݒ%

q=">L\,Ƴ<܌gny:eH|#^d#~8tꜧpF;2gHz܋0tڨx"^K VUUGgK$dtɪxX[X5 yɎB%zXJd5ԁ?o ɒj&G:ә1d>ق!4{LJl$Scx;B\c/3/ d[]̲m0K4&;Ђ'mrC%o#^U7F :2Q x E7#HxpUM'xbML9B_j'6&i?6%5#5j #Ncev"Όs$4N$N<"3۝dtY4<*e/> ;M3wJFM|`EQ6טڼY6ZJvƲ s% [0dgyB^qP=Bk}v|#DԼiCpwMj)t?g:jOf-',mT)Ҏy鱶p;b6KbwO?ة]f уg.;y4}WJ#Be;,aSsۂw.+rFŤ V(X ݑjmN=CMWm:=)˗efpW79 oX<&-zaxozw)\X6愒!d/RםFsC'-r0ĺ˝8mX̭ Cf]>"%L>;bJF8! f4mYӞG(Vf̙Fcڙ?^w|΄򸎸z\:+z|{gt+]x8)Q{$։oԍeekT3!ΦiN_}$x811lpkPAjDR6դLɰ&L<?Tl|0I0,ʘf5ƥ&%* tH!_=.}XGB8=iq1ŃK= dYDv6l ˍts+g 33&~͢8͑'Y#-P8xik/wG!FgMsņGqgg b\_wQrp '"VRea`Tt8!`aȻO=#oF|*, QMla I89( ĘIvC/%!f6 X<~o&])ӧ%Lygjԋ[rtNfe4ߴ4799=jSӏH&sƗ3gf>s̉?"7+Q$(e/Y f;{K3tNɗM/+:N{2muO=Ae\`ႏ{W~qUU +~ӫsu(eՕq/TRu}֪_Wǫzj_ա>%zr՟/i^ҒH5[Gˢ_^;v[Q]M{u꾪;0["mVdtx>~R}ko'w׿PJ+G+4bB~gY~dsjsMUҪUlȆ]m?,?,?,c7,z=ϭ,Lfa7 B ,Uz V*K#儍&q& ۔v]`˙8Y d8R9lT>6)W+U!00pa)6vN^3crh Sz V23 C { /hV}lRV>nWep5/D=ǀ`U,*z .E) ە(wYz6-,d1RMp>ar p)Fxcؤ/ل9K =a=.`tR<^/+E_WJRwRApzs.@TƂùwsli(g+aeһ88`r;A_Ԯhw(5_6ɒ|ZeX"p#2we@.{e ?n8*]{NyJخ| .C?El!8XoMZ'[_(_ЖhiD=ѻ P^bVNp>BK%$UGP =ѩ3+aL}ZLp]m%B)[ ۔%x7a'!`rK_i`\e p2X{Eo 1ޗR_<唾җSrJoDv F0q z .D7BL 4:c6W X6"\5[(e+an.#(k y`r s,Tұp>!&& @D|hS@ Z6"7Ml%lmM&lmB+&؟ `jX̀K8ϒa!`wJ jܑ#򬆷B|X<607^ q h t7_q Vvx]`f כh00pa)6(;)KyW0P @5` Tj0P @58Plim)64v*x'_ [Wli۔@^"՟?v)W 0@|0QyIy s z:-`+ar l=Lbf ~ ,Z&{ɞl'&{ɞl'&{ɞl'&{ɞl'&{ɞl'&{ɞl'žwB$0}=_,>Ž8bD[yYA322222222222Z>@TcuʳV6EmO) hNlh&Ɇflh&Ɇflh&ɆUT*aհjXE5VQ UT*aհ駁{^`'wOw֡VJyZ)O+i߉1b#πB'a,l؆~ \ -MX؆Q(@K`"a&xhڏca4RBd;?l%lCch3+pa!) X@9Hѽp!, FXJ襜ܒ=d܆g=dXbv~w,ÒNX 4:7++u$cFG'͝ 5|4:.90 w-f`6aa4RB/ZGZ y"V-]Ԗ..jKR`ys?F%3s zQ~X˶j;ϟ4]W2Fk(`rQi6)W3t9<-ef)3 Y8++p>aÓFؤKЊli^3=lWv(x?~.+ ngB'a"Wy_c+aV:92 ثG)E xV<#:^V󲲁F^V6񲲙-lee屣l_3 s v5ltJ UN*GSǸ??&gH瘩zr SUH~<=S*}{gץ1S1Kg^g3LAϜW8M<uc+O8O!w^{: P'a'Aۑ_6ұ<??)IA<`/8]?( 9'yԌ|89VeN`?FY h (+s=;lehV^ԏv^~Ԇ،F)J׀g3_Aw%"xJf:i@x%wQ@xGQ@3OGFE{lK@2Psf:tμl-y=f-{ Pposo[d  <C =hy< ʽ+ W@x^![W, ^XW, BqO=h)d;} zޗ&{_DxZYU+ AxV+ʙ( Q5,GYDH(~8yswC&WJͼ$g.ڱҤ0XɣcnivI7U,3vlbC;6- ˅ڱMS米Z}} Kc ۴c_j 3~!ytjc}H59c#4ЎMio eʴc+4ݠۄLR XRNC_9 +4ϩ|l$[=YI,~n.4h~]=W:"߹9*X&qAԻdaq#;@` ݣp15]vO6\QO%qҽ*h\9[l&+>VICVU=N,*B>Rm7L=ŽaqN:GQѣŵ&b@|9hr]cC-QۢFY<ؕ(vhKUpRd%ޚ@=O3I|Z߉\~Xw4G{6 |/߫M^|ߟ|\&ā,=|Oߗo5/x6> gh8*p[#{^׀m{;~ |? =Y.)K/D\)͕.IWjo߿߿wE6R>=,K'0+#}-H=r>}5ZLaqX`@,p׀f[}+߇g{a|YVI:i*HeVM|o߿;}| {2d.X+'HR-Kyt\) Q|~|?=}|I_R.^F7DVW$SwJ餮V:[+6Kn#0KRf}?oOiV"a߯ldz; ~| lB(\nkIB4|׀m{;~|Vd[Nay)_%tf}=|?o V ɧ˒6K]*m]%ݫ륯t?7}RNN꣥LW/}//ڧs:33Kֶupg=D_هz^0{6oWd\7G J|6 RFA0>cQv6tZQ03>-?~֭tҲ>-f`6f2)G-@&CHF=.m[=ζEF3{5k2)ZRt-hY<j鹹ӧo>:Ao1lLF,-˂^W_OFp^(bA&m^3KJ9S4KQ>g}{ۀ闷CTOfzDoP GQIGZ }=ycQ[vpAfYg1ht:=D΄#HBG=SmzzE3Oq1A _AzZ}%2gv0zYf&NG<8YWb~87l^o[/FvH=VrQSZ#ȌR1GԃbO;a Ï >6ÅCI0Z20T  JZ))0)O c0c#TX 3KZR0+j @ m_(Z+p!ÅIL|$@Gu0,5bP+ !C_ }0d!"qaA?f Vй?hJy jиaqCg&C˦'8`I0pPO`I0pQJ p\8u3}D;t̠PLd2lI/*MƢIĤ"~fGb+qw#xSwU+ s|}Q6oudLv|.6ywr˖nΊ&mIE`19UO dy$1 T|l6e|Ee2ZFab,,pN;MdN,CZAa2nNKQ~N0pi"{3mŮ۱gT,M[qikA/[kY>i0kK :L @>1Ȭ@Qf*BqM@7Eilk_Ծs_z~(pGdj$Ct2[k-&">LI]2ݝ9L`=@ܦMf63ImFfNKc󃝑7yk`3(7O yjdbO<4ЩE/Xx| z-5Q Q/ VkV/E'Y |A8ſ7ODo_~FoTbxK%$GI/RґڎI cbYgh6zQPJmNQ^t\\-*I= }[.B݃$f5+lnEz|1ѨDY|+.ɐbn]+U:),E)\e<I7^r+<'YLŒZo/ѥ`_(!r蠱 M5kw q>M83ۦMS Fko; ٷ ٨*Ŀ8gv`3hZGJ@, dVc)1F DS9Lh ](5Y%SovX!R+8T%ӵY,=56~)?*ڷx`돽8+]|۱k tUħp*:PZ_\{ 1[מSyk:I94{ڭzJA9VA:hg;=B}dWԓ",;-g/>en'{3WmkFBm+e-^Q-lD vDyuJeYw~pvHb-*/VҊ/joO`J ڭhHֻ;!{;?sνƐV`u?Stpõ/]֮{{t#=CC:!/mnV[[qE+ۓ"8lT~,F2Kح?^a }%dX=#^ۏ-V# s ~},8#5e!Q-[:w#CXbk+jqsn[]]vUWk5q|ObzY.{~oS_y` LՌSާ{oj@gd,BtvE-]}{([kŽSVl\r#d- 9V0c &{G> Q~wHt5H=^+=|ECKw*t}n(i^26p@ }ĿJ`\FA!&;R^rgѷHݼ.N'Cnw.