%PDF-1.3 1 0 obj [/PDF /Text /ImageB /ImageC /ImageI] endobj 7 0 obj << /Length 3960 /Filter /FlateDecode >> stream X \r6jG%k$Hgj7UqFqn( *G}\sg ~HmMeKЋo~ALFAĄWDE4]wE/溎ĵdm"좡zW#15>DoCf!6CuK3<aK< tL.`0Vj+-:~e!G<NB<[40ӵ4 :^.41A%M~O8nC/kÇtmS VPOtl6PڡkMY.Ҵv)݁1̊t9^Nj7v\M7 .u]7# #ٚTGܼEWw\4AqFhz9l#|I4f&ǗXQm50V8f܁'/@o(k -]Ї뭪yD%fS\:wnblmC3} fx-Cˑ oUeCrPa`ilbѽ }ʑր:]<>ZkYE8EͶryk-+t7}e"ҡ^;%  ip6g& hhnoAx_y 슣i0[A#i`]#~ 0r # WF 1pz0XKc-lkW  [q+Lc-RFܟCˀS$cɺaLos@Lx:A< bʢfXҔt,$M[`;D:C7dBX( F2@>e`1 R6!uf ّ?uw6 NI i=8 &htr3B&JJ([LԇI骺7 ldXVɩA()g=b| 8k_9-g{L*(i\AšhVA:GvuXVkQ\GsxQs(:Jץ=$W].I@9o1l KP+JtHBIo^jz;+P lg}wX_+zif=ǐ#ά&RI$}HMR$jn8kܬfլr7YϰW'rC,I|P)_owV4~}qy zppEۏoG../ԆkC4rNsz5xXj[W""U>8H58UReOFW#2$v[ ND@ :b@M٬nVEpK󜡱&?ٱ2vl qMDvRz*ӳA"=+"^+DdxUѵyi<^H>a{5M0 |~ܞ^^z5Kߝ\юHEpϏ&5i`l*  <#B?I<;,w; 4j- Ξu1 udչYr]Nvݮ{!y@ug׺Hk'yURs ʡjvت2B\;تJre+4mk3 z+Jv z]iս8\;h.9k{vUwMzpm/ꮠUwa}K쬠\k7@ sʆ1\۲+$mk[vUwtoemAW6õlt]Ao%[Iõdt]iӽ8\KAWV-xОԊ.6W=M=^țɻΛ_Ez-g'lU, `=+4E_뎮cΰ${CT)xN`/u,,ѭ,+fZfO 2U&n4^3p']=`\aT_BM  =Ԃ+ j𛘉b3k0d5w0zV0*bra0p4Ba.u-V Ԯujx{O1cF4I}j"Q@:﷕Bb)MJku-Vj*ƒ=تRk>} ^L&U=o~8IIxWV&Z|-mX~l$ Z}GtƟO,]q7>{$q׼Pe/L)x.>>q^m8! 4Ԣ Pޏ;=F:q_iuJіy

s?,f>Dx[}q_A9a$?J@ݺ8˖q$BTh< RhF/"H2;<TC[ÈG $]`M]$[#mBRiq}8E,JjQmS0;BOyx ?'c%x 262ؽZW(l5x⚝hD.Qp|10m yȬ9/_6)Rv&gWl\H3ٚ. ,ZxlU{{'>-E8z(&1 Y.$Q'[BCy\X> dkF )?2t׾*%RB0E ΁ɧ ,j9&x´quLtƒ}FsI$䁓N_L,DHȳ<6F) ů>;3ímW`^87#e&꾵a3<(X/`_ 2`;, #z:֎<,vc endstream endobj 2 0 obj << /Type /Page /Parent 8 0 R /MediaBox [0 0 595.276 841.89] /Contents 7 0 R /Resources << /ProcSet 1 0 R /XObject << /Im3 3 0 R >> /Font << /F4 4 0 R /F5 5 0 R /F6 6 0 R >> >> >> endobj 3 0 obj << /Type /XObject /Subtype /Image /BitsPerComponent 8 /Filter /DCTDecode /ColorSpace /DeviceRGB /Width 838 /Height 351 /Length 727730 >> stream JFIF,,JExifMM* C(12ևi"-'-'Adobe Photoshop 22.3 (Windows)2021:08:11 07:17:510231C^px(HHC    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222C! }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?(& rx5K@,Ωǰw푰&WKB8ET?J>$Oqx#OaY_6)Կ? [Cdgǘ=??qZy~!2&Wa~2ea_s'Ҫ~mylw2]ƛwlIAԫsc)-[tnta\ =xJw"_MG4Uܯ}rZ}14#kD 85d:Б '_Ekĥ.ײrZ<濕{p)2yQ5_K4M4p~UAK4LDGQʋDMtTf4i!4/d3[‘=_@ju KOgfˉB:};~rkc@ 5GǿI̓<OS%=˾9ů|>֗W?fHM@wy_* ?%+JkD~O?iQV>XaRA='u} 5($y Ӄ뢽Y}oڭ~ʥfi4ƍ6}Sfk+|v?O*5A{WN_ȷc7SאVD =;}qںҼLӹG1o>_$ݷqVqIt^2nVV:$'?e$N7c p>u%(EAr24/- 5aҵ{x#4L@<8=sT0²]ԓ ==q՟@j{}y{?N 8`*Tk"0s|1CG>LJͽٻiLMӶ8D&i:r4u U2pEx_A+Ӵ hаǽgH2\p%)lo"n#.F֫<I赭25]9&"*Pw5(`؈vVy$xu7Q#Ŏ?byK\/}9cdȵ[O"򣑝[_e|\sОNkj)ԩ &"0D>m4-VKȦ6䲞qkcK<Ԥgi,NI_SJ:W_@R"я)t:I; 3Tk6{bɿ 8=pslHmOd6+<ДbH|䌟JZI<9䃒0Ab#n7Wknr=SLx2{++뺄rI'NJڕ N:傱gy=՟Euמ֯5R[-2x~ d"qreg!B|v_ŭƳgwJkM.yϷjHbH]GZn7mo"QPwH}aGwoR9spssS 9RvW_#̢LĘ~vؑVAl?]M|ؚy]4)Va-cGa+L@=Myv-eXZL3,F4a!@8w3i΍R+^>>qy^G=9/Bw3[<jeA$ 2 ;V9mP-ګn  =piߑkВKkh1Ra%W#AԃPn'aWVEehAc=*.-zcU,d@"sGy#kduOSGbdaxiAϝ~>_QKFegqjE֮нu}fcdAe Wq"FVz~f jt[c-$ s#1d1#WE]T w1 *.QW03ƲFʰ8Vf)մ`I]9wJnxkyLl @ߧjΌa5dѤ:ԚZ`mD񷣩YލHT4V; ƶzOl a${psyBTQxNnV1ĈUT[Z:/l㎁4˙52XEՙ'u X#SGA9l0:Oamhm[\ !t~(NIn%Pެm{ 9,+(\rM.mE9nm[r ՛"ԑs4YE2qq r7`nc9?+g8Z/m5;]FLkfAHctb 8-'݃P4QƚL`-,'?>S`'d4'y vf :zWzd3E#Kq#dăW9Vm+SisSZ[c"Bw>M[$0mvSX7o$A YYbHTԚwF5߂.v+1 a?+Γm#5Q\.#pqw=1bxbyHf`(mS~uG3iV}OُwZ.Yv#!Ot?Qj8sE..̉[}2K,aD%TV?0W.)u)K{|6 r+j6L7je#|UθѲi  2eղkf _>;us{|՝(AҢ*KSeb룂X@#ɷvIEP(k;kaGk*šm"=EFN.ğeer\bKE(] G7EsU)>jLFjD6^ m-# R(ö>e su& .!v4:U*j=`m6eg(?P:ŶchCmck0Ue''v[DQ@Q@Q@`((Photoshop 3.08BIM!Z%G AVENO-Logo_4c8BIM%,7tzSҷ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTprintProofSetupObjcProof-Einstellung proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM 8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIM]^CAVENO-Logo_4c+RahmenC^nullboundsObjcRct1Top longLeftlongBtomlong^RghtlongCslicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong^RghtlongCurlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM ?C}# Adobe_CMAdobed            C" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?T/c][rqeUvnunncd㡁p;0Cx4{qɹjw:4IsnC >Gk]\Yy bә?,zMytONQ"+8O6a3&|F<_/qŌxB5uߏ?+(hOZcc&q i+?И=h-ֳp/?y!&> ڇ;7(?>>y_&XV'??>~0zc~OFXݵ9==WNֱj|f'9}8Q?[p-N00ZO>v֏}/l.!p?[?o~<?Z_~ tlx,|9ۆ[2]cfEFf5y8UiQ4K-^agt1c{Kàw~2ǐ㔸"wù@kwВ\O:Ak]:7FhFkVQEJ:G~-}z% p ?/2u޵7 1hQASmKҔrh\e 8e_TɿS:NٙW[V㽯f?Cv{{*}uzk|=/^²*X4 qEݿYf ' \cbŔfFQӤHje1$Om?K9OU*Wv8'" YΣِ?U+㫮:m>u얇h#mlߤnǽ,oY,5M{]{?5O)2%^8|21GB|q\&>Gݗeu^oNv;˿uJe&w5he>b,~3^1[8Kѯou\q0ie9V<1λ#eu? Oˏjs^TϧRҭhǽCXF[f=VUnO:Oq캍@5ÃzeY[|C.)O?6(G,c`qā # %oѴt˺~8kXNvKwouƮrh>zhkQmUc-fFC$/c>_]nYAyc[ '!N;?Nj3<%+5?vӈ j۴6ѳKf_ֆ%fgi~j"bӿ]²,ɸƍB?Λ?'k\ EˊU tfcc2cw"7?HǷ?\F,،6W{4~&ؽa hkD4pL)̓! Lc0.F pǰoUձdְGkecI&XjCr*u7Y[s$;r1# Dg(Ke] plb :\ߦϤ9qZN=HnΛlVznloCΧԱ܌lkC>g9xĈɔO)#ؐ')6bidiJn|I?\f.$J=t.H(m^M³OHypN,tW/GFeō2[WPeyN.dV7Oh`lsmkl;Cߤı(ޟMtPnshwM]c+ݑ=5_eϠ~&D(!