ܪODIY>L&8sݠ[(NQR&wdjçâZN0H351wG3A4 ߅VsAaT(am'<!}k)Y"鬚MGQsݹVԮר TMi9bk}qj!祽 3SXL 83{Z|IjYĒelVmySy"';ÜΙaC7`ڙšDs)[łi;͙}^6ԃթ{(fvEl,/(XTQXϞ#|%%<}Jx[^~Lh&t?'CXMV{/[LxyNo~@)W:i([hdo['Nnc' v}+pc*g~_H7?R=ks{sW]gs}pY$ g´=fL_eZAUe?߳Cr|7{K~ /5 ϘoKVu8ٺqv7V.ڍ?;Źѿm{rR)ɄBJ אy?C!s1u{@NɁGl ?BWΑ'"^ ȁ#ODCv.( H&3/(^+ŧ!Ir( j=1c*cskyB+&% 5€\:' \^)3$`Π_x2H}V:dHѬ^Ѭ/eK粿r<>$bnȡoNٰ4y~oDo?=ltK?2z&LR|kss̃|0m657~ff\43ef3(M'^CRzc]W G.Zs.1krygu{rtYgfHǡ>g2{ޣ4AnAfRY3ԜO|uy *%%\:D.hS+y+KVV_fw|d+;VPp[ 6ư鍋k|)iq]W4on~UUCVM]ȪO-LK|ԖE- -wN;;xps4u>8x($^ Άc;ɛ(z?~w<q{G:%Ĝ}&*?g(98^6-(BTSx.o;TwlXqU9WifiB+&Z!/]c̣}_M!Zz]-x)%;=krV+4^F::sK+z;A$F84LS{`ji+T7ӍT;p$ߣ~z|yb9a a1*XP\2S>qN; Vu!yT1$,d񸞊zA+N[N|oni-XJ+>a1'}Ʋ/ץ/k?Hh|k5߽na69|Pu;Y7CWA@k7uеuQ~Л[7Con>&^C%0%9KAkls67[I QZ6P,Qz7 % =} 6a?BAgY:?Uw'=z,K? ?kˡuf3*(у=ѯclq_X`dȆ^Ͳ + Pt#ڠz7dx?O@@~ =  h% ̒L5E$Oio~ oKM.-̀ʭ|m6?-='} ?;$Sl'W+0*a!OGP?VoUݪ^|j껂QרkD- C-PK6joyo4o˴uuud W+Q0s5G= B&ܩBgQVjˮGmHG`+_җڈuFSPkj@+1.F+/g-œE$z8z#&f[[(lt?UkЃסo@߄= }_QGAB?VOǠ*AOBOAOC{ݾ3}г~آ((*~,îT"k &-w 톾}+Я_C{@PE٧ S^Lh)t2Z W+ pm%~6@p|-kӇ7&( l_Bۡ #p0P}d@GnE1EG|= EP _Bm9=4|zP7o}g8q>2V@+U/"hح|/85b%nxf7< gv3nxf7rO녧zi^xZ/8<<<<햮b:T| tk5nxM7^ tk5SSSnb7zz֍::Ft7z/X``8=FOS`,`,vӈ}Dd#޿a}J:uBm/ߵ8o~6d2d̓ɘ'1O&cL Ø=1{ c1Y7+żqa~(-fR ۄy4 h8̝ɘ;1w&cLܙ3sg2d̝ɘ;1w&cLXZ `x'NKsB/cfXv3cf6|Wu϶>г|!СP0h.t84:  BBЉIT(e}:tt&~b,l(}wлz7?A z?ЇC(1';OB|ww нP;%W|WaQAE$:]З/C_%s)GuHh4(G P>ߧ|AC'?Կ[C{GUm9g2sN{bUP (J0cGD)T$"Q@2II  Bf2$!1<}_|sfN^{2ٜuT6Aw=4{C 1)2h ĂI,ıQ0$hȱ3`&arWʠC5 `kB[ фдGuQP'QG uQP&[Ch =$BFz@O~8B}*gg9p.p!\@. WUp5\0o%7P7m7?3vw-āY|@*<s<=|xހݿ۰ ށw_V{>*+CV rBU>u9ߺ|| [alw1v. opy -$;ߪt2Nx:O'duzRV+`3װoa+l a{`\Nx]!:@G$˲xE9^EX̚a l5q, ,9  6~0NqƳl`_쁽),#gvF.d]|pmKHBNpQmkVX8C=G b,:z= *.R]P]xF=w2y^`6 g̅ẏ X a,7a ,mX/X+d:]Hz'/eQQasvs%j]]]L2I3x&$dΧYn'ۉv⻝n'VbU*VbU*VbU*VbU*VbU*VbU*VbU*VbU*VbU*VbU*VbU*VbU*VbU*VbU*VbU*VbU*V2G_bos¨3u‹؛s :N' q7O[>#B q*gD')Qny~Y bॾRzAw=􆑜 <aH(<qx`2< S`lSHY-GeJ'T D>S`Tg,xu͕EJG(t|Q:>JG(t|Q:>JG(t|Q:>JG(t|Q1>*Gb|T 3C̐03$ 3C̐03$ 3C̐03$ 3C̐03$q:>N8t|sq>98|sq>98|sq>98K` <ŋx.9xs6:{au6^s'x 2G(e 2Q?G(e 2Q?G(e 2Q?P0a `(F0 !fCb6 !fCb6 !fCb6 !fCb6C!<C!<C!<C!<C!<C!<C!<C!<C!<C!<C!<U y 0&L)A0;8a4qhF08a4qhF08a4qhF0;61al cc061al ccư׉0 &al Vȯ 6;>ӣjIԨt6f013}>k!RB>k`C__>jz=/k}7`1,{AC! ξ4M3䫚%%svC<YjT[N!hWU濝U.FZ% V!ģ O, ܵ;掕̥KK~ǾY\̗sLt}\+0|@r\і+3y5BZFWvJ#rzl*3ٛfG eq<'F9=9U/e OOjGzP%jU-JԪ;Ij@;7:@G#k}u. =Z/9/wky?Npπ35,Yxm^E%_]9_%l¥rv yZJ^_%`f7f?aL{!Y%~l%Lk4 ̒fk̐dQ2(e/"z^9B/g fLޅB>g''Ͱ>*>CUCXfYϱͰ>O[sכ!x;n}?/@&ʂ}y ٛŬbCXEg0{eG ZĠuC 8C+ ĠU UPM(cruy}9#+w>Χ>KN$KL$KLy@1Z%bkhmNX_בs:Ag]xO{ K6!3|ϋDk͆͗TCTCTCVC|K[{\W=x>E/dO+|;?}3{=v vkn53Yl,,fu/3i 3fvfL) fI6 近B;R""~'CF1+>u zr—߲m6KeBΪ`ZXhYֳz'`S|hoo3R򵟑Wl?d\ F(<^ɴ`YgnV07+X1??d~V0??d~~l = eKV%27+X#sgn~\8.g=r?ZNn#.W+b9vX;L&ʉr0quZ'­'>dʑK| >ʉTt m:d W ZIL|A>;(ewLjdlq689#ɲAbe?qRBf fY3~h̙MF"#fT?GȀYd,2`0 GzYd,2]-@ łdY,,A d )Hv 2Nd ~RlJd (@6;;,d$$$$[- d2CSx*p P2T&3Odg1㳘Y,f|3>l`Af{ٞl2 b&Y^,/`Q;uQ\,sGQQQ̚}_Ә-!Z_Wt53",ዙb&3 ?f1|Q(_/f13Zџ{lȗWý⌣?F_LpG~U7cX ::Aa _1a;c؎@_߽8/s?۷8[f[t`|Ռ1cLǚ?d匫qU2JQ*yv5Ϯ<=sc<Ϫ9<7bwXY֏Οhj3 FX<Q7uQ7uUn=CEBeR:!4];&F}bSجuuu͟Ycx!V+]+]z.Dcnununu1+[+[uYiXiX]Dk Ffv꺣<ƃxVI`ڑIΔa,(笰vhIй|s,b+ B9%1.1;ryX_X_Nj{e/,ڸՙl`C`bY-Պ }#q}NuSNuSNuSNuSN5SN5Sx>)TTTTd4<1<{CV3m b)!/S<1 r8%P9'\Q '\ p gp p\¥p\W  !7p ap#$B6;fe'ܬ/w] ت7s]bWEvQe:@GEr+9P%E0F.6£Lݍ92Ȕ :lSpNȼ sͅx>3;f*9VVe[\`Jѝ>h-6.>^?v&خ_#23{%>G{D[ `ip:\7P7Mp3n)KܥDt1A%&$ OTh^I4$W+}6 0=B&d>?@:r:r:r.qj!Qr yb yb yb yb^&3r1݉nC%TA5^ uM :\`2M\70˼ps{O09xo&hdF̧5خ`F@Lt0с<aZnrEk) KIhEFi4b|1>M&G㣉b w*cX|H-3,< "e XNţST<:]GWѕxt%]) }BWSjQRx;. xއ`%|*>հ§3#ZDZ9MNWy,g#P]%'P]vܭMYZpiYM՛CW+`Dkڬ6kڬ6kڬ6k'[?N~\˖A9l*>}2dէէէէէPj5}>@MPj5}>@MPj5}>@MPj5}>@MPj5}>@M(7Df›Jg%YD~V"?