~QrvdX3fܭֲ7ퟤ`߽Vm&y`cܠg֭}_?'װ6>k}MObf^Nn;v5PWs!1JcC# [0?75f=WzX=ҫ%B555uy,SN߶9tG~S}l9<_?Ied~G{/z_kKqm.sU]PVe]K˟,Gl:Ks멢{2*lُ3k/Zލ]uܶi~o8GU+8db2GT߼oxWY{}_LZ>^.-cbeёUN-WF30]C϶kHN5YYcp褘+77 Xdy|lFDDY4;.߮}< Ջz@'\ȻF]k[㾋+\g=c~^.57s[=оtc1ԇ9kϛ/\"$OQl@b]yָZk}= 27_[jdmh'p8aS9%2e)˩1N\R$ TI%)f}^y6:Kѹ]e$O;dnZI @:~j~YM3CC呙]ӫ ]IAc<j2EJ;Hq>][Ϥ@e"̿{gв I_2 (w< -j>R?5 /8xpߕA9XsNuHp#UWs v-Ň,?5?ꓬ$bӐ}zo؜ۊha?xKo3LWCD:"t'a>7;mM=zՏL]nwWQ>jiʰiδѭЗ=3#짃dx 149Z>KHEb+֞?ԞYk~CO^qz=Wpk/v7}5~ts]`]Ek1cCZ4pxh,&RI$Tʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$8BIM!WAdobe PhotoshopAdobe Photoshop 20218BIM1http://ns.adobe.com/xap/1.0/ AVENO-Logo_4c ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$C {/o.s^4?SL}_=/±Y>_q,|{3??Dߥ ?g~(Y>_pa?K׿H[ort?_zX?+9zXd?—ωhZ\Mgo++{'4vZ54Wrt? _˦ۯHbEzF)/a"/+'uC᤿vTC5f/N)s"}}ύয়?-ƧA" 2w1ۉ]~yt>ӗ?]F~5H6Pq۷هN_~>#u4qI56$&OڛA_-o |T2kG͘w/=O41YCw,_)I|471#c/M?L|M?|w~aG~?dFs~>p' e⩧׎O$Gώx?Tu㾞'_?nl4㧍_x߹h--G-7Lo'IAf!1'CftG͏Xo?WgWfk+sm{O[,?3k'Y ?\ГmWx}Gˏk35M>-[}͘w/<'V(cq1dx>ojMa4l~!bq1P~~kSO/i.ҟYg|4֩z ^o?_F#0nC [~yտ W >ZVꢚ֑7X/ ?x?7,WX_ơ 1>,SNh*|_tnvS[:suBϊa?JGk׫uMjZzˋ 6く_šY?Bn:m>5'/'5ij𿈴j-m $y}@Z~V蚿 zwY0JTQ_O(|t[Dg-[j?xvb%(_|/T!|Oŗ+I`]ş_c saWe}B ?>!|b|_'7)/!IU0xu+?@xG?7_&+5h#)1??{"L/϶źktv/?ξ&DR8SƵp? ?L'ϷX2ԩy O>O_" *_\/ϸQZC*dƾ_TC%*~"?//§!ge,z巑 /r)_ گ_wŗSG_|^|0/T2zN7??ԣӮWq5h~u'TpkQǎ5/?§!oɿȯ?|*MN Fu|Ÿ?Gƥ~(?o?zԿOC<38p90k??=?†>9('O!mɿ?3c'`()GSOO5O?y&!/gދ;ŭ0+>_(ǡ~!j/_~2~?w3ߍȻ}6W EA &|'R)WQ?MA_~2ޣ|SoΥ|W??FGĝk(S)~ĭo(kVe?f?N_ًºz>&k_4h)4ɿ?֜/H3~?ȫߪp>"zϟz$Tu??럴 mN_~/!Q?8~ȿdcW~j|G??4]jC"֊="3V?O?!~%??~z?U?&?Vim{!c?!ɟdck~?ȥe_ LL+70OM{oRj?Cg|'ߪo2º~v?#J|O^ ▽|oRl??emSO+9 IZQ?_?T5?_3?Y0?FKs?-_~r7Sn5?¢*kgT9?oɆY~~=>?c||WRh?kGQoGC~C&"<73?e p _-A/ZS*6ЇjV|Q3ɿ?,73 xGi/DkVO)zH? টm`S*7a_`4"*?F? य़[][O!iɿ? 73&&«U_g MFR?Y);?7Y~~Zc|9qWKG<ZM?QB? ?7`,?MZ>ڤzaWKE~9 [O|poXS(wdU$y~'RU¢ۋ|Q_~UF'p+mOZPgV @*Bޣ3 d*Vi+l?MŷP]|Nn*W({x?Կ~7t5b6ӭ".|Qy|T2~ۯO!3oSW|ԣU곈!CAK~_;_m6Ǟ1ԭuI'BmGjV+ "sVQ!Rj =O{:"COCf(!$yr t06s)`ij)kp% QkEJ 3j#$YC,ȮW UtZBуϰ_7j#ף+KVmeEhfQEQEQEQEQEQEQ\犾+kmkNq"D̾ӭLF*v*1rvGGEq?0C9xoU֨2~Ƨ'C9xoTHx/ /*Qe5?mEq?0C9xoT}j/;j+^_U0T}=OqQ\O4?r "^_UZAj+ڑW !7 9xoT}j/Ixb<}ڍ3~tR Pq# &>7g?ZS!cERG=/Q7~LTeaKRW9`}ac"N1Q`ioFOʚ|;ҷ5/cQMS$VZcgzcOh&)nʣu旱jl: u* G[mTn0*=Kf!З2M ?EQ43Q6smc"co?wj7{s3M =P=m0u Σľfd>hֻ ƢnTd̖jLnḑң:2 Ȩ.JfW:~4ZD`\T83)*?Jʵ.KMmiK֤/8\m)qңMRzsZp*&5>%ͦ/Q9@5Gq*kiK\?J i*}M TTm:~u'5OF}<~i;~ ~>˟L{ySOJ\Q6 L:z^#8-bbݫvJf)5W/f(5_ʘlqW{_Mf3֨o7jiSʆQk|E,~Z-ӏ^OڭvW+/k֜􏶨}e N?H_?OĿ:&ֽJݢ#Yz<^g<4Qש֦[.粧7'd{`Eq#?r "?<CaW?̾G;j+^_U0?̾Ƨ'C9xoTHx/ /*Qe5?mEq?0C9xoT}j/;j+^_U0T}=OqQ\O4?r "kŸ,͡nKFOL'GNNђoN֭3rD9VbȿV#$^ mK6? O_]V ohWmK5MX`0~=?]ѭ.4]KO@?,@lV\eI$rAJOQؾYOvk9zdF Vݷ#5y[߶Ե{_fNrdZ#k}94[$νoyX75@O?_?ΏIGG_~E~/?skIG$[#/}M o?S?Ək}95$A?k߂>G5@OgA VaoJMMĢ4ve魎_|9;E7ޖN୏KoX5A6NiuqخzHzGSB6j7j74F?S?Oơ} H߯Q??J5TFSTF?OʢT2)74ק74ר4ҡ0_L4}Ƥo(5 o֧c.߅J~Qv+24:iRY xm?*Oj6r7QJToҦEߥ4?JiRRiܨߥ">ҝ'A/pJR4"_\7jiNoyJq<_ Cj>IQi1?J?7G[B W\@տ?w?U[Gn?M-,cv7ݯpW鹲_\/!g|= O)_ʹeļϸ|Y_W[k|k{4,P. Y_j :,VHU|iWOծsW˄.k?<XN=;_O o?S?ƾY|~tH??:oW/}M o?S?Ək}95$AVaoS[E~| |~tx{07_ o?S?ƾY|~tH??:?ռ?mbG/?sh_,H??:Miij%j#P>_j[_>EM> c' 5  +rV/W׏)p6'ʸ5oV𬖫%\jZ ?S_,.pLE\U%h&]K98Q ɫEWڟ2QEy/ YTQVEYW.>*| Ő[$?>gce>@ |bތ^+ڧ_juQ=ƽgp矽GC<#ۃ/w}Qp{4no渿GCP;O|=ۿ@?GkhTn?5> jiɠ.~W7]7M:?S7_<4J<m Ѝ~wƎ!Si^"ĝ/ݳ㦿5*Y_Nͷ5kSJ׺׭dl_x/=r uv_՘Oៈb> [ }fD:Oԣe߉5[ RAfcd=X+"iؐ<֧?iGOqē:U0_n#'QWn앚ڿT~G0¼^1&4T_Q Q'? _af#F}G8zO~)|<־$jD2$Ո3X0η1V㨯jO楣G!_iru>>m>Z+G0pE~< /vZ+=MOTςY]dӖ]ξNZN M!ZN1 'U񧈴{;+[đ:)k?br>OqGCU0!Nw喱{??Z8G)0pBSZU|E>&}&ݣ`8+! #aNy3\h9.-QAIkL ,RȽ8' z0gJf`ɫ5{nگFyM԰8u6Ҿ^q0~%[#tvkzWS<7kl2Xai'\" |5Na {%q_Noivq61FT`W~!\T%U(kVLnf*uqPZ+iw=φ~$ O ZcIU$W"zѿ~ >Am ?O}+8 |vevlgxZRRU_vO.cQ٤lcmH88=м,⇅ִ]>Q!%NZχz|GHs5G q:i?wq./'(9(ɵfnSCt+7e}>eo_[֙ #4g"wGK_~7?+sZ4V-hY[T`ο/H?|?:W.gkONWEkVJS%?_?N}}_v:h6';7,9+*K^:tK-+=3)2L//c'44֌i,{w1kϷ}V*]O[WšyͲ}+~Ϋ]Ɵ?i#Qfo[r7K0$pz5 {qo }|@ԭ +BD~Z'Vb&ͱd=O8KMl /4 O2W|k8bhwW|mR|geCWIpO~&I&'Z[IZ5/ A9?Jusqs6ï5uĸ NEJϙ7ѣxʲK诧g7_\_'_׉UZX$rʗ#c{Wޡ_&a5C/?.K1x8j,䓲w}=pux]>G.JNn+KÞl:g[{xSJ<N0}q0$HR8г1s^*9'ugk0ܓ_F.J?bo ~|]4a ?d@M{-ަų*Ye5$ԯUo}yO;?$ bnnIB+vk Tb_"xx_IO aI|H#??W("~wU^w#'?šH@?_D?!`忉|=lGjJ;m/x~ᎦmKg̥Z9 W=S+XBicFQr8VM?ppj3޽fش^ =>h QC OS~U;R*\)uWK5iz>F8:Y/񧉼/kjjZIpcc|W=JVl WL[6=u$)5K9?j |F>&z~k޵1Bmx;M<+`k_tKǪI|!2` 8$WU*nrUbis])+9E)4HUBP3I;wJjSQjާe][-x"wk61^A?xSҽ1_;ş*/Io$ƾjb;ek]b1p:6 ;|I R/ί&R؏>q9e_k__ u#/m|/˨FjmlMz" i:\Gn5U2phQ]91Z> (P()ËAUɠE+y" _{V?a\C-6 ExZ~H|QiS[_ V~O%H [ }fD:Kku;դwƃ18װ 5Eumc 8yOVJ&ϩdm\}o]r\cH᷂,ǜ\?<+(;Ub';m=ҍ JъI/$b.7b?{-?Q[~l@~;Cn'bhۉ.r<}}2So?4Tmo~c"o~87hfs/徱z.(q0Km緑࠿$O^\>^I6^_ ԟ?Pk|hScᖫQ JW& G(~뗄xy6e Z]^tg\s }c&u+(VEM'S\~>գ0ZLm*N2=\Z#5B%Vj?Q*<;KxVs֟2ʄwQ>4?X#ɾ>J~?[׺~|Cq;Umu"g,~( Ů\ w_u>Q6Oot'ςWFon!겦N0s^)ӁUb!