+Jg%YD~V"?+Jg%YD~V"?+J䧗HD/^b&zMiiiii£d+Ř\}0+Et5^J X-: E"HGdX-: Eʹݠ?k2T ,Tm:T,: G#HyFQ9rE0 QVDc;LF7%}oT~*?O/F/F/^x~xpy6}M_`PO_`T+Se re>U;gڹr4m_Sgױ\fw;hSXͻz_e%OBS?N*ԃB5ŠNΖi*}6|ʓvЏj>z7azZJ5jXb1Y.tAܐ>h-F |q)ʵxx^2dJf)W4| ZCh =$B; zC ? fB L0fӐ </\_|xހPWϑk `,T_A%$ʇ0qHabFbQ6iü4MuZ}S T;)iM엲j* ynJSw7 MGT 7An'$ O )H0%ރX G >O`5)4 × 6C:| [6'ȅ<~B> 7Kn4ڰm }48Ηl_ik1{5[ 6&`c7v{B.Fcp C-DN0[@Khov2߼k'`&̂y ޕY*ur{<>]b{ap#p|$</ÛVAܟ 䁄l_ ̫U{Ah8w|0=w s`.0^k0^7`,Eބ%ނ=/X+Ze{=Ca70M~} R`:̀0 Txyx^`6 0k0^7`,EX~i.׶H_W~)t֊d#"/77TDL  ?韃Ag٦mg٦mg٦mg٦mg٦mg٦mg٦mg٦mg٦mg٦mp)12Lg ӳYCwfwfwf+dYGuYUlW`,b{n =z%paz0=?韂OAz&ɦglz&ɦGZB>e =z%6=Bd<=8N-R[A_צm_צm_צm_צm_צ^ SWmj԰{"ߚ&mMz3Ў4B.\DMMMm2k:̐ev=$B ؿ\*ǬqWmGZ\m [*bG Ca.*+h~qR9t9bq0Z}m,t\\˱TE ^Rw*b>]s.2zu=ZֱjVˍ(>|%{g8cp83^1 q;:m&[r5=;y=g6QVyS $\` nHxE{Nj{a 6mB'ADISa<)0fAѳGD>| zAۃ᣺I5t91l&_1͜mLG̽pv'g%1iamH[(.96G%ZD];Wt9 'Op{Mvhws=~L9L}|"?U0oBDLδ9R$b(5(nz'9>$x%7+~??*TĮ6޷geοx⎧1SrdgMJ6J|ftaqyv\/ύs<,ܭ uqw sZݪhd g漣O'82AtFlpe+XոYQ,&@ $a8yv7q~c}`WGzf3F$D Irn-'H*/~D+:w>ɘ>qVQr85 b<)sF^(yRA(垎JAQoW¹l?YYwl7zǏ΢N$_G;s.\ӕszs/q?z"OўlKo;z$^߃ߗ}s.g8OrՆq-: gpOe|*W=9 z/c_^p`މv8W`އc}9*^"c};cKߕgusxxoe_? |Ӟ&t u]e7l9=8'{Ao9}9? `esdu(1Gh8Êkۛ} C;u"흛uqzZl*ZOcYko~wc濋mb8SDX.8 (fk7~m*'&qՆjMdjM!HZO@TNFM"u% *jսM!2HZO@]SEDSQT#;3P:UJ?;{p^Oy߇r^?y:7k|Vіjn_P+lkn{ťJ/f+dpT^v7՝8k{,;{zw*|Er0Z%)HOz?-\qwP]&/WG1HExML;yGr.JO鮜)XQU(w*wc}}VWFJe8LT&:+KEy?]neC=G=O9[@X9OT.RP)רK!RZz2u:TRYEJM VRRާާ\TTSGdQ uIyvEe:G]Q SenWQwB5+1%MTNR=6(ԄjU35]kQ~iL-QdiJWکJP;C;S9jj)EEamvR]]jWjW*JH ViCv6BPj1XI{B ))ЦkUS[-Tjm>>Smж>mvkZTKo^OQ//WhK=]]g{շ}z^K3QpY.KprQ],WH ]QQUCWZꊸ2 ՠ]' ZaF 5j2ZMF*FwM3zkBBq7q1\;۸xZxxNxјg1h4iooh C;;c\kg=j2ҴnjύMړƷ ;cj2rg<#fq(0JШ6%0U4{j m%Zyy017n77k66ļӼO;j>`f#Z9՜4gt||^͗ٺa1nMM\56 =\en;[])fm5fY5Mp>M}ln {ݗ/s_}Z77oqGpߡu??~>==UNq3OOwOsvOwqg_sr/p/џv^^^^^v׸/#;sH|=A_K0<+0SB'}yB =[z?YAI[fpX[gcssw?"r,i~WPf˘H@D_o5rb{=a>P" o]Y?MCHK$ϒ^BǟUwW7d)qG__?>UW6ﱹwO˨hS5h/Sdxcq]1'ŝOFۂ_gn>/wwnHy-u犿˕ΌcGpbwGrL>op=1"?筃CtxPG\ݜak? G)?x~|\s*z_?oV("n YM+)'cㇻ-2]\׳E'Fg4;ڰk~z.+OKqH}ŨW՟\@y9;5B_.QNw7}뗸*JhPrw>ocN~7arei{)ح{DxW9οTE8/EbD\/JEP$1bˋIN/&ձb x@jey5/8xIueAm:bWzh="nXKKυJ񶫍Xof#]1iHC}NO'N̛̛t"N9=9=8tӉ&zي|stJKSZ9=\nP:=t5ʙtsRѭ]]nۣ-ݭm(wgwWe2O=HO2ITR9=))i޹,QZFcceUlU)۝^Cvz ek(N:RJk(NT9RJk( N4:}r#TEB jhߢikQ:O!/1J=כ׳aC͡mcaĵ73[|"|̙̙D/nҼ׼W3cϢY018y|=B5'y$swL2ӦqSSO1S8:s{y `s_2gst9=s͹\5Ϝ9Yh.d$Ea~ 3?\\r\U\͵k5 e֛WWhȨw.efILyf囅Ydg!˙'ڲ/QtvH$ug_W!zzr^޼}}}yMc?=o)|pջwr ɆBshdCъis6- ]dE^By ~K~nDp %jb;yP#1sɯZ{w<j<>yσyc<vQ}czΏgI{ߴe97QK+^+{2xdpfo';dcP(!'0/|hW _Ų?6<{\boaMO!>/4K>/$2_.̟|Y/7[n6:.l^*t~(]\,ڃes m䍿,X!5At}̝P'o]`iC ^^J纂VӞK/mcQ;I>GK'OSG63?VhoQ {&@l,=݇ޟ?lsYN8c_\O BDz>;g,hc?J|>oi;{X]qnkjȷ:o':h 12E<% G?x=yeP)Ho#Cok<{FHɝ;g8m?@Ao< 'n@ /$Eς? #KʇC0xGA/ vͅJ#ڇ.""D|ЧyvzWXW/2?6}\\.kćh;ޠ?gxfjqҨ5G{Ã9w&3am_>VQ A |aYXg?7x#3o'K*_nxw0ON~Ce{[W1K28$ſ|7Y>WG9x׃s\>/Ļ Bq𿤿ޗt~xi{^{rwݿȟ7z_ŭQmoӢǹ?|= MBZp\|Gr}HHsAwV{=0\®L8/G|ksRR#4/r3ԍmRa>77OC>e3E', > 4v'Z~qWC;n|K]n y/} o5҃}Ǩ|˧~L wXnw{YGQ A uP]:WH^>/ "jt '1> Ҍ_=_9'eڦQ}2>}8!-fXZ7*k }JY`op];0)G4r 3)aUWa܀wz3L>Se∲?)g;22/h $ 2xjp6C#? . 3~/T~GGL6,Xo`a5"tv>d3熠W4J[@悂 }GwW[)u݋8})x) ~/a YwkAgyNwdȬ`{γO${& q4H z(M_b BP%?zS,=`XS߭68'@gk@fd\PC14<|4\P!7xߖ=,IHd#d7@w~ {Jʼ@f$܇k{C1?Ƒr{!Â`;AV|?xY7q_ҿQAB?Amx[׹isF hMhͻo9>ЭH=K޽Ej)]ya5`tEn1SͼHzc"0.7`WINGit:cl0?a~Ia)摃4:y}}ȯ٧ؙ7uclH=7]KN߳[ٷطٷr9s{̾˾KG#o2AAʢe10Ga`9,U(1QdyLFĨrU.ɍU^`bed5LVQߘɒ%TӨoFzct4WD+2Ebcޘ:q{cZh7fh7&@1]*,1ޘ%4*ƼFc1i7f-ƼIc1;h79Ƚu1XFwc4X%j 6ucch\7v&Ҹn4{?s(~Ftc?4;FtcJэ5ӈnl#>,ϲ~lÏa(>mcX']$~Oa_ؗi5F\cO᧰иkRw~`_qoѸkl/~]c_q57oиknͮk}}nvnk4cv;?d??žQ؏iT6  cؿѨl5&c&%"h<6ٸtYl,İa=,K{$Q=aŠdiaaŲ̰Rكaea3eaO=# {>l0[SHxrxFw͠dOhm2Mfd4ZFk4jF&jOcMRqd^ 4N:&8mr%&qch6]4N&iOq3h6S4NiiW '4ʚ|.&FYi5FY[h5ym$mBd+o͑G~,E(F',sP/<(M28,'0v+`T )0 $P2 Q"P"f$"f lyHc7_ N3C\4H#8D|g? l< @&0L$I/'2р%L:f`2|23? :yp9q9q!(_,$"f D@ꯓ<&yY=Q{ Dl@B~`w6`Oa cD"5(ΐ@9a"x:V+W\V\&+>c7 UqW*|c8NI!NI`xq$Í!2NEpdEBu]m<7'pI M$B#:K\*ԿKp\哹Der${˂} 没)qGG|*5 D%\ QrOrO1?}k"԰ v L\97yIWzp\㚹f8N+ -qmB;Np\쥓:]\H rKC ^+$8}6)z^ګՠ_֐W+>&fv+}{ ʷqPvEaq?#Y3~q/~P wW!..apG#A7o#Q(l a3YP_e2\خpcCc" Kr1qd2V9)㕉$e2,~RLW>@Rf('GL(yP%2M̆(@eyHUae2Q_,Ӕ`_4C9ɡ 4p&@g 4p&@g" 33D HLdUK s:@s"y9G9'xDvuEX ho|xQA_'|["Z%`u ېwa_)ʴ L 40-@g{ hXɦ A>HV!O1a @ L a#aa"AGMƆ@ɸq ,6,<vW]dZX\x(6%%&M|bX"eR$X% hvہnhvہnhvۑpc%UU .9 ßjK, _K yuAa;@,Lc7PHXA $dEE2V'#w 5B WP *"t zo P(E@*ԒT&ؠN`:N k]$ʁ_nZ@/|$Q r*AvjvEP-,^ KACXu 1V@;VB·~ ߁6W `kk~a<@+I準LM7R, &}ЛLaPk mJ~,J '.rnSaI~& j^ !h0D87QsL=.v >vR8I\$Wn#$%3E$3VE| J^XJ&G|#i(>M2)&OiA&O`vӑO fI9Ę)?D~I )q)22d1Ȍˑ!38!{= ߣ=G{'(0~(0~OQ`(ߣ=OagyT`g0~O%I>xs}yI`CS>3$sWrG=ay^d!# ߔbA߃Q&eF>>h(eAnI(#{4Qg"it5XGw IˆG)2FB=J)d G)(U6F6Jg!Aޟl,)ϒ K4`Ye g2AO=DOOM%ʾ @Sdd=S =s Fr A"2ƿLT!/I10&8T@z30>Lxp(C@>@$%x))`B 2ː G?AqIq 4%cӗ g98ټd%וcO@v^\<yy pq{,`r% r~)/A.rn%l%rReȭc[#Cn=u2n9)c~ n x$yȕ'"Wƭ6XDd"?mV%!K~X6m+OER̸ȌG<yȃOT>|4eO .V>| ڤŢ0cEa("(bE)0B9K9 Nc)0XFQaJ"Q0)0EaqCEap"Q0Ea1Ő(b "QElFK(b "QDS`("VQ?L1$~E`(aC)0~XS`(a ?)6㇍aOc  a ?Lfb V9$~%`00H>x,oΧןO&SLA7,(%%"OSASڡ>L_? OC AIyK%hiÌAf 0π^Ơ$x/UB}9T27|.h50nm @n4XE7c݅Xtc1X|d|e1)c|юi"UNގd)WGĉKQ{p}"H H:HH.H%g %d[Cdxh9uڷz%;Tho,Lm. vh;Ku H|lMx{UU_]ly+ \[T5ѵM>RWqu*@ѵ5]>AuļSj}1u }/`/uV3-Э+@/|z _Ⱥ^бuk@'ԭrUu}֮ϬG9m]XwtqQeuTʺS=5|gםeL˦ڿv/oܺ u}yĿU,tyv_Aͬ]ƺkfg}Eܿ]sjJ=[{gi=s?aԧٗ5m} 5j1@j0ѾdIuoA}ݾYf:Lg7ބz+ A_nZ^_m<o<[u5G6P[\16x5'7еj|Ƌ3mq[E]і[ni:詘&9peMѠ+|VA@~-kݔznS hu]5lY5fcնν5;lfwS>MttW,Ms@/m[O<`^Ѥ<\[%̫̾}|[+jڦk74y}X.#Κr󦦖A wI,~E w5-i%MAnZXF'6w6ns6w|iG9lTri7+TӒ΋5m|MP iy畚K6Etw;[›wk̾hT5ttJ%MWAg5й͜,ݶ+\Elvg.[zzsJblm~R:i0_ޜgUE~29cPi$Znߊz;pGwh?:~t?:β_TږcUu4|QpUm?YmH5ͫWSUyu4,u9pѠ8fG? *mgl9j#בő͑Qڶ^UB2t% ,ȯt1:vf(UUb6GXUmwt NHTl>"hAXB` \,v_ڎñt,}qJ2PHQt*R}ƱA}ޱ%6W; s-851#,hqvt풿P8 :jZ]դ: ״*ЋՁI p,ruZAq:<0y_ґ(lqvQɹ45Siv:T=^;`fs?MsȹQgdc-4-J^ESΝ8s? C&:tE[5g6[Eͥ">w%RJx+|kN6W8niiӬHҕeikz,jYjpe5@`u γHu^ :5 u]|`6جtis\ کdW^WϪ-tevk]9}5mm0pf8pfWtU/jgfkN|CvgF0ye \Һ]nz\M] crumki+]Z*hWVhWֶk׺6&v~k8G!Knpmyvk;譮]6ZSw@kfhwfkiК5Y$a-=B=Luݗ=ޗ:sGUhv\w:;+m~;ח wWh-ŹKDn%},JZrk.׭mUV=VtX:pVu%n[hb=rw/F7q/%QFݺ\7ϽD^CWzJnCUkN^/Qԙ+}:{5a`ŭ{t^:S]е7n֣-rojn{Z̽4CJn7t)[Ϣ jj>H[/ֹ^zM}נ>z$p+3-ᾴmsoKл)2Op_ѳC õEJ=<1m}@'-Awēږ;hKӝdeJ؎x xڦH;)m+]T:mezj82O5\89<m>$F=@6٦֧گ;< b}V,=lb%<=H}g9=rgP_Yc0P_ N( *6s Dk^9JϮͭ{D_[=,05ltj<ںmK=Vֶ Ym˽MX$iVmZ,iێz={Lo,\PfX&Ha+ Sm;MyE1ISѢxyܲ4JֆC>Y%Uo6;Zv.ny^#֞M"Wn]޲շ۲Z״:n]߲ZZtni9uy%k1JBbrF aڏ>Bea{ZNzo [\IS)_Z!]I^fKjau<1zo9x.,^X.z K p./}jcD].HʅU@mtP% Dsa,nUԵ rsq6yA>E.lM[0w6sA ~vY]}YCQm N/.ז-0Cv_!ǻ=}g1Lnj2z窲[ ]tm7Q  % 冹 j*G F9b<{]kh^o7)~RH1m -BCW}t{>MO ֧/2Oo_zo}aU}V:2mhP߾ٰ~z6wjM1}ꃆsڏ4׶77ñz{IÉzosm Es Wz 뗵_5WvcxN~f77AFCok[+27]~cbxUF$cJTcztƬsg:2;/uK]Z@:sR¨m2;ېڡ74dtXm N㢆㒆: $i\P3kjhPaܠXl֠1hv,7npv54tcjMGHc0xaqGx'z:v4,l3oc԰ՆM㐉kVr6eviq߰cptj)honeNu54`*j[n*mqTp㚩dMնzoך􍑝1jZ:#8;cM i&_cfg*8˟lhLVL ;L=ŝe9^FgӚٝBS_شYfotwV66%P9[M;sM{:Քt)KYN(of*3\83d>wvQkg(>RL}dbK +ץW1 Vv.5&6\!zSk;WBX2e2W9d± #aV chv,`bHN$c^2Mg waCJeOxEIp*\$QOHR$$rwdr$92r.$/Diy |er+D D02T1d6QgL撯%wI5#go A&aOߛd3ՌIdLL,b1 ;s̏_2/Ⱦ'㕻^1E+WUVk7y||m[GSϘW{eCwW̷1?ĬU1:}Y]uf=R%.+~ǹbVΕpO 7sZ6gM<}{[>p45n[F`gq}/g䎲N8wmNp'C,Ŷr.]e:HI+]k{7iʇMJ+SR.e)LPE(T*|KMWDD)<*USMU~XoU GA#.5uA.: I$ew?bS+^>򑗏^gWuw'u...-O/e/_zDWI7-tǔOB {W€_2A"&/G~("EN#ԞMM°cGXvʱdIxN,}=L UM`?`? Vj'Ow{12F Oa#q]Y,NG&e$#(KIX@V@ {de3H ~3otg$01x]&b)[fYXYnZZ,mYXYVlu-,;,-,-G,-'-g,-,WYk5ޚdMEɰf["kZeZUVjua]<$X[{`뇥ϺPicCSYwrjZ6\_\τY%L_kIF!I(H&$%$C #I!1<L_eFjMATҒq)l/1y;IzL$BD )MH>H)mHCJ%>d7>H Go)҃CHY" 72\2J˄22F|Ib!12kbJ޳0/2*$fd&i^~>X+`: aYY]d`KL7yazȋ8}=7_~gŷy?4^Cޞ&h sHHH)H$UTs\a2WUfjv@Őzͽ5>syyyy|||||ZxK%֒`IAʴXZ -Ŗ2KeeEm1Zl[,ݖU M]ZX[A:a9m9ghbnCYU&"_iHQhhcǡǢ߅VVVV><< nd{SC+OC+RdL,/gOA[mau}?efvO--{Zv!~=ZthEh͏5/>g7O551`t9~=4ZsZs%xs9@#U|5_MM~^ Ik?"- ;AHeAe򱦭mOSmnaemQ ZfkgуXsZ.пM''->t~Ʋ8sK(WW- k0i9ݦb;8˖;wv1(qxs#rHf9zCGeJ( ˩[ grdsyŜ(;TE 7\(;M4;*̳UG5*ym֡7֛pR;6{ #uсȱJo].x2'K=e#7׼{+˽ju捎aٱ&&;;o[v;9$GGo㎁aB6rm>8k>0:5R+\.9.ߖ\u\';RhV$ҹ9ksEpFJ3vPḑ97Y3[-<bqnsJr&JSνC:ӆI3&;X92a\V:v<$LU) !{g9V%\.W4_ݮ8ZNͺԕh]Jj]J8i]ʲnp1ɕOݺ5=.W9=o^,z-\s(v6QY.n=Z/ZW\m8F1 ^qRjK\Jv-m8גD2{Bc{4&iL XZI6ݵz>pqQu5v]jX}oT:R:Nv$bBHmCqv `SEaȾ5_eoQ;ܬ]:||h{vR:UzܵݤvDa[nAqq|8!%3<<|"}9BrNJ!xi;&G{ 6~SNceY*w;'_y6]8>˫ENfv[m]9^3b)oX7kc]녌V6׻]bo.//FN&%Y7Q(- o)sn2C"a2 JoHu$B2ׅ8(̾Q[r3ʽ/ʹBk(ǢJuBdd߂W{S:N q3 ExuɝM;)TuhK]jqW`>]eKrWSln[[vc@lG*l\V jr;_5٬6BǞ Q?8gopĶ?l{<~r![m{bm}ֶ}L?*O l;l{<,c~O픎CHQOm'v֓FeONk~)=u2).SYM =suK2=Fjgu9bǺ7+4aŞ2OW]ngi\ϊ:gUѳPl׷ɳ ο.َ..juݞuK=Vx׭ ԭ9]s%̭XsOI.^yoihZ70]=+=_9G.xm VmvvOEۯlvvm֠ҞtA{Y{Mx].VK֥2u9UѺªb]R#&],l\r1:Φst][TBJVAIU]KWJPvtut<>zD&]G{BA 8p.#Fb&RΆNI8z7Ά&l=8z/Άl}8z?Άl8q64~E@98Ά>yCyR>Ή>spN1s3pNq&I"8'Ή8'ZsOhΉ9rf'L+JspNY}gCgCO<ϼͼMqN}Dk/!T˷&Z{^~F1B ג> ݰUj;$EӦYYYYY*!ZN+hc$m6CMfffffݨi>99Iv2̓Űp롶"CmC[Q<6D:}Ap<D!l'j1`Ē@ - -`<`t>|߂ѻ>z"΁O;$=Nf߃w7xGSFE;z?Q;IgpG3p{2 w1xpNK[6M>/q?cG&5-ެJR=2iy>A1i#GGP2"iNB:C6 ՗BIzs` W5DJS5F9i5JJ)CJ#)۔ީ)Rd*Te*TAJIUӠDɰAK=nIguMa/PLips2UB Lt*V1-%lM/Mڹ7D(i՚5wܨ6f ~MI*h`3tFptDۭss.׮IJ3 &Z(99ݠ9uI tAsy0ĤJ[mwvv/ѢAo9<^%j)Ux*L&Z^iM{f\9;W4zN> E-Ł_%j:t)`1p]:\]4 ut|O7]W+#gyXCtZhZ<#ZS+r#:fήިBh] 6kO;ttKtt+uu/nn3mvAo=/XA7'q8Oh;tutWDih΃x~M>IӫOg5o  W'T`*khbL{-whXQZ0Ueگ7? k:^4<锦H]ŰtttQPB25"Te2fpN/b9KFdNX@;4s9ǰ  kj.4GjH p  ~Ĥ.5̦dWԚC#U`H35; M2PVU7i`9NUZ&Vv.)34^o8kӆsp?5*6Ѱ zp`)Xspp]kÍ8#cʘe5kzӡc\S -z9yFlp` {-6"`\)5.~|Pg\ 7lup6l.J_ehl\סø͸ø[_agѣ!ѰȐїQ!Uã\休yF2qF𜒨GP05`cKkގ<Y <5 J۔Qd(O]ۓ2$Jb),KI{e²R6m,Y2BJFe#djuQڥyl=~O}TmIQ*};s{RAyI.IrU |Z p7KS­+#Ii_5#d$N-570r(&VKID( 6~#,<1T7*o i-Nijrz8A> /?+ hk*h`c ?Cx-qoTs] '%=pxr󄶞=/-8g⥲Cd(2 E:ׅXHFG<,f8*p,zmkrS߂W^qs*X_D, +׋v]n)G~U.rrߕC? MU7>/k^{O8tBr=!"\CHInQHBܓ$! ܒr' !;sc|ת{y?s̱s1\{SFy-'91tށA)֥kq ͷZSq[{~?b;qS.qMHӗO=]jCGLsĢX:h"r RKQ֋ǩ|?0ItM}Bj;N=TZ;R19Si HI:þ:Ƴ{*堩S)R^O2&e|ʔ)S,NY6eSVOٕr Hʉ)SnZ|R3f#.5!@b4.O*5RS6њ^%gjACqLKkB=C1{ ǐc1d1d/10iJjieډʦyIT7"3E=3 OfhhVUbdΈAmLhϫ,O4r|t m(&PMˎ73l5WII'5K;['uWϤI&_)Ic&$MKI9ğ i ɮJZGsқ=i^nO:Jc!  MISRX!lSۤ 6MKt5Dc^ fyM7+ Q|eYsVkiX6!i.K.e",mw%AXt-^nqb:C- MR3݇*݃pdum K.Z_ Uߣ(}BOrW{z Jj}N'M'ʨ 2%6d@-a"D%w]BiI>bU`_@KCR2d<;V TH2fAòi ,UQ9!6tte>+a? 8h-$٭gBg&ȽL+( t ]-[+k=a}k_iy^Š,#3$ZC64dyy fҚO|!'k z$S쯉>WD1_7+T,ˈ3@k!%'m٬t z:zp;pՔ(p88xN* $TZ 88uArJ烳~LƝi@ ɾ%4yk >R_FRN8qqp=pg7]k2 9p=,uBCvhz>643=cd` 3Gr8e;Fv;8 0GJ  IĢj"FLx%e~03``6Xcd`.]8ˏHWc`~MXj=6 ,a:Pi} = ~R޻ 5^<p,Hss.#@F~=mQS ;#ا>*R|:lā:`00t\ZGf.1>·<r"N?7B^Q Βv^94v1oӾVN0Łee|Y\cu,%{~Z1*=U6^T(o0ǫ֒ /˭%Of yeAKg $*3k1x 3 ^e0st eA0Jςsg XNP~51y.QΚT]o )$UF*scꤹq՚SM$zMec$%8+# hvGNYlyP} ;WE;I!`{eY܋A^5D;@O~#ܻhϭ@^F p7p% $ ^ɒ*Xދu^ =;g#lo Q]N/keZ\?4GWY!S몆z4!\ ~08qy ڮgXքΚY:kBgM +dͺKBZhX zE  LSۦ@Ժ )vq3f]GgjwWYo%GnZo-_A-yi hu`kf:j: yV Ƽ.){1:{1j{a'2@~);$$sCrzE00Gk6og7 80'DžƗ>bA/<9 I$8`=+.cwLͦQ)mfXxݱ0?,ǬܘP7y \Mk#Gin{g+#J@g9~ҏB/bàkK1Z ׆dX.4#Q/q6p(5|ި9̩)r^d`d]ׂʱ{q 88H삼' |hgZ.MbjŠ/^blPr^f[Y+vr6feAa;8_-¸? |F/k]́P \W3T\:7Q`/CZYHxT/xHU hؽ.D~c%cq2 9C*>|g:m.p2G1^OB~'Cik#!,Ec`{6Bn.;cN1^-ڂXk(xȻm{%kWlmR|)J(Z 1Gty?_c)G!3`Ɲ܅z p%mDD@ m[{dC`wF;'zsu^0G^fPq46N \gtJsKAmȏEC:X|*nV6,o؛Oo|r680kHU`:#TzkRrLƥN-,x6QZ\ kh#0q~UW_KQc츧ck_Sk @9.v Y{#Yr Lqq+J]E.g>`.LF~~Z{7}7LڏxObF+L#_9he=]ea׶ 1!^-mE j@,Q3=[b\b=z;]8o*v>"ZeݗEОL'h(|%yV.{ 5z taYs9yF<δV=@c%ͥbR#w/n]]wS% Y93/ i'!r[q{r]n> #FO} $a~}zJ= 22z%`s#[]};w-Iad5^B58sv1=;јkͻ**2Ր| xȴ&{ А 5!y{̱  D]:Ob$va尿{J $Ar?gQh+ujz@F`.d{z]]%+Y: l+kTw_c/>-Aׂ*R`+'?wE v)A jŭ8GDވ/Kd &m+ ⭕ cqxQof2ZE] W3mg+h, ց=obwb `kCfHV݆ig#k N~FYr5$1P2ߊ(̇oUL鹠3hftq{ 1Fy8ec Gdb v:| ŧ)t7.ʟChG՝zA^:-  ( NI`mAfi`/^g4:j :GUT}p.WկWJhӐ l16g.85AV!'kg &4`vѴB=ט=c#k CWCƳ^HCio,VSӼQ](38;]ٟ93~ށY2i#h ;<~n,VO@k'm<NFqXq\1?0Xx

z,Y[>0tuQzF =7"TϟABXi=V.X̛1`_VJ ==@OfԘź6<&6M 3lCymzQVJc$h#l%z~xԝ=, :w ).קߥg&>t.PiS݀P:Sf7@JL{m :֓DiNj[bK@H^ Uvg FzMjLGͶ*yPE 9 /0!V 2  DPcaJVa] ҞBcˏ]^(|;_-`loh y[S0?;p4pp\~Jx u{@ցt%i׹Q9Ş3!&kA@hú#i \Jx hyx97U~`6<*#5D'EhI4 [IAp}֩?÷92T"WQ:a{5$kftXw:†h'ǥxn.l  Yy->䕝iu޺>/[3!IqQCZlIY}yF@,MnsijS7A+_vu,ô1Qu}HRlb ^-pv2Zg[ {yӃƌ h < \.J!FB:w&8v 3GdZb$y7]zQ+QSsx^tmIF`y{j[¥kVB3-=ZIF* hs*3Q<ϒU BͱN-WlbZ^'3er4>~20Ta.?Q-@uUu}tfh^*o<{Ec1Au c*  u5F5T98Rmuuc59L4} ^6d1)q ;*G`L g1#F 3t8`1FF(!ySЇ$_] ± qqKm!9p"c O#x>Czj<˨O2ao3* 8 ,c`/$ SP%Ɛ<pF'7P*8tu(ZU ߀> 38A Gzڶ_di W| :g48B[k* =dd ^C1?to]#px#Ŵ~ښyZ7jao ?x NnpBۊCrg\qpg8О`gk:"kK(% hc ?  D-& `s۠ teHz>Vhr`SC&4| ?'z] q(vV^\ cyE]|zL"Þ1]>fj;\˛=߃@CR C3yyz恭1KLĵX3= !]{!Qs/ay |/aZ̵3 Dd mʋT*"Q8 |/60Ҙ;2jlo6y=Z '*chF NU sʂoH<^-ИV_>1e!jYn.Ufl#8^<ޘb5F*_1( WXlx{vJ-k(]_]3&jp.6oS22B0 [n o gtr~_oA=XAތUP #hO2Q> >zm 5`{nH~pŗ@C{O!F ~@OM ,9Q72U@AiwK8JG;GոnZ+.z-/=R+Pon4N`*k7^An8(̧+C@ 4Ԑ _cP:4< h_Dec/k{><|;!s1: v]LJPt)* < ס'-q $GBxа̲f{Bƻ@oL ,s/a= |/{-o^ D14QC8棺yԵ?ߋ*6p6>4<\]F-ף A~8Ȯ>06kDPZq1 ,DQcca)r/V*#S |AOǝ(NT{)9G2k{4ew2Z]Pz1t[`-h;I⺍yߣpw<m|% On~H UiwA+h8 X!Qpע4K2"+2OO,cU wH3Gf&?odxC1|nVVmgZV@}AAGרuhO8Gx_2Ѩl=4- y2 4yoxm`ZڀLON"SOgԕz<$dw2Z| <02#Qm %Y 'k3sK:@TBg@r:k^w㡹1ҕ!ԝm㡎ӀeiXe>1a)uk34O6ri9 i{Σgη鷨khewA_N? ^׏k2V Гvo=)b<NdNfԏU1jp-<`7dceVFK ;O0m׀L&qJfi|o#Z8 t(X o5nɒ*j% 0 [2$/0Rxy~/? G '^.0qH]|4õʣ4sy\j2;ygj*+`cHv{6|2#^5|-O(ZVD-/K|^_5=~ ^w2ڛG#P}\FH,?r *ވQ^WEGoCs5W`0ɗ(Glp$X16>? _ `&6_rýVV1Ĝ*OA5k~H994@;KՈE$9,!Y t23=_#m fe*iӏblŘ_ ޺5>%­E/񐬟uDn,wf!KkowE`N3lsZ~< H .RttZi~] 9?ygPe;3gHϧukEZ  #mA#Ό3g;+Nxgƹ ~@{2 ؚyv{ګum ~^32:Uлb `.:?ɪY7CgIp_8P ㊛a[c,,:t&o. =??Z肠A4~K'D3 34]t):%5m4^Ei6gC*#  Z~X ;a7:ĝ_=w0y7qWzJYɖ8i@ԂwAuw&>_15 gVX}Á3 kہ[wluxxu;Ym  0 o۵E+ 0 ؕ.  ٱsNX4L઎/hn! YeM`c_S +0,,, ,b֝5)] 8l`(p] ln; ,nn֩UQYuFGC`nK8*ZƄ%]CK9ӀKK;ہ{GWh͹0 f֣K`^`!`" "*Vw 9`[`G`W`o?rm6%GC,hIQ~Sip 3O;u;ό3o0?xw=<=/S@)@"t' gI?%e3(f'eq){+fb%Ғ12,-.˱r\(]򸼪,[>jfej:N[:cu!]^'& z6}VЛ }[~}G޺<@ep]C}~o}s^1M}Eܫ?K}'_M{_}{?nڽV>_=|{E1'Cus_V}v|?JPi\? mEp{KWx{ߗoJ}oޟ{ߗˈ(s2ʗ){˓{r:b$BCi%ljruKz c3ڙ E@e֙f-qHVBVdfP֒Bj?DDo3 _`D6CdGI /M9\o}1J^y]^ob,* UaL*}SԃA1QT$ɪ!V^XMѿX^UZ5X  ^UczOlT3^IGknҺHUu5kRzVwi٭Vn#Kv{|fwev%r'C-i3)HHu%?2B2u1ytyPg4L>1ͧSQ5sEu35@4 BQ,6Em,IfY&JR "աعNK6֗֗BDq(} q%cC>&g a5q<>1Zr#&bX b)ⴸL-tTQ/#=^WԫtNT?GǹG{F ĹWktArq5Q3 {E sOs7q5Qo+m:"Q8ws18z^Q}A=I߰8[Իe-3޷e&[doɾE["}|[#"3}|[doO||[doE̷X) Xdi},-oEҷWY[foeVY[+"k|-ouE[doo|l-obxjXdÿi|l-ͷv";||[doݾE[doErȷeѷ2?9[o}-rҷXd',rߴ/EN9[osE.[o˾E[oEnշoEn[$t2!Y&$=˄g-s 9\En`rq7((w:E?u{^eM=BE>'I}JO3> /+)S%t)kutukFXn/*.tOݓ2޺pu_Wu?zȬDLø+BVn+c%XZy|V~!{Jo0Qn(K{S#+_U+`]XYV6+Ê$?D^2[+hEY!˵V2V+,[j$Q֣V%ʈz:^o&ެ[weq[?Ə[S){8JwTCG$). R_z^1z&igziLSt~GڹKo3z7P=Z(^xC h^)F[hbxW'ƋiOd1EL\!>3bb+|9E/BH,_%b)ŊbX)Vj"bX/6bȷbNlvb-bO18$~ŏ"1q\,NqVqQ\htE\uqC[7q[i"XzzR5P SjVM3zV5SsjZ֪jWT{A:NzQuQ/ijگAV?#'uTS:N_iuF!uN׮.K겺k꺺n_-4N!KmЎ(]OO~V?[N%=Xѯ7;}=Iן/BD/[6];zޭzޯA?#'UeX{}~u:d`~X?YGcqgu:ebXgsyuѺd]XWkuuպefݶXiVǜN5Sérj;IN:u'N=i<4r;O;MgγN3i鴢Wz=ONtq^r:ݜNW_U t99!Pg3ytvF91;Xg3yߙLt&9)Tg3Й|q:Ϝ gY,u9˝JgYuv9 Fg|lu9۝N{gu9As9u9ǝIs9u9 Esٹr~sn;w4'=(ș|r>qf;W5s#;rOPЫ~ABCCB}W~nw;v_wp-w;ʝNt')Tw;Н~t?vgOݹ<3w].rrWkܵ:w~~nuN{wsr?'_3{Ž^s7ܛ-7榇EXUX >>>>>5|+[vN8-Q"v$q"HT$q#H$b""#"ё̑HHHHHHl$g$.+;@$>'y07/?212)292%252-AdzȌG#)5{5UQŝtu*{uد VtEoQc1=^DZu֭XNaE/_X!ZRCvH&팲 8!O9NiyۯMT*Q+-M*-q}&E.hͯCZVQtKC2߀?(8w#n"~Cx^ֈ En y$;Gm9iF5l@Dѻ&DѸd@IFd$;Jr$%JDѨ%ؕUTTT UChU[zB=!;wD eK..>eR;Ck+tONkyV ^9ӚլL#N65WGoml}߮: xjjGxZ^s/༣.eyou, f9B`q`.fy%wd@:2Nyԩ,W  5"`` 1X&XFn grsJ6X5XUn ֐kk˭`ll &&rgy>>^mjj%ڄCHgs[Y iE 'l-淠g;s0`A`3̄sz0ϔdƹrt)du^ѻ"Mh܁|X9Y,ERRA}{,CF>BVVg?/)_PԫZ]dm—daWB8ANu'1BQ~i߂40SjE2H1O3´`0=%`eQfUSZo;:W #X1IsBֱ-b8D;4ȓ%_JedEZE&ԋd dOq~Vss9g8qn%?ǹ\skmBsp^yU0w 89=|8WS0~S1r0r`c>Ę}Q#7 # G0gųax,,ť2<խ+f_ig wdVZ6Hv6k9ڱ'qx.|ȟɌB{H_xM.Ɇ|Z6Ovƴ4  6wLI:94%454-Ahz kBkC_օև666Fm,cqL0kVНPZ(ݥvǸcq{x}w].s+ܕ*{=q){=^t/p0p8 pppppppbDdTtp#r GՕUW W7a1D&4[&3d~vz6eɴuPiN;zvt90 6<ف']$l ʪrUA]nev/]Eoя>(.~Ybbv}dD|b W/0šwy#tYwO8,HhEk8ߕ=^O}u_yv+&uo_bFmƿMel QݷZ2*ahCtl+$:N!:AѾMu хT! DQE[MQ)_j"ѓ$'DO5 Ivf @kW+B۵v{;,J݋k`{ѯ۫g).!U0 BFut33>$Κ`&D2t>3+ՑuQϻ=0ڹHK4SC]uHҞ,,KtB{iNJ'[H7= VN >nL_\tV =+s㦒Wȴ9Hnϗz{)4MJ_vS-SEU{d}oC]˫u_!LÖ0Ǖ^0 0ntP<l~{Tx{ # Q{nmAGe]{eC?wd=`BY :DH W破46O7VÍ\*IF,nM"JK**(8 ~X YNR3+BIoUR.)(8nCm+e:TA;b=+q*-U]fMu?z&Wyw^8ⲑʳ]ڳ)*lu%w%TbcWmJu(;H>AlA"\ĬTu U5^>zӧiEkuFvb5% IĜ Cvo>:  M`0-k9j GB ؿ|;Nn.^`dGH)H$ dpH~S/(bp3M 6|%?LNծi#}P{ lZUKѡ=ӚqgiEUsRo2E 3;=n~UnHlXd0v[-Fp\\|*Z>_CZCkDyR@Dź'nΞ~[,1bdړ_)@q;(.VvP_6 H8WawLAj7ǛLڄM/־<{ç}smn:T[:g62lس(=҂\ u.|S3;&T,WÖ}Xd\}[(x@fUB66+JوTKsb`[p^X(3O b8aW85sBҎ=S8>@V>*\%U^Pr'iM[%6Jr=Rż?Lir0 IH>}&6_P)Ք1Lp , 7*58,2'تUǡW`ap ᣴc)*$c"Cl9_DHoi}H+ κݚJ hmzhO峽5)QKP{*lUZqGϻK"|{VVO%BK)%,A E6(4,l=UvߢSz1${9(@4"{;XAJl4sWǹz( %'(Bn2Y$7z ֍f ?4f1(,34-SO.Ix?S7Cq7ebL_pTҊ ƙwY]N) _"'ŴE'($ݓ@siέ—i̱fwt!GuYDŝoMQϢFGȊ; cB{ hU i״HYdՐ]׆_&a<7>^}*o#0}g*|?]]雇_$LM&C% ,}ÒPESG,E&EFͯ!ar8< Ab?8 0=!Q-R﯋}T%;A4w&&߇vs= 5sf[ MŁoB6XFx3Ո~8CqX?$c0Rܣ<ȢRl!X}"=U[آ9qaĻx硍oS/PL]: ,>#͘O-QfjuVc4\O]ȣHe _i &zt=3F[$Nl aP?o+0tlm{vfK_=|٪BJݧ ]3}R<  j }M\:ˡ]GXdx,YLblHx-\Qi! N[kkVTeo `߫j!(Э1%1U%jBPFfA0Q5|@5BŽrwR p[gE睯æmqBu7T8<7`@M v'nIӀQ' dHP6QҶhoHl #k 0 ?2s#_z&0>Xg%ǔjjE.Jy<dXTlʠ.kSzeC r:rJس)דK6*( +}zՔs{~Vw&*4^ ( ];mI+FyD TߑkC4ꉿUO֧(/KX3Ze;rnNR3wD{Rg>8k$}b"TUkWT_rdsFDϛ?TW(sEdGnڇ8{N{]b"JG埝-O./pE󹏊eG 諘TWX ~.4cdX-aǻ懜g~%٦ N,2guC[˯j= {p]G(tZG~،?kvZ!#SsBmiCA?sI'ȸ! ς^P/W]ՕcHvCk6_Xv3?`'He@,A@ؕ[~lB&@LGdyŀ B?.DԆՠCQ%O}AB<98i XA  1ٍ3N 0AO P?l o_kﴙ_O뺮/LX{qQÜ*M7 +rl_ *`ݚ]3{?H2 I3![uD#OweЋJ)k7V+52ǺG8#Dwk 뺤xTP'x5g,,c^&_["# il*6æI64k]|؏{uE)iz$x^CI<1GH,bقf¿m&Νdq`B2mm( )o?$u CR2mн󻔉ӎF4T)c8O~tD@|޻B!}#նLFs]B ?+#üxOs0"wc<xm~Vy̒eCX)6Ґ~DI >g534bj+<2PQ^sXV?OIج[Hf^YG (IYȹU=S܉ .O?ѝfܗΥ7pL5rgJ^h/ 1|&6 deҾ:;, endstream endobj 4 0 obj << /Type /Font /Subtype /TrueType /FirstChar 0 /LastChar 255 /Widths [ 0 506 506 506 506 506 506 506 506 506 506 506 506 0 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 226 325 438 498 506 729 704 233 311 311 498 498 257 306 267 429 506 506 506 506 506 506 506 506 506 506 275 275 498 498 498 463 898 605 560 529 630 487 458 637 630 266 331 546 422 874 658 676 532 686 562 472 495 652 591 906 550 519 478 324 429 324 498 498 300 493 536 418 536 503 316 474 536 245 255 479 245 813 536 537 536 536 355 398 346 536 473 745 459 473 397 343 475 343 498 506 506 506 257 316 435 711 498 498 401 1061 472 344 874 506 478 506 506 257 257 435 435 498 498 905 444 720 398 344 842 506 397 519 226 325 498 506 498 506 498 498 414 834 416 538 498 306 506 390 342 498 337 335 300 563 597 267 303 252 435 538 657 690 701 463 605 605 605 605 605 605 775 529 487 487 487 487 266 266 266 266 639 658 676 676 676 676 676 498 680 652 652 652 652 519 532 554 493 493 493 493 493 493 774 418 503 503 503 503 245 245 245 245 536 536 537 537 537 537 537 498 543 536 536 536 536 473 536 473 ] /Encoding /WinAnsiEncoding /BaseFont /ABCDEE+Calibri,Bold /FontDescriptor 11 0 R >> endobj 11 0 obj << /Type /FontDescriptor /Ascent 750 /CapHeight 0 /Descent -250 /Flags 32 /FontBBox [ -519 -306 1240 1039 ] /FontName /ABCDEE+Calibri,Bold /ItalicAngle 0 /StemV 0 /FontFile2 9 0 R >> endobj 5 0 obj << /Type /Font /Subtype /Type0 /BaseFont /ABCDEE+Calibri /Encoding /Identity-H /DescendantFonts [12 0 R] >> endobj 12 0 obj << /Type /Font /Subtype /CIDFontType2 /BaseFont /ABCDEE+Calibri /CIDSystemInfo << /Registry (Adobe) /Ordering (Identity) /Supplement 0 >> /W [3 [226.074] 891 [498.047] ] /FontDescriptor 13 0 R >> endobj 13 0 obj << /Type /FontDescriptor /Ascent 750 /CapHeight 0 /Descent -250 /Flags 32 /FontBBox [ -503 -307 1240 1026 ] /FontName /ABCDEE+Calibri /ItalicAngle 0 /StemV 0 /FontFile2 10 0 R >> endobj 6 0 obj << /Type /Font /Subtype /TrueType /FirstChar 0 /LastChar 255 /Widths [ 0 506 506 506 506 506 506 506 506 506 506 506 506 0 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 226 325 400 498 506 714 682 220 303 303 498 498 249 306 252 386 506 506 506 506 506 506 506 506 506 506 267 267 498 498 498 463 894 578 543 533 615 488 459 630 623 251 318 519 420 854 645 662 516 672 542 459 487 641 567 889 519 487 468 306 386 306 498 498 291 479 525 422 525 497 305 470 525 229 239 454 229 798 525 527 525 525 348 391 334 525 451 714 433 452 395 314 460 314 498 506 506 506 249 305 418 690 498 498 395 1038 459 338 866 506 468 506 506 249 249 418 418 498 498 905 450 705 391 338 849 506 395 487 226 325 498 506 498 506 498 498 392 834 402 512 498 306 506 394 338 498 335 334 291 549 585 252 307 246 422 512 636 671 675 463 578 578 578 578 578 578 763 533 488 488 488 488 251 251 251 251 624 645 662 662 662 662 662 498 663 641 641 641 641 487 516 527 479 479 479 479 479 479 772 422 497 497 497 497 229 229 229 229 525 525 527 527 527 527 527 498 529 525 525 525 525 452 525 452 ] /Encoding /WinAnsiEncoding /BaseFont /ABCDEE+Calibri /FontDescriptor 14 0 R >> endobj 14 0 obj << /Type /FontDescriptor /Ascent 750 /CapHeight 0 /Descent -250 /Flags 32 /FontBBox [ -503 -307 1240 1026 ] /FontName /ABCDEE+Calibri /ItalicAngle 0 /StemV 0 /FontFile2 10 0 R >> endobj 8 0 obj << /Type /Pages /Kids [ 2 0 R ] /Count 1 >> endobj 15 0 obj << /Type /Catalog /Pages 8 0 R >> endobj 16 0 obj << /Title <> /Author /Subject <> /Creator (Microsoft Reporting Services 12.0.0.0) /Producer (Microsoft Reporting Services PDF Rendering Extension 12.0.0.0) /CreationDate (D:20211223010003+01'00') >> endobj xref 0 17 0000000000 65535 f 0000000010 00000 n 0000004045 00000 n 0000004242 00000 n 0000964853 00000 n 0000966253 00000 n 0000966794 00000 n 0000000065 00000 n 0000968185 00000 n 0000732148 00000 n 0000840573 00000 n 0000966049 00000 n 0000966379 00000 n 0000966594 00000 n 0000967985 00000 n 0000968247 00000 n 0000968300 00000 n trailer << /Size 17 /Root 15 0 R /Info 16 0 R >> startxref 968543 %%EOF