(4g츜<+ҕIYƺkyQцXpAʺۯuLzh۾k[uz_=R4񔶒OC6΄?nԍWal&i;[j}"Skc)a0Wvm#zI^Ri/w3+ȊvybSl#XB"PW^U11v[%V?2,,0WdEWR,6H ('+sO~˷igC~k*O>2rljnJPyn<}|WÂH<'Zo4Wzz/36:^lt.*;W]ц#j 夷Uцl 2<=e"g5W%kO:M\.:zKi8;s>(DE}ӥSiJ)6?UTp)t'pQB+xͧ??9_kATG Tе?j~d2Wve'ޖXq?r[f~~k?}~϶M1Tu_??/˲O8?嬼g|ro~ |m~mzxVG iA1{V7 ?d_/ ּDzs~ܾ S16\mZBaϚ!۷k6նzv4?Msy$2 tuè#ظ2zf8L5#{_WoVx8]LMWZ7 >#qS$-?F<[//ZWAfO1_}1/?DO2^JF 77ʫ{UǸ? {7G[S^AZuW qH?57)hOYG52z؜le U+s.wm~* 54潽WCTs'+n[跤m.q7C} \~jUXҋ/GZQh[е/xDlm.fvR)+ F]*aݫZDQ-uJyIEC8E=${?{f9}LgJ{t}+6<#kcju/+X 禋n?_ %EןYH _-ZkymRM|QcmBǸcFo>6 W>*dծUZ? Iu#?b#_3_0XZ[aZGa28*"qv|MG?;j2_{7ޠfցHqڟ|Cm?:Lc̓ʱFRx(ࠟk4fSM2P [SA^SG]or;J`+N' N:lwmυ8+ʎ vz4~> /t> /uZbu'ʿO?ȸ$~/g̎|e[ mCx'_Mu]}|cžc@%Ze7r a*ÑȮlOM^Ժ_I?֏bԿ{tR0|Uo_;9U[tW~Zxz[O;yFjAT_<+ 3Vu2?6>H/_o>|_Wg\᥄'5L">YC+iSM~2Jb:[QWGCtOC|7½~{W]&*b y'׭i>/_/^զ[gLvT^W@?b4}O+ :{_u>M"(o5\m!#8S]{h<3ϭM?e؃?WYO**8}oI:uEf~)f ( G?x_mS~6Z9%|?(|?+3G/ 5_s3/y_2'<  gl#y?¿x\ό?Ѡp# [ ]s2m@NkکkI?_fx/V𵞗j)oא~ȿ -lj a}?u+c.(`t~/9g_V ?W~?5-R_C6bəozѯn??i˦~VdeQ;6 袿?<S2q8ri'ms3MZ8I<<\VMt2_\ny$bf'$a 40\6/Xm>O O8-9heJf;jeU>Y?~:vk]]*]׺knCl`/\uWx캥y|ۼм+"+t+·2+j;uMt{=okJ5,vjy?4|q+(&|H’ZAE)Iv{jtr+g#ֿDo^Դ=N%TkyT0G>/ Lռ!gf)QDZ\~}c ާzzX_eYci-%tǖ4Z_h դ4.:/"N} %tSMn}oMŏ~ dɲ<p+ػ Bn#btP+kώ8rY.k<4WC/?8k7Y5Ĵ=9>Ʃ| 1}?4m:9nN?ղH?ࡿG+_i+O700Ȓ???igkYi{@EhX?w> xMKW6算5т?2Mj_Tʤ ۲]('/i!Z:kw=C(*4H_9ZV\n=4 sy20?_XlcW]P? !hZ}gGR <}e󝣧e_#E|M<ŏq#K1ym_#onߋvu#n\84уVhV??jH[|M NMwV_+_Le %8OuTm7 v? +3Tq^aQJ@|Ay'?LOxv0~:|.|-G!㑫wsXZm鸶R+5@x;Xqڿ$XF41#iQ~~_e9*,:Š8z qC^g5M㾻7|RU;6<$qk ǽkC5~"=Fc^?~__o-:kpltG]ﯵS>iG?v|1OJMon#ǥ~ƹi>2[Ey4H7,Ðǵ| |4Qn+iCGE`$zW~E~h:KXķҮx}z{?| E~vaGqXgxWO껟3”*QUUZIk`y৓._PUq5MZ?*,aY {Zz~=־=un?^oڏRT}cҽ.\bxCҽ(1_;ş*x]]BN¼gz,sԧ+ .0W}i~Xvki֨ȾS0_{|0!_Fx?WOs^(Eٍ{'5GlpF%<#sJ0M=~8SOx?)l E.10F^kt*@<}ioOioO_^hq>0FdOۯy#y?y#y?¿x\ό?ѣ}?LO?nl ?l Eq>0Fo>$>(Cg fYdRN?LOe8slxLR}V~|6_񕮃xjo* 08^I٭=6FH>a~?A_tGk|UlNWmvcƅ:5:}?1QEzǞQEQEQEfÖ+w&#ov~W AgQ۽U3b> Z) =gTY.7{3ʾ72kX>Âʹnc WOg\Q߭z?]gG-27M=Tג_FSaቤ٤ףW4ZY&i3놟~}Yk?M>iAYk?M>iZocUayg7kK~#_?-0UviV6Cʜ7N#GէOgK@5[J~~v>xҮ?_8?k? e/{5SoWP+_{'J Chx+:eoH>9h 'PݾG)y?#z8XyMLg~y=KVK, ?ZuoOU[F#A=jCXx̍Xw濵r–7 Mx&?19ʍEf,[3G,,$FSʰ_TPf_@>zeP2~>~?ůV#n' _gW*ui+գyG_i|֫#3974~O='AkỀKKGהaC]qF2kS BkvZiO+RX:sWMY/aW[|?{B&MofҞEiZig[fyl~*xCDcBVNGOtoj,V:=O!'8QN$u>+j&75ƫr'"$=p++ i [dG>b=Ҿp}ѥ+0zW_yG߿̸7mvij9J*66C_K;>t5Ӿhm{MM~U!_#H. vǿesk?nMa+dl.FXlѰ~lDRHHmduʑ 8{k;wL;iNPf{~Һs9q ϧ+D~iQIWj[tÏ _Sz1VOڟ.39mS w Fj}/MOPxFҴnF'OڐEJo̿ v 6OKo?¿JIK4޿X:cMq^ p$I%p*3"WOHt)--mmo[+T$}O^媳s_G9}mCV{d|iak;~omڕ%}kyWD߲|,Z%}}'?DOҸnKl_k's.Sw`^I񾭟 }~C_7묟}xG BjvhUmCO5 lFA^y֯ߵxS~"=.$o2ݽ }8=k7vO2elGc 2~8ߏuGp"c*O8IHGOxU֊]ᾦ)s%zŇtZ[xMZ?*ɢ_^ 8gq[/?1?k$&v^c=l ߭|ga^?GKa#iM(O=kSS䘊4- dU,]9kz~(IxsKwC(S=Ou׎'˫Xꈭ[[A0,zF_'7e8*l%h3JV?"tq=O%zvsWYˏ/k+@f19x\4=tm߭f}G53Ϯm߭f}G4{0߭mg4}G_mzCm-}œ+B vg>4wnQݪO ʄ|?jmcˏ6UoN"x_W~,_zg[|7ڪvP8yNki]qleRNRr(Ѐ(((wo5>ib&#+F5`ff8IN;? XcggxޏVOg?(Oҽk2/&dȿc_y/~}^  pߓG2d_1~MD<#~?Jdȿc?c4y/eGs׭ke f4u?[WFן(E i~ɞovo nX\3|$ּKF\v`o_*z?ik׍t{%\ײxY#7b^<uU7J+'#7>x){KM<7py_Z[jzfmwv0 DmP0Z3C"F1b+|!sK;&]qW~~Y[>=?ֵnxW+|g'$N_iik_u9ʯ9emuFE(}`} L~F޾ȟl~?PǪi8$ ρ??JRw :_O]_MѶd${%kb#7ڮV76n|]JjmGK-/h~tZ4wcTGNA {\U]h-K\Lx<56~5 <$HpLJ]BeSk]UO9)Yw0GPP3jO#sctJ !bڠf_\:MB*?~KIJɫnK}B溶GIa]?7Ol@_hk??4N5vKڟ-??5-q4OK?K`j?t6'Iƿ3ᛅL>?/?C}OIGm.c|QXi=?=CfAƗi5?yió|5uOI.4&~wy6{[{t>o5~_蕯}>!~xn.r[F꺞WV]Wuu?c4!B!?ƿr۾s[j3/W_ƿ3?Q_'l}?/?g?%!Bx'Yui ,r1Ɔu?u[j9`t"4<-.+ܒR-mw0qdНend$r11)ҿ[+f~_SK hv.+U[k#zx~#}ό`/}B&}Fs_}ڎ"֒y$2CFHLUIғդ;yMlM(M)G?n"g]Ѳ=UyM_|QG ^*ѪF ?m7 %"%/Qqz4yf/K1^I_W~J?_0Wgz~)д{ i?}9Y׼શWcb͇c}W~)ˏ/kдKܭW׼S}1գͺc2׮{XO$0^>?c^2ʰc l/ZdXhL8ɯ/C!%KiW&EC?  pߓF%,_(Oҽk613_ 'hC"K?Y_K.&K.$t^ >hϱ_^ t z78?AWGl>8 YG"Ä GWl`ھmZ( ʛeGc')6*zۗ[]}w*ZZ{5j-;|pޚ-5|U?k mV?ٟgG!w*Wfo/<^4w/Tv RJr RJUa?~+^ }{}j>R~u&b1?Rɍ*l\H~z3GCe$,E'AdSI}jYYGr3GRi4~)2To֤= 4D-Tr}ڑ OPh5M7iCP\v = Fr=*6CQH oRkЍC񩟧Pk>mJR*#1 }1 EDd?*ROʢTȤD|^x^#GJåBuj^#oԒTr}E~'o֧**S*YG,駭;YgIdr}QVߏ_Akr7QJToҦFr7MnM=*J[ 5*C*7H78xI}iK"40 j1ґdD~Cšzӛ4JqM~ 5%GƆ?+S5?J'!тw?U[Gn?Y,xh_4\l-FqV5}i5>?WXeSՇ>ҤxWm>x/ĺV=t^FtI?g»"3'tfb:gkdtφ˖%pOOjSCD43Qb_/_KF T佯 DR ''GU/P ?? zV97O2F ''GT ''GU>G/P ?? zQwS̼/'џ¿ IN?Iѿ|K?-†d/P ?o?y_򨝠M@OMvJ0+I5|$|PtR0;i{"v}]{uO٧IZ/Uem*;U7((((((+ /4|iCr1m}t+ ~W?ZL<"*%KUc>Kgg_ c/˪Gs"As8=k֮vs]#fݴ+U^!qdl%Px&h}(/2}˓*)ǹ~Wmgڸ(U?C㮏 {Bj祳m_ gYe+UVjIے{y(W]D7^:]k%\ײ=}s5f>*WAw_|?+`;O_u ҹ_u ҿ?|A/APߩ*̈u5{GSQI:TC j#U,娏TKbG/CQ|1Nk2OyyA@X/o#Nş_Mowg#WrxrQWXSZa>?G /Fog ?p,j~̷6?c?3> xU7︿?@*ch6{|fb?"t??AxQ7__-*+\Oʗf##E> ߲owN#__*kvSS?ȯQh ?g GG︿߲_q0j:Oʚ 1Uٵ)bh"?CN'_Mo'#WymBOʣmدͯ?kG% '/F OW?︿:EE~_)"?DAq54O7//FΗUh'S["?G~Ox;}q5~r6n[R~Tg?j??G?Cn;?_M7|q5~po1TҭOʧ>Eo 8q57 G!/F4䟕DU'S[K!j~ G!?/Fe?r3j:]oKSJKRo/j~ O︿߱K___GJKTO[RT[K"H)Pb'#S,x"ifDdկS_CVb'?憎?N7'O/E?VDt;էK5+C\߱7S_L?'xkDГ*q*_Q?e\~;?m}Eȵ1*R?eWG~Nli?"_ʘ֑S:_~ 91'//E[ Ǐ9Q-~_8g}N@ 8'1/ES G1/E׵5cTS~!qn?ދk_~~>"~^ 7V/.K `d$d3@W4T(iG8;z3i wƚ𮢐M=iZz`Fz_8J@}cC~?O㏉Cx3ҽ %/Pp_;ş*//dJb+-yG px["}_C)<{OZw-?jhe8A }?Ob=?J#ZA[xgñ&s| I&-DX2eJ)k> .kzŇ uvxVT35Υ6b(gS䖿žt=>`*Ҵ)ikf1IYIŠ(QEQEQEQEQEPFEPct xO2|Ta7ּkCڽ۫U-w:?/_+ǩDz㏤G)f47rO__g!Ԕ$>lUߝh>'>gkʲ}[:G{oۏ3Yrtu^y_gCjo bbdRg5kZ|;U@ޟ..N=Ӟ=5/WJe/:w?/q-%\ײ73^;O_u ҹ_kNY# z M/AP߮dCߝJ:OԚQd-D[9zGI/Cwj"¤¥Ȥ> MM'Adk3HF~Yvooo&Hwsc?~h?m牼=cE9c[t)Ӿ{ka;0Zȶ?/~{{' Hλ z5wkHh|l~  dg޿IO_5GǦƚ_M[;뻈I *̙#R+* _"~+U;V,5%NzKo1ƌPZW {h'OuT/֥y>_[vrsӥ{'_~+i;ltF᝹=k9feMVr^4g{OQ>5SVcSK\K=3&:><~Ⱦ.je`[ LRxu `)]RG7CQZzSKX_0́:g K<i)kK4uD>Pq!anOBM Z|v_<8¿U:o^a#`~P8\˿U%x hf7ZA{R߷qXoҺut29:4I}i'D*Cң4;MPc}֦M=k0#=iҜz_ Cj>IQi1?JJV\т^|I_0Wgz~Cu h6?0x_9Uٕ?)^_C?WT+;oE?ֿƏUn6Q+?,o9g?}f~v/V{Yawʗ_ʲqտ:>}[~>!VꮵGs]J,KOS[a׫&]*J1{ZG \5'_I[Bú (!^޾Wg}Nef~9xW4(/(s)ƺ܇QEEPEPEPEPEPEPEP}F=Bh&UxC ~S|n/e?XeVh&i V<?ҿXk |@\ދ]"yk5ݢJ}2GJ%9mgtMYsI`9魏n\pJ~Ѝo.8-+?>z+@? Aq__˿?F b ]pn ( Ϙ0^k5V/?֏?l8rvEn{Iy>_w?g _bjOt6<{(=o%_n_W#)Gi_kN7J+N[# z M/AP߮dCߝJ:OԚQd-D[9z3>^LQlE7}*3I7}*3K*;I}j:NPfܓI;|A?3"4" jCt_=6z_}x%յhجMzunҾ+im~Gd Gt[-bןjp:ю_Z^78|&º:ʸ a~RB=|Y 94X#m'FVf"+b N4{^`]GqC; f=5y/ 0JbxRCqlE(=-uoO"pg_ xj|AxoZV/l&0̪Ҁ˸sW̞/>94<-x᯵/x&9/w>䟭xXŏG?J$CrBK~fk}O?5ŏhwhDYU?//:7xA<7İio)@X/|8L:J[ ?b|#kڶi˨C5 $E@,9S+T̜9ݖ!E{?SZ/爯n kR[,ŽW$Bcz ƾ(+rGHAQ@koQ0G_?K{TOIW/pg )V)(zE_jo/SGOn&~ZE~&^ U8)Uxq|; \qw">ic;]?xVemZĭKy #ԃ۰[_]#X >W ȏ :5)Fg'BvWOKAo_6aÆu?'6s,?o_9[1_{~Hq[(,eT"Mt\@_Wzno?G'm.Zk{yVG WO3-x'_j~}]glA _jLda `uYRJ}kc l3n?~%gɬ kH l.* OK??MOu /n%'΅^W#o_ؓ=|7zVx.nH.A˱#J~?]x@ޚ7[D*aF{J Mlc{+kW߈0G4Y~oQ$F:riw4n,~FV"3_Z*¯(< gAY;wPBk%$!~%~Nk? /Q h']?ߍsWgߌ~֟h/[Ev:C"?PWY/eV;/\Uj>8!gz]0j+5Dϙmdǡ-~W ~ è8kګzefC}gTC| |G{)ojD..*$&} >'/m+qOO_9Zٛ~O[["5@ (s0}*`AVmj,ą5pr@#q_D7iiGK3J1zTRVm??:l|3f[8BO1צx3|u!/Eu5-х:öM O/_u\tY_х~R>(’?d5spLwPs ^iZ5/߲„5QK{xJMj؞F2 ʾue}Kkh:_[MG$w%Շ"N>%|[,WOFڗm&[I>~=l/CMڳK( =qXzqSwSjԋgs>|~]KVO>`\eW>T#DW:fa0*+JGR[QEtQ@Q@Q@Q@Q@Q@Q@Q@Q@#|xq҈gF~߰tg?*Lߢ8 :I <+ο8KH%e~:]7⁑Λ8 ~5|V~F}j6oFq_?~#ӵo$ #j^6E>0n5;&27 oҺgGry2hmՌB>xU濨~*qqQ^7ݟs BMԤ_zb^oQw`Cڃpө'<{1SQI:0?7A 娏T?Q-֙ޟ/Cwj"¤¥Ȥ> MM'Adk3HIs ?~cTƟѰᡙfhЃ^ axxWR{Ae G5[WVHZwexRRR~>O_e[+K{b~!D&U3xgKgA?d?5O ykQ70oek81ňMp_-w5|A*b MyC w(xVVjVש~Zw> څڼC,?]сkO &nIqIrѼۀ +o/?QCr#v~OU=W#w-wn&A#jdBբ{wR!?Q_w^ ?=ݹ<د?_ qV%m*M #ŌQ:iVj﵋tvYSFqVşύ>~ÝjR<Ѭ/\2/UUE|T6AlmmdX##'֫q# ̝)fNj/. a0݂z?* qn_k|PG c޼uUe67>f=*#e|N*2޸Lj<;Cat-/)RC"pĞkUX+Z qY"Epz"A]B}3_5#|&M+M֠qbH8|xx/M[7j,q̣<2Z _z7|3㯰Z8$ dߵy$4oEs[':o@Vh%sf\/~"|? m$=(x5叅?m^>4Y$Mt ka1 q"JAoeյ]}DF]۰Ee+nϊ߰3?ђc7g=k9+s~ I#ˋ:Z"4paqAj̷:/2:aOPi-ֹ(_;ҊJ+c (((((((((((((k_GQ/Y+y-n#=7R?#_kg~_ufWT3iO+PE~jt ?쭡zvb mExySm.O=LϘlu;8線;y7 =Aw{W3~(~ZxRMkEWȶ~Xt<WPXA_ ZJ=сVֿ/dx<(_|΅exߵ >)R,oכx77w5LǣZɅ?ߵS. XC?WK<+[ EyK:w>OWmY^DZ8(3-FѼWf;oz0Ͱ/woo?-~J׺|E<2~uFx.[ɌQ(|!MGMS̄1^}o3[CsO9[6gKLT#5g?q' 8+3`_VxTcc}c|B\FyccC,ϦvCr@2&2%?|_kE/<}V޺mSྱf̰ ) W:ƋZuk݂n_q_yFU ^2}g;?NOKNoTg ݫq*˚qtZNwϵFͺ;,j۫j棤ˉXFGݨ~?S$:j~jGQ?ZMDmXnQjK+fڣ}>5nL>\d+3E'bJU23sVJ+&F8ZG#t54 %cҢ=jjfZخIF)SVQ??J\HJtbSڂG2nSUw}ڳ'OʢTHJB:T5Yq *i `T/ZiGjJ}ƂZB)X= FjZ4D>H EFb_JYBЮ3izTΚzԖ@(n6HͽO(!Q14XԳWi٣^9 >X[ \'?a*[{='M@9[KU-}5zF+zYVկd^ txQVVI_qS_&5SSRb~h,k1W|3GZMuu1B42HRTp#n*Ѹ+q}bttOVI\DQir;,-FV2鍨ȿw!~}qһ9oUg~.|9jvks4|lv"&z0҂>a< +[5 JUpO^; ~ ^\jrᶈձږ_2cp$?JQb&OSѬd;kxWs#UNGō$AXyOߎ ǟA}pr-Gq׹|)R95y UlNt>o4 ՞#x>Kqmv_{8.Z<0n1ھt٪W>F;J0(B(((((((((((((NGUOZu"<]IeŴoҼ\u\}jb{kI$-&{7sV35M'OVpuށFiR׫GA|#'=9 Z4 7[L^XqF+~~nYoI6iƍ^ f] wqO9V}IUNCnNw˓#kͼO [:ݶszђ?&8Zc{?>L^ 䅊o*L}?Bk|gş\ZѤmx*b#'s>wpǤםև>zwv=7Z.pAQisck}ƛ'QNod+2\5}ʐ5}:CQH F&ߧPjg=ϡj'R_Ƣ~ccTO ~U¦E"&ƚƚ:T/V*S-"G%Fw$4#= FjCo֧c.߅J~Qv+24:iRY xm?*C_ӥF%ToҤ}$O]ÏCG obfϫkFP ?ѿ &m|&Rz/ :_qx{|KW[| ? ӧMZ /Dy7sɋmg4 WڽM] փL]:#Jv8ֺ`U1KM l(dQ@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@P0=RQ@\6JϽmT^}rRWKgxW/q^Fj9-Aҋ0eg u|k FAN· Y CY?/|k ZhX6S ͧ]&οX56w߹^}mt+ҼFQ|8M/oxm?"d&庵Ͼ+~ϻ5~-}-+nzћ^Q*$o󍯈 lǃS z}jNf0 N64G+% W ckqzI4c㚱:%9tT&{7h;Vh)W$5n{swu 2H3zՇKNS[0+5#+`<ꍹ7>|0>)G䲟QA/_(]/U,OdqeQ`tff+eG&V>]gΕKuͬ\=I|:h :dumF_id5~۲+}%-l+f  }]kKL](]U#q\d'^`sM8wŸ?{V7RuO%~U+Qxg.4[[߁*lƾ/k'%JW_|o|#qד 1o_I|CQ|\XM6M=k+?q_ n^?xsY37?Xr q+F~IqXw5nzhW5OơԮxQ_Ƣ~+j'H?AO?AH~D_Q?*dR"oiNoiPiBujaҡ2$rTmJ"CQZsȪw qo!ռϺ2l|E:1%ݻ/ڝ9M* MB_d/$|\G?.4?Yk{|rC˗^7N;?xʛBO')`͵yf8 ]Ïw7<9j@h_> dzF>yG>LWK|vծ6ojhasv3ZGwĚ;vK7&2$W'dG\ -y0W+\Ĭzc\}b_OfK/3wM_ F-pD&>1]UKڌ'`r9)=mdrkqjח''M8 I/- in[2Jg[3je5;ߘ[K!W°R@Mcw-bvw73Ad>u>U-GumS+O^M.OSέa)SMj_2H{GdDB=[5xǝq$jǔvlN42J|k0Q^^I_v"GjP3̮ln[eK9 &AzTψ%-]CHԾm zehm_澃 :?7+MlSgoC {u_9!h%#$F{v-2k~ζs ,~*ѥIZRV<ڕ*MmS ~*ч^fvn_澖5F}+VC aG^ٝmmrF=kd/^Rats j[B>oJEFʝO-D(((((((((((((((((((((( FEIERaWץf_"ƼJ(+cs \W?gkkBݣ)Z$QQ]$xU[oRZ6t&#i+k _ʲ mu5]ZKA>~ELt{Q,> ־݃|A:[]bڼO:i>O(昺_ ݼς|mO#8QT. :o^7>k~ʐAfƞ־t-ء"GzNMiV igZO+ǘV1ܭ1_G>/wyr}5貦^Fχc]1LμEƑ3tVbCY:Ūiz`fc ]EX)֧Q^g7L|>Gص+UO25ޡ=ִ3\VhFqJ|CĞ o4ōz?Ȯq6d4wٝNJ~ b'ùXܴx?y4rɒ=֟?V1V/+vo}ҹ2S^G7  XzomTMf>ӟa |Qzև(8HJ';o~} /HO2?+mJѭ1*$r^ȷfz%@$ǀX3iZv2)>p E f5aLuov ٦59]#ᖿ1ƍS~5I[DYxKXY'= `%]F!,Oֽ?ז(+.Ǘ[)/A]v[xy^u8A`Ӈ};dA^Sn~ݯR !w[9aOOY7Ec̭bZ_>J.c:hccۏl?ekNE{.Kfmjt+ǵvz'K=zq{p(+QHVUޤg~0^?V(vn-m@UmCWos;X6֡r=+ ٪}DK4H.oNc^m(r1Y]vB(((((((((((((((((((((((((((((Q@ hՇJTQ`FCa*U-AkWGGZR9־ޫ~*G:Z)½ƭQ?5 ?~ʐ܆G_Zo4iՁO־3'Q}kwƼT*KJ94c/cS>:~F4 f Wݚ[rW/x*?T}֟G4N_Qw2p~Q~Z׿bz8]Suhs+ WGV5j_~KlB~+ptwkJ)}"x<KC5T2Frt>VV^W{lZk3džoej"ωG۳Ipb8s0T_Ju4xѶܤngW>y9m=\ψ*uM'^%܏ǃWV;UV=*uQ^ ?MOvm[GW]2y]fo&1lWhO}bn $,1+uGO 5-b74PeoKI,> {kk"#~f >S:Ous,5?kxτxƻZ:K8cڽH/II/IeF~'}SO߈i[XB?* 7p4*eTѨhs:ok0?vl[hEh(bqRv:p((((((((((((((((((((((((((((((((((((((7NSQ@\θ3U~C6}b_SW1:kK߹_^xo |BKh.N72_k߀:τi4Bŗ!:W޷~6Q*Z~U2dfʋi, Zކʟ¸͖[y8VϺb;|qo}j[ a%9>kk ^R5Sq~z Qi+'{J;cj*J ֹbyo'D FVSo|iP7f;qG_S-m@}+fP(Һ9yOonWt wZ [@_ʽ>->8ԫj5 >Z*5mZxrp>EZ@`QG(sacB()h&EPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPAi[E%rSEvQD~Tش(VԫjuB1EP (((((((((((((((((((((((( endstream endobj 9 0 obj << /Filter /FlateDecode /Length 109569 /Length1 223232 >> stream X }|\ܲjwI+꒥U_Uڒ"7lll l0L 5PH ɲ8$!$@PB%`kٕV!|{iw3gΜ;Q!-#bTVwj:.އB)WT6U5]}DՅ(kj}c 1KbV:+~/#u]ז6Et G3wsNJ Dڷr͊B( ^y6{>Λ Wo^+A(D5˷nFۡr͆Ew"4[ۿ|g=Ak!Bv)nܶ  Ns|ňʒ"$eæzQ 6.߱,ֽ GhjQE $[ym&ڃp-_p[QDY}?*J?AF!·u_=DykD[!шPb:*k_}Քt_1 t/hDAX !a EȻ*WГ4"Z!eh-DOD#5w m|u7NcqOvTkѿy5l)?WOIfޝ~}y]3YIϬgV]?;I*I==0?Fsa>EiOUA:A4uH|&q ~%hδoJ:_`~N=;Yy }r(ŹPי%fþX :lBUsl=`n3ǐdVul?Qݬ=~aS"=ؗ58/ҾDU2^z( B蛕oY06fjf~;3s7*c+YV|iϸ}<*C.zxuY>nF!z@Jz=gAFv0:ɜvЏCw.f ڑG pi8^ԅ0rWjtt.q8{=gq8{=^r(&:;u&'\'֙gטgq8{=g3yG1\Q5K=؂";2dGN@!Qhڌv ݃BU:Ie[2-K%Rl)Y*Jf}} vb3/ ˁ*P#@9h Է3^B/շ~&>x<R Mz1 =zW72jXZ mv^r]FF,R!5Eȋ|(2Tj QZ֢hES JIRV*jQK &j:C]I]M]ON^^by PuT!Ոԧ=?> \OhtJs\\?~;!ɔ2+>Mxf̢%QtBjٟ7,(|O*>:83{:W#]tE=]m[u5Uy%Ey@Vfv9mR!EB242k\}Ao uEYڵ"'E !vzA{>=gr3BrF&sRJ{)*ʴ׸Ǫ]QjQ[7_Sq9.dpp@ {am} ֞@M_57$WYhH,S 6QiewBH(÷d<5W uT.Uqu \]u*PU}~*תKPSs*`z0};r`f'o@ *nc0qu`.oRзq61=[aWe)$(]%he2D6K<>V\0(NbpѪ id&ե6i$7nP:*mvҘC !fg4x`B pQ jw]=.Hk75Wcۢnq)vE r@r₮lDqWW0|o չ04kAj=|tbCȁ5}kqU\ݥ&{LԨjS9䢮hPWt,~Ba*{ܐt;KX/B.B{TWR&(r&qD q,pq&AWaY{.V?jrAU6D|_9(qUr_N8^A( I\@"*ݎcE~f|JNo$H_ O=!.!g [Eo?E ְ% IoJ_WH#xK~Jn^$8Jy!g %æ\ %p !vI`'0@`8fS%XO`XM*+ @^,%b  ,$@N h%0@ fM 4'%PG@ jU* T('PF`R%   'G @@l!j "IO @:4>^a} kX9/pH;+ 3TFz:Zrr TPPP:$OG% Pq'  gmOQȏ GAC'7c> Wx_K?: 3&a]! 5xsXW  aXWa]-k~G෤xTkRq"KR/HW#2HBǤ/xGúJFϑVT,gQx|wX zzhX[ k=mx`X;am;}$=$$˷HHڝ$v6$n%p˰fR&74$$uֶ\Cr^M*SNb8e )K4NY pI伄d8Q[s~YH؆! ACx#=߅!|·!<~A=-ZnMBnp# | \ WC'/dOE6a hm#uXEk l&6@ (Vb(&PD@|yr +fPPPP SF)) 1! Y 7c>WCx&7 ~5o < p“V aK(kXE~'! O`@JB #]H!0p F 0emZ 'B@F  D %PC4NFJBLD tSO@pI' |s` |S@?Aw!?Cxc^B Cx ~(!Bx8~!#Bs'4C`7u*0&O`VXN@/eXB`1EztXH`.Y2 dH'FGKCx&"#`(2"Q> 1¾ C_BW πO@xl1ۥTvIto(‡tIiH.]]쮔]xgt{׎wIS] |< t6pq<002ptx6(,;p481 nn.vK-[[(:jҷ\jq-ZЖ覮oꚿiӦ6ݽM6]~ &Ʈ77R)z)!đr(܃@,΅A4A4<#׉Q,:|y=~>> }1S$ϣG"1 HKet +h2_~~ v~~~@oП@>[y=돐=99I>\_Cٷ;}B3̽[8ssΘ5Ѓyh(_> &77~S8'p=OO}K=7YEID?$8)@Le\t 8> N{ P_9N;yn<} }~cb>ٱ3c>hb'#BS_2  Jjy2'7SJ.Έ.-գT/'` '?b ˈDA5F'3T2Ȑ)FvE\^,"ֈI)5#,n*i-.^2E (ۻli8y,2-M5 QptRr#4r|C g\N7" \u"]Kmge< 7/+]eZ8i;CcDJŎ5pUZ Ht_y!6$ӊݝPD L/O$>XGwb8"RU.^6GA萿|+c91Rui+Vf]7OvIXҭ ].s)ZC,UU5iG yn,UYE|F]VyAYƗɮ vT*9SouAS|Pjz}VI:⯬炑}߰_Drd#ƻž M;J-zÊ"EygWfp͵2T5jۡkM/R[&kfJ]~WwnypC#.4~\,ijdC:=4`7 2;iτ}7^0PD;DriKg~Gb/qR? pl{@K=>1WC2 mBkЧT Z$X2bo-kqaT?]0pA%V_GD1U?>{ύ   |#m(t4J1R(Xv "ˇzup򑂽|`Ձ$B@Acpjwn4Ŕ_3J8*ޟ2SX H&^ %o^: 'uHiԈ}k ~~[5&)[c0o*3+K$:[5+՜"?o{|h5̲D?ȌA"0(8p%{[n v7Gj% )1)Z!Ii) ,DsrV)"u%'2L-%Nًd/lR+c5X;2KͱbχZ2I}!qPOǩZT  Di~`fV4JG+Mʩaj@O )s̕m^qJPNǖIlEFAl^ HrmR1vuN䓨$|1ԺztT2;+SYܾXptS|ާƄLiA JHѮ8PI@cB^)=-*TWR{OdnRZ&ypє^ :4&鴳 27IdQɣ ӌze%H]MwkNi^50Rs KziuMd0٫A5;:ZjYCRO zF<ҀM2iρ]j_12NVK`u dɇGo\v陖H p,M2yowۭxks{޾嗴:M{co76t}_<|׉e-}vx+wݿxwwGw{br7"* c`Q:#UB0"B*zXR䚗DmIѱ$-`l3՗`Q4*;бm{gfl,Tۜ|3oC[Kc+'G@_{ъ I9㻎w#݇J5qJP CC,J4; 3S\ 8v<~f,WMBy /N_܃ZG͔Rq &$o6_I/ı-3ewAZ^5wѻNsu%_Y$URGnTj3W]',EL" .)GUkWV߾&WgsflGCQ,umk[zҀ`M]Tazr-~.U0J+>FVM *:A5f$ *xt6ԊfLg=-¶bO2P\~}tpHkQ1'c[Ǐ?~t` Kve}I2*5"9Md-:eGGҴh?ds븕A޺VT{c`iSTnF8|^[N5#4^O:Л߁>QG烌`5vQ״hk7Qj ͚|=:W6JE/XB^%7J)#"WEd W,;4tu%مf [[=YjeTXq@ҴF>_:Jm7ɇv/̎v` w+3XD7ck̻>Ԯyhiz׈XϵgV{`pYmS7dɰDD P@^CB~w+D'HV04}ؔz/!1ZDtiNܯflALޗz }s*AYKm!oZMƊTP*`~1B,&/""X5,UYRkR-C 4wg5X~!'ċqXYIlR@9<ɣbCZA#H6'"rʂ,g.Xk#*[0*Ze h~c.l!%F\.)b=/1<ސYL~۳ &bޠI> ؤcߔžG}SB}*XB&'c3΢tQFKg@ref6cdc$ Lb]`I!dW?I_wDMS"Cәem:O=Uv)JdpFQWz7zh5F'wFĖ̿!jmouS&[ZshMaσ!Xr[7kn*k"J\d.ߴ-Q1夘=kts2 IKYNKTŠ-_"ND"C0tO6 ,]ڻۭDGU-/{ƈM/)4́x 2-tx)˜JW\nм#|Ma%H\lSɺ2?뛷 XWɕR^WRm(H1;T涸K^SÎH~.^'W^5hnE&X 'co3@-qnG>X""9X^(RTl*E5y"fZG[ݧ=Qu0*Pgո% -(ZBO"uVWGVX;ʨ C|kO% 1ˊ+6qloϖ;bi] c< y塻&w^q;/m6A׍_4ORQ 2*Pٙ\3ۼQsbr ќi{1 /i@ܽj+Қt"Tys9+֦ù^H*`S]ޑٶerU0A[oymbh%`y;zpMozVBmB?$v_;>usmY_::՘k%(=T߬j5a;dK֤o<$Ɋ?&rj~l2yش|ݿ&J$HqdsT@*uRKԫʈx NVJ\USm,+B{wAgF%#тr0h{#|۞]4Jo7}־эOP/U{pKsVGyQ3@Vs(er>0X) rcun) P$;*q㵆.Mlb>]1oF}׬7k@IݠBVMF4)+5"ЧջE<:EtgdY6VdV .lAXf)[Z/ Z93K;VS487&SenkIMH֙B>a~yazs|&AzKDqJ|&VH ,ԏD0,JZX}:w%[90&'dfrpr,+`^ҭ4%I qW/WgpݙzW6lOJxnu4?p}GYt; RƑυ0Pdj2iS,62JnjeXvY%1F')+崊 RYd #?X6\z޲eK3{od6p$`h*YZQ>ЬPVh[;Jw}, 4E hiSΦS zU'lf_m=wuA' 3I)NLxex0M̯KNUb; EM(Hܞ6;YMy;&ynD0:&_~PsldFÃMm4BSo'a,~ۮmo^e|o1뛖65GEMjImPa5KA=&i_sП̥*.<xy o0Z<9*ng)7Gu֡t~ bWF~(-ڌG`i=8?RPQü cKc  k˟~͜g9xQ^`iN34mJJTM(o(]2ښi$si0:,΄"ɻdBT5hG4N<^6|XN(qYwg!ꢝ=,Th⻥&i=M\IIڎu9cnWs8˾ls %z@Ob%R% |eD(qgg٦Lی5ὒJ`tSV| cth}u%b}unU#ːX])jo^&2|][bJۣMyMjҔtqsbjMN+Isũpwb~7{GxJLлliҥv %pU]HW% ԗ|ޥ/Wl%8M`Z&],$J&Nϭz )_~AYN>ߜ|r&~ܧSir_oJ5=65A#dWg4;(JAkУnz4%6 IQK(  -;;Z̭xh!ZVZ9 s%}-teEϣFz!`|AVi\v2'W rO@^f~e;cm I4 j/)k Q&"v5?MѸ5ftڨ9o>~+X§ /yc7Z?9Jg?` %:T _*fF;M_[Z]m4]bL YO˔SdJMkjjZVcS\>euJwqFobިn[[-G羪t!XSmF9hcl S9)`1f61Eܵ6ylC8Ӿ1˽3Q( b~a4OLӸВ%b4:g ^ "I|AG?ܪPl"Fe=i/5Nޫx'4ز ?5嚲ήy]mgv -^ J] 7~F܍OϬ;M`w,#ܩ/dCϝH :qk+y^ZV5Nn%w7ʖD3s$́ofKٰ.Ia]r dS\?Z+_sB$J"d`+T3p`"zNΟS #m@ooq՚C6e>/)pcC'= eYYMd'}b{ ?K6i7a׋f ErysWʙ,t=C/n&Gh'ʚ1gLV/iJhԂtqLt+ U?Z&9&M(7 ( ~FjBLwJf~f$m_ȱbt=jڤFDɯԘw6-qߵa]lV8oZt,+O 7T\8zq@MuY-.,^&uhnmrHE;j-|J퓲`L[:ܓ/TU9l/7&SKmfTa bK&}FB0֥KOi?h]{?}>m57n*$)JUm⠘1bIFlGuDWk7+7G#FglkpGXL,L1Zڌ,(3, K3@GܥgM9^#Z菠轩o&iSy Pw `:*`EP`/C4R*}!G:J> =5;OKJeODCTڎѐN "?ҕx55,3c~$S#dF E!g]-6KYz6+ TyjZo7;3##4eHZBkӛ)A+Ou2fGfpw'm^="CSoq޳GaLdXE_zS%=r i);iP `gLkZ˓(Dk5"8]g4) gb^׆h[w7rZ|EtYzYso_.)Uȹ䝞SN*F7qJ%+IG.nX?C[EaxCmDq[xO:"t9(Kyctjj2N|U2)v &;&OCnNЗ^!MF;)@ %ZVo`QKVI^4},/UF1kgN?g8&$VOI Cs!K{j2)ez}n,i:Y (߉Z{o'Euߪ}}gzzf`XMaCEQI^$/KEpD@@ͨ^yQ11n߹{zXI??[U=s9֭[----5Tv+ƧdTB&cycDf`M<[{1=UT*x*;u]1.(j븇SW *:&Ru)%~YTKwTWEXh؁|GIW3Aw% "䄵":ș~-B@6F,-¶&}~8hKHbg_RpbuV 3CrYrXnf[[٫4{ݳjhoJmQ>ZBꩤF^k%WXKK_D0o,n[^;yi͛\ċ-:C&G =bsÞoگ(驅6z囂MMlvWe`&bqo ;{kxҌ*'mOh4DB=-L\ k6f3'4{|v{{j"/+Sr2{bjO_3s)-Gl*rԜBf*h;ojF۫̉:;LP*zJC*ߛ|=dz(1%LJΕ8{nسoOPi1+xuZZrJR.LA3h&`Z6ZbIhˤ:ȕMb\R{]y '+ixX zHlCh 7P騝PwbTGLh1GLh}>G7OPtoUod=Ɩ;1أU 'yg;=-{W Za5d>,5w! ^D"lC*y'HURvKr[dЬkx vgeu']Q,5.]YA6! ėo^vu*JrӖ@r1T 6_P+VfH#JS)TD,әq1j;LGڈY7޷<  }M|z7Х;!l<-5of(QlR/P l( |s@tDyZ#"~|Y*soλ8#o)c¢qhT2 +*ϋE2WjbʘES'Qc}ڌ&ERMkb.d`0.U,7ΈE_HR.җ+pDt|#uf1Q?qPYK䦊.JqZKЖH v*JcjyJ=4T{{V+0KXN=>۸g3$k;<[I>Eq_2Z;xi=6/[|fynn`-T76r̞ dP½/;{x-bG4f_YQ;<A%H $&Ҩ zFad{0FdGYZ⒝p7͚qV o5fo~^E.42O6NAdF M j3/>r;. 4e"H>P |A3A`Õu\v!ջqQG] >W9h )6i|?\Iłfc9=x F ȏN>RO$6ّz3 stU.~wuZ,cYRTZl.mEAN4 %z_HsR?h5p'b:HY )ДgPuO@a} )o/$L֖⊝*qplִSLdЂ=bSQX^ e xTe }Eu(PRE/2_%ta䶢P8nW)z^9)+Hf;a G/v3@7pj^DAf9ɒ*Phd"|5O٭_ DQ(5B03n@?^6_*AA^3F g}\?5\lKj$M%3pbevD6I֗g!cѠ/lQH+i j"q6;5iS( Kvn2'|3 Pto'WWHaNPJph\JAz)V$!̀Q+S?-1c4:RͣtrJ6w^c#Ɓ03J#Ȍ,x̨I较XZP%/_!U;Z:ʧULQJR: o3~2|ڋ:: uv|:+f(lQN{Ō֙eg?B]+ʦpb uqw:HHE25,R9"1cV9u 1sf9:855Q1| AZ9R ~Z$Ex%a[mG`S1cQFr~FD9ԴU׶Un6'*v?1O{ayZ[g K /^mSTފ BfLZHGM\K~Q_kly"13@~,O6.ܹ4ٰhYUCA'H+"s +{ɜbbrdv+ 1iu*ëϧӨvCI,}N&FF!ayi<=Ԭic#V?{QQ!$Z.Kp3J)3w63gnPen'3AYEKDuk%!!kOڧ!Z_t㏯G$n:F~S:%kh_m~F;nXp㒢…[-X`폀ld?=XBUQu=*5Z#]6,%i-YecW5H%}1eɊϏHZٹɣ$jQ>\^2@*‹5KvŶCKRc^RK4꣱*o{x|Ӥzi]M lJo%h3~-l[iikLb C*YjګxNdIPCZW |>qj^q;7\i[˛Ҽw- i̞bo_얩 +U=Yyb^3ؼzZeOZ)+D.>sƺ+[\QYXհfV9wk4:*k$^2%m.KM!+`d%S}VOCnפ5ւy3kfWhI|-]ihȭj_̫{ Dp>mj0p@T\ d.^"bf>)ϚOz-+~+d=pC!sjV0$䢪iy4TNA .-!/$V`H% 쯊G}|1;E!2"%3^P]-6+X iIh~dC+şpx_0lq{^$q 5d;mS7.=@},*$Š*gρ Sdf_sF!,s.B+AoYBYBIF6 ğ)#쯩1U3m^;x$0Ml)SOoY;ipqF#+X9ܧ)*W/39VvŴR,VinΕU{Z#wcUyxv؋'G f[[b^Z ǃ|v'X-dbN⼘㇘#^C9|a3 ~\ZmRTQ be-QڒSQWM 9XS?qJN}9`!9?bg#{j1N'd3gk{.rbY^+'\ɮiW擐)2Pw{w?_5[T:k[VVA̮pWގ{E0rƜ]s*Tߛq^}hO]̖mzKS+m +1|N;[mƛ֗n_ނ7.Z}` s ,բZ&#9Za {$um%G< XkvXf-Rk}5yrbPpM,.6,OOԱ<7 ̝\mFZ F?F2䷮+k_uJ@:3gf* ]pysǞg)AH*wej\Nsr"#&uҟ/GQ}qz~*,wMa{|&eB/DPo6D GܘDq8(1;~SYmPID)rglRQٔ|u:T/PLEC0d|&*Y1ϙ2;`%!4 ۦ6e#IRտ}Àиf_AL%$FQKoۄ.a^bNʯWXD eu¼fiWks&U jˊeZBe8l^DXk"^d3lD15Y ~_OCo y;UOJ.D!.ׇE;ͥY]*P~WEy cwϿ;f.a"|O4灼3Ț΅ϘkGUl7=F#1h+Ł@!OuLJ ~* J떫LG|1\vZZnr#s;cT*K\k5@~Y>C>naƖRA,Q[sj]k7GRk+TΫ)Q0έv:ÙO-;WQ߲T5ӱZN̓8eDV/?`lVOh:%Z`Ma3hK@[j9-^ZՖP1x0((6XUǪ NU `EG޹·`% u)%^!܀bxAgsSQ[OqOIB;-ЪDWFdmfX _hu ~ =bs\AboB_If-H% sIW6~i~?f03Z9@@;p3fِLԜ KD-]jO'HR͚jhwpLΩ11>)1%bF"6ؐ݁eƭR/ngvBo{l7%P»fJ6/4x~^6şT UIu\v^+"М$;l&[ܯLmw/i lO* /xk/׻̄U"ˮiɝiFWyNY-tV߱`7BxZo!ʱ:^lBϞ3}~_I (T31j^z'+`BzjY-69] f@"1}z'$ zG*?_pž&+%=ku F3og=B9b)x^WϞwD]x7 e7 (J=C(j~p}݉XޫUdZeU> tBoK:Hcv٤({\ oI$X%R3L:eZTڪoǬ\<.ssx!8+:sWUW6uX4QC(35XMjwU[ʼMx=.aR9uZ`j"0uj #tuҁTu' ֖r7q{u} \TTe; _35֚r+XgamIxQHl/VJ͈s&u4zZZ#l:\zPiUBSЪh&M-)5&+e Q,^мBG3:<&䜻SI)l}_~]sKݢOL)Z.3p~|H«nkR?N7859I2ΞW.+Uʼ%LN8ˢ.)<-V %J =F:A&VYzRZXeѫ*̨SɈ$⒊RPM3z-}. EKLasWbt^!\+n<,gb [JU)E14~)+|ʤL:E#>_{uvm3,F%5M2Ik.ʑk(khoA ܇C  pNR?-ʾEH)nIH-ϙ^1Ѧo͟1Kc 1$5æւRBJKX g 'mMc^ݠ6**.miTR5J.3zL6R&+tӔ)֊G@ ǘw*ɋ)Og痶X4}Kmp@+w"S@YȡXN$7վV^~oW˩MkݠS'-)N3H%RO19Nʺq2&,d{_(WL*  b !|"U s WH? WUy,6N|Ou_$IR+Umvh}Q$? -lvWdYs"A4fl`34[$A2&4B؇,A]>g&?{N\r=ˮ,}D"ɾU1lDv[}E)nG"%*XOKKDuڼ)eS&J %J/߷j9ԩ:9-K4j'EUW4#h`ٳ_t0t:/`$RJo)Օ̉l g~Tn>G,Df0ܯ/gE[Wy*cJc W65V][AiŹj5>MKj.},TY{S;`UJmEȔmی|Ƙ`@f̄Ce2s紩HDD*2knRޫЪR ,\x,&.7q<ޓ.9óՉp9R*-NJjD4y45(Jkry=Y EbHqREUsDŽv4xhk.yPtF/za#…¸0rBN cWxu"&ȼeY=ݙW/E fL2 <1_$BmSHjX:c6-II2TLϡwybnDo3$I-'ރDԮ'GY-ޑ8K T梨OLx+?\|6ށZ~ #&(,"G(V`eA?g (Oү_%>PPahZam/&|[ mGQ-isMҿ"<=`#u0 ӏ_^?=V/հhwׁ@׀6@r,}D,|.H p> xW8!7%Iz;A92C 1uAu 'm/&kx$<%\ OoKm4b- !N |'9I" H R=G/#pRh.T%EIiQRZ%EIiQRZ%EIiQRZ%\(ڠ}d.]pt %DKn.!]BZd i%Ezk]oI3]% HC!Rq8Dj"5HYYYYYYYYY[ } h-wĖ[NZ;Ėv_g פn#]^I~qhv$#!sRHٺ2挐V|,! ia5z4X !M# 2KSBZ'Ő6 i BE5\"#{搆[-eT[.9rBZwi@ "i^|3̧y=i^|3̧y=i^|3̧y=i^|#ȃJP2HDh%G0E]0z&H>aO7֡iD=@4 :ro9ȳuCn:Hu5֑c Cn(almA|8O"gvtf9{|Q oŸOiAU~S/.^;5io]4xvZ=89ٿ#ӽ=i_h_7]=<W{V tz{ut[5酬ku:biOg{{X9PXl4>eP`wnhmg?$ x{An,6ӻѳtk_9^8@28ӽ^E +t<gmMC{p5߹X6ؾ3ԇW!`/ڀ!{6j^eU_32P ǪB;:׶X\ އwZittz{{WUmܸ16s^  n]޷zSuBVj|{@97,\S݌.GA#5bip%=/ yͯTWq~hp~jq~!WR.hZD:dCs:j%=}͂ :]{Q+zh!%  x RjKAP(5rQTڨMfj)u7l}꥞g qj 3j;*OvQi-&N1jYz*,22^yaާ7173黙觡LN#v~/`58g>v҈qgŀJ~`_7}`? Q"`Ds{F>/k&~ `?[h4h5 /]}wc}oO!ZLm[0{+`_;z ?#y2`os5sq2cK_n^?{}_3ŔW)}>`q+MؿQ>j RKi3C^O{'`_ط>0`؏_7fC3 hw+>a>`*Tw>y"vv527;0`"('`;Wؿ؏;sJC+(m\t>+6/݀}`?/oR:h#:Sce2 ŀ3À} 쿟] ثB>oO{=Pv 0`16% Ŕ}_ؿ QS['R;Zj'3,~ `6` _E9-03DAX_C)Kmڮ.ό3R1J,Jό?șQ7:acdїL6>=v'OIEH*NK9$&Чkk^_>ΗzmH&&6:6vRI"Fiɓä6N%"ׇ2NzT_~z9j%'O<[IF3:xxI QId!H$OE=?ŊҬ(N$ed`*ŗ/'Ŝi- 4! ESptnAH'y%gė F}LS%wbɘirZ 9Ѩ'T&M.Ia+r o È )͛6kTlW6 DJ0>Gh3R/4`Jʍ0l0%r Xy 1_ddo8c͠DB@Rxn8Х Vr,P(0UvxfND M4bN8/^}±ːD6tߘIXYf{x 7$x Jm#Z tIƥ6-McDp){8dcBF}61Pdmo6#bNΤ8q ,Vtdۑm  [+V-qN\1qW]YO;Ҥcc'O;Ή).cg89)O߇~7@/.w͏~񛟼r(٪:jRJ!BY cY~A6\5 /OL+cqƣ"vVMaaq*wTqTqbǪzNL%qVX(`؛e$c{zPvI{S,=Geal3+X)Y+21r% &9&)((1>G3b~16J*1Wُʊ(V8C$MxccHd刕]7z5ۊA˲BqOniУ)x qaWDS"1$nLxg6*lw![Ow80$?%!L\@n߶۳`,ޔ^;|wʤLv6u[ 8pWZ{lfŎ2)io8$;xOћW8Y;\;l[⼵9)g)9U*Ul0鎇1 m 6~ C'y#ZlMkW>q8 p4%q8qlKzT f"ąW8X'pY7JJ>88=| _^儅:/\FX7rQ,JF8$!t duT)TYZNԀ]԰\9>k}bd.}&GLv7c?̽ |UI6Mp)" /H+vQQTAD.MZQ?DܥUܤ 4.R0i%M:mB=g&>d2s|zvbJݵ}olXfz;8y n׸sW [ .,DlOy~lpp;~ gf4ؚX!6X6鳸0)d߅ֻ|X1hgflV/5i[BdkRӑ'Dn䙥ZGTF>ٳb1Zx4 =͑BxG$޿bx4İoe̘}R;1mM#"k5/͖(5wޙQclR\fxm?qzaK#R; J[~~siW6 Z.973IS۝ӘY9)~>+-|+8vWN-ɯ"Ɖ[W/.v_ R4wڱ};-4tg!G5uag({J!~o#!{STu%? Q ev(t:>2i\3͎"iyVj4קAt !֐`DOk(k3Ns 7[|vRboJEEMkɔƈYH'f"-be)z~ijg3/M "+&I6]RB٩KM$k[&mVN|j:дyzkFڥh%~#]yX!6ZLchGjfdm8)5+GD~Fb6Y?!,@0dk-*2~&'3''='`َx-|+Eڷam "V@;ӿΊQ_/8mrOjݢC\)n|WR#簢; :dh-3mU'_ZK_,}IWV??ӪlmC?????x5|ܮܧt?]O3_g,Wt=Yx6[nj6yQxC| D(M|ɠ}n5Hdͮ_}/zoI}r{ۍ/O﹨fa֞l%BE*$rKFcm2wwSi()2jPZff]o0췵Gۣ Iظ'јk,LK3TM7梄Ϳ`;pv:-ءi7lK$nj,lҷZZ۴oilƖvcEȦṟiR}kUr[Ώnm+monm/l7mn斪oDos?ۑ-rvUI&Nz/mtMEFOgRYt iwI5G\ߴe`6nnkGfXnq&}++{~nV3άm|'۾A͈9ny׊Rݻlp3x6fb2zHxH{9Ї>t_*?^=3t9f}zNԩ/NIa# V@|ԩ>pc{_z#Lf38aɄu/'OL8nbė&nk鉁g''9&];&N Ln1&Ϛlɥ鷦?ezSLϸ1cLԌ3Ň^r3SM294Ӛ!s`ӺN8iӦ͟aiN_30h7glQ>ڙ37,qVYf:51{Of{twK3yg_6-Me߉{/#%뿙.fYdn_6-?̽-l"ݾ+Gnw?lɼ-%ӾNe .dϖK2\6asdшӷ8rVw.hO;ge#Q 2w>f}N>ެ"R:ui yՉ {|)".jG"9Pxdvjb.G<Ԥ2ȁGeȱsi4k(A0;Αڸ.nT2}Oj[OjlcE+υҪM_OߺQ;wihGZVm\v;0F;/yM R3mQ3WfD*%5qA>C}[O"khZ4r/h<n#e8ڿWv?,,OԪMS=uN4D+iWu!Rպv+QMjMͶ_Wf[6mBզxkҿ])mkݿ??.Վޗ4~?_iiz?lYWz[yѷڑa6^D>6Z9ע"ݩwSZݭDZz?bn[Gyfgv6={ю i{m >Zig&Oml>ZZo}#Z; -E?c֑҄QشB8S~']&UG?K|#/UYXq/_۳\s N ;S"?SNXص(Ewa䓃PW~a~F~O2,Ȱ!Mt1M{2V c%s|y%̐yL>ӢHQ||V!Ov/̶LxI{r ֟]2U͢*:~=)=Cz'L xB&+ir3`&̂y"İXBXb <H20@kC D[$~\yDW6q/&(tM˽u E@1(~1S*Ɯ?+J5Ljͷ/`<Sǜƌn< Ѝs׼uZr<.,iLI s`.#2Xzlf_ a0)m}ڪП7=ۺmxx[*v7g_RW"7jOo^՞lo+UJO*L˦%7qƟ3~":I-N{VKtTl+a ҟQGc1҃\{\]17 c$9ӟq2`8 ce!c7[2Z1^&3Ӟ!Ӟe2JTȪ~FlBɨ)"X{7DG2 0pD%I/+^^p@6' @1#q8p,GGE<)BP aX#\UF*2b&æB7(7/8( ΀*!AB\L VrlpE)5QS4lgK,erm jGGG!ɵN(̜3grfgqzyF}G|;\I{zFJf=C?߯wa꟝^p$yx&$HEҰSwYiw-rEo%sOv귃^1I)g_AgЙ) eVٹ~OIHUF=U%3df̒Y23Kff,%33{ !GGGG=ń[q89Tz?8bH Zz@On&H^n[?mp;w ?@w=p/ `CmYfX {>|Yl6B6|s _w[e )3Ia=iO.~ȇpg'&nG⹣di1oa?8!KWLKY㐧bZCh I2/dߓ~Yc>Oa#ln{`/ \-OjhȆ`| [`T<aiy!A=2@ EdYzYy@?u =g"x&2g"x&2g"x&2i4} [`+A l`=pHMN8,1-5!cZCh I$Jd^5g~KX؀l03d1g̜L6.+̛/Y.`m||<~s;8N8 n.ެ̬.dʀƪ3Lm+P!0 KءvޒrW#t+]5 &ɼ} X {Q$*`0b!6HDC h 2pklkhm$A{\ u`3y2ptp5gbdĞp=o$s b{}̌}K_P!cgnci{8`K_"侳`6܏'SbW_Xo۰>fOS> q^-68!+ KFqV-9~qTkI2=tоԢ;K-Ԟve;מGX1-QhLiOoHw#{^`" MGᥣZ˽֑ׯBXbxRX xVJXa oZxޅ}Xv Y kC?dUG I"yu%9Jk}P#WxR0^tX CB-l!d ![BB-l!d ![BB-l!d ![BB-l{p a(0yCذ#{>#{u̵ft /\ϼW>g^+y3|1 d` ̯R yLʘIpcGW3=xw̮ٕ12fWʘ]2X&d` ,e2L2X&d` ,e2L2X&d` ,e2L2X&d` ,@(Ceh 24Pe2BZHB8l[GH?k]u}t +ZWo4lu[Va1m@#1m@ih# m46FHCih# m46FHCih# m46FHCih# m461m@#1m@#F *wGYH<[#HHBG_/M)@vt_ ___̣y0Q< G(`X4}q=亱qgab 6>bbl\q16.ظcbl\q16.ظcbl\q16.ظXł~,ǂ!읋CX b9˩XNrbmXϏ8:^*7aJ,X+`%‚5IV,NJXяXяXяXяXяXяXяXяXяXяXяXяXяXяXяXяTb%+XIJ*VRTb%+XIJ*VRXɏXɏXɏXɏʱR9V*JX+crTʱR9V*JX+crTʱR9V*JX+crq#V c+X+`0M5h֠[vknnnnnnnnnnnnnԠSvjN کA;5hF\Kf'3ԓOSϭאb?̞׫` %뉸z"'ꉸz"'u=G]ףzt]u=G]ףzt]u=G]ףzt]/Aץ躔|D(>]"`)^lހ7ި}^=JG)(أ{bRQ=JG)(أ{bRQ=JG)(أ{bRQhЏhЏhЏhP#|Dh >G4#|Dh >G4hb!/b!/b!/b!/b!/b!/b!/b!/b!/b!/b!/5>HWzRҔVq%ѽ()O3092я~d#GF?25_"oGF?=n3~">D"=LN wϠǞJKY}h.zW>fq| uUgJ^hA;w D4@4@4@4@4@4@4@4@4@4@4@4@/ x_ }A,SeL52XTcj,SeL52XTcj,SeL52XT뫕:4uiݢ E_װJ atB.~Aji-o)VZAFYI-Y^k9z-GܪtWzuWzuWzuWzuWzuWzuWzuWzuWzuWzuWzuWzuSA|*O >ħT r^{9z/G ^+{z@W ^+{z@W ^+{z@Bױ3he܊'ɽ]nnV~h?k"9 ˔rD-K~O^&o6faMD.7=,%cvҋ]P.Z+b\:nBP, FSnx eOI)o{٣ ڰlϔY0ql1^%z&Vj^=w#Km2Y}_rl (/^RΫ'l5P'O$8dyBkhJq2?a.WY<ނXj$6j@GѪzhZգhEGfmѦMu"c:E-h0Oh(<AhwOAAh$AA[*FN%'}dl;VMc#{ITZ2m16t%^D}b+ZC[G#֑ϔrr9uN13'g)x $xpZ^rc:YVۈ6bx{*y2Gs@_wo~2K6].!*F*wzCd!$j=M):*`<}Gn+ mH$!Dd ^2/b/b:,c`5[_!K~fHe6>>ÉT,ca㲈N"zGCl8AC[9Tb~hm~mA!glY!=Ky$>cf@,Vl8!ymo 2; 2^;Ip9t+8_ U#ÒfB"|J&['`l,Ƅ7:"#j8j8j8Y`#jxZyqg?X;g'+I #|C&ȞLdgy"4QyhCn& {׈1'׈Dvmo$yXdVZ's7s7h ϣ3T%`yTT!S^a@oca{^r7Y}7Y};+`5[>W~O{'RS<7Z>/?/?i|4v[^4~uZn]$#.@O؍|xb UbUb_Md"UZ-DėdhL]f lB6>#Ȳ%dْhV@f%YsdɢɜGȈȈzv zzthb%d~X.Y, ={dS ٩TBv%;咝rNߓJJ%d\R.٨lltY,EX ]N]NAN-Zf("3T!*Rdd",U ",U@#}D>"~K%D{ ^B%DDyQ^DE錵7e!"*ZID$YDMv݀]7` Dk66ƦDD(a,lEhrW+" /Z/_7סl7סlt@W}:l@?OoÛtd!w%[q|EyWk{[G J@2/R `v; 2 3:N0&l9l0 8!:q}]nuPO3}лq7Zp7g[ wӪR 5袆;p\KE w5ܽp"^KX# a>̝U%}@=J=JN{{P9+]?ѿX ]D2Q#}q3N_X]s $ #(D'R8C'8$$a>"Ghۖs؅p^wN٧vfÛ}xOYݶ1ֿS9dHtUUBF3?YI,DxFF7Vu!ztZA9h:ae'Vvdߏn9r^ 9 ȽYk/`f`v] erZ.@h-4\h[v Z)Dxx}<+zCk73jo-M:^M05 U0-p5u:-[\^jjo57j:`5uW-4;t noY]H ~kK/*S~}\301)}d+b?/ܓhD7:]yy^Mc@I;JD}3oWJ}\^Oӗ|#\]*i%w;.F|{[N+pN)Ȅ;JnjjjW+4UG rv]|>@+h~+yJ>z Xy}E s鹂XAz *HoUÜ s8Aaa6_r faD>=ގ3cgjߨ*_@N GuV tx֡:<+a:@qtX+1tX| tX+Dv@k'ДMy1FS'ЈxІmxІmxІmxЄM@ A 푳ˑ\ |9zA_e3y 뭐+wʼn,NdqV#9Q D'28~8IO,?21fLG4՜sN.gԐ, Zz@On&H^n[?mp;w ?@w=p/ `Cah) yra=cz_.3pN8 jj)ƴbZɏb(5T.sN%Tep xOKe@1ec;@/#GGa\jY YPPR!?A> >,eQ0k,k,;6HD5=KM z 9?f ʢ8ƊLVxe5 Z}0 x0Z~~~.@Sa܄7o›7͛MEiz QaZKa,7MXDiu`܄?9*1DWN@)ǽ}Ji6}9jMoaߏ x Fgxgxgxgx"DibLcӤ]R ޶ZbB[u qn!-0sQrYާx xfAGtdAGtD<|>s=XЃ=XXJm%ֶkEZ,D Zqp0эĀ, q`x_(@{Z||->_u:)Z||>~>xTȁSr]EWal,nǢ۱v,]-.KSoQ$o=w˵{*`&ʍq%0^D6AyTJ6Ay}:+)aW.Q9%w(yHVS(??#t42E 0 `s%x} f7*r3e-e-e~LhV2ˠ tײ z>/ג?֒?֒?֒?֒?֒?֑?֙%4ֿHſ_n'Vi%M .[9yV ѴDW)矄2爜l"'NlT9?D{Nofku\eE.Lu67VJX+qc%nX yoV*X k-x;.Ǻ!d] `6́̃2 UX5X X xVJXa %ٮIq]E;D))&'t4H6d3o3Bh{< e5@Mx|]|]|t>:NG' |t>:Y2,NLϰ Yx^]u`͌:M"""""ZɦVlj%ZɦVlj%ZɦVꮗz^ꮗz^ꮗzɼ]ȼ]*W_RUJU*W_ r *PZ~IfFfFfFfFfFVGVGVGVGVGO獵wӻnzz7=MO獵wӻnzz7=MO獵wӻnzz7=MO獵wӻnzz7=MO獵wӻnzz7=mHIa<I%rRT"'I%rRT"'I%rRT"'I%rRT"'I%rRT"'I%rRT"'I%ra-;XK`-Dk9%rXKV!paa٩bT1ndMC5F5M5WG8ͫ9.lllS>W&ˏ\va*gYr>U9*˨tguԟsψ*g٩rv*g٩rv*g٩rv:iNG'I}t>:iNG'VKմނa-{DDĺ+uW*jZV*jZV*jZVL>ST3UL>ST3UL>ST3ULT+0Y8灘2ϣ2ϣ2STܬܬܬܬܬܬ<<|}/хUa!!!!L5GQdH)2n" uI8$H2o- d]ӌ-Y9N:'Z8pkwЁ8Y`=c'sX T*u.euJneoy FyTx^S <s k/kAñXYC!T"MJce=PYO'TytAV.+T:ytBV*k BemP鐖!-CZNr/-z/难kF״nirmtK薬ݬݬݬݬݬݬݬݬݬݬݬݬݬݬݬݬݬt]N.']Iru9麜t]N.']Iru9麜t]N.gl s9$GS0cO8x^МthN:4gY9#S^oZ"lqɜj}PYYZr4h_y=U0.tzsy2,v:>;Ngt|v:>;Ngt|v:>;Ngt|v:>;Ng_u|90J4To'Eam[e++Gr#srR& irT*XKz NbIcȖyo>60dڳKwr۸ LZPҪd'O)}| ʏ݇rwoE"VqrFsb%2"ᘋx3l s;șiN'gW95ggs#\1+%:yX*X8ANٸ[N1~+~Z֣WTF$ϝrXZB}-JJԯF+5&"T A4Ef@,āUlA$} U:E?'2 UX5X KNMn9rH b 8B<$@ NZe@.1K @.1K @0; @0; HEab0fls%exL& V|r7ðB4.2XŏXy#Í:P6zsEJ}Fѭoܦ,FF)q,&KXdkh6ML6oJx" )/TȄi0fLDok5ۚmM&z[Dok5ۚmM&z[Dok5m"6ȁ\vBݰ BSbpQpC c c9Ff[ p/~,25GNGF3nj<9?`s nf>807g>8*TC d%ZB;oIp9t)}`\hs`.,abf_'^#b]FP^Ohx 5 ކ 2?NȢ쉯8*G}> `%9JMƴE+s 0/ܯ=9t.7>z2F#E#1UF4G}G"gp}Q&6Œ-\\\Z[zqJG8'zhijca%?Jf#g , O_Mm ݎȣĜUy|$I11JGafY YPPX}103lz"#j+(>y8ہv|\ΎchW*_B.2ahWNB%fβry\xB\cȋ9Pg܆^$F3` L0q2'g;OqG}gdD{WmcL Cs0)A{=d$e IE$u̺kOe~*Sd$#m v)S][GGVtڿT2?Oe~Yo*=+wi3`&bȿԝ}qVhy~_/*2fv P|ج\z>dmmz_4gL 10}%Tb9σ6ب4Ln+C6=+)zVV93Ef2c ,2ZcJnϜ7r4̑)Y`G0j,3s&l0яpfgޤ_Oq3Z~S'Oh7HZkDɲhřKRyYϕse6UDW(A=#}H̷$:62J-40J6gޑkG#pxPԡϡ?ngbQHK,¦8|D#/L GF>ǜ^תfc#j:).ϔd)3>-RJ~fB{'vc\.o!ZNj7}E!bM\Ӂ5ݪ]p5ukԆ1.+_kS[icux'^wuWlUGwϸJKhżbojÑNtd~v3fGǸЉWyg]9ju5#Q|U0Ɣ %:vkƘ?<" 3附B!CYYDDDEB^L^3w2!" FDdYYEc@fAD]9]S]U]S}Ll6OmGh7bBٿ-|G #w3G! ԚVXe(ya(sQ=}A(cɏk0 G aF?F8]D3;*| ZWnO^ݨM݇OgMtZp^>VȹA;AmV/cGb ?7d3n`  q$ZwB&Z[R@;Ƌ@5> Hu|7JoLj8?ˆ`DLܸ#J i<^EbT$ P& Gr(w3E\GX<5?XE/BorVVу]kh0`a"yTHzj% lh^/zK5MV7} pBHObsI{Ƀ;Mܿ!)dJf$l m3d%d?|g ڒZ!LB> !~aB+#_  N($o`#0\` j$,.KX.6 h7Cۅ4 q/wAB_:!^a' h:FB t0&}4& TjF,F\Z)H5>HK }Zi#='TZ&-5>h+o^4&co?F&5f3uF)l7K덅cqqqAsotɷ,Cos|7j|3CS`;-݆1ZAeȊere-_˗[jZUi30m6KYQ\mI[-c%J/ڋZkjgD[l.h|D"5QeL\j12)Hf 6˳L!Py))1EM%Tj*1Uf4͕W2=%`z9Ekl_1[ms {1 IGrC>a*, z.M'+:ʷO@-pUm ^UkHٯ fVl wHgd!Q~M?Xg5\[L?sy|iF"izzvMY-{o[积CE)+AQ #OﱥV|RBJKJ>ie_1և72x|~u Y\ֽVld.#V?@{{OA-{_c̎3 $^^߇6Yzok?Gl/1^x%b٥f'̆~!U[>պg!SyjO C_dG??7P9r]tuz'W}s\g_!}|ўŻfNXn.= l\UlcvJ=snCͪ4|񜽘6YټWchC3|sa|}vjk/c&.ޏo,f}WWn6cI)%)g0 F/ҋQ &3 Y"I8N|ʼndNZGӆCyG~I~_7w俲.=?"(#?"D>aOI??"?-|Af^1/J01/J03/Jg^(E TQ5cTU5 jƫ-ԖDZHTCP!Y SÅ4z`U xN,xHUңB\y} |g hZ^[> [v3/2/|8pq|N3/|8pq|y߅>f_*[[S||n>v#p`BD%+`U2*V`[Fn[F;A_b139D NNopaiO%H9@"I#Pn"Kۥjuj:`H= m =JZ`mpKm-6R[RꤥH`W iUa',8[p,xY|v;Gz"9[s(JǥDNJgTOII O:']"aHnC݇rv *AW[H`  Csr/r)ÈܧGTe8ΐ!#P'>rpf#;3 ;3ֳʳ^y,Q erV*PEEje-F%sc*zzMym&Xr}|BnR(aL)'/Sr#rtPV*usR)akҀs9=ڿ\@hrT~P~F2! G#h4p8 @GRehB$&D`hB4I!t3L!"0h'&ߏ|?"2|!HKvjkv\;N l=$//H[g3(5ʜ΢̷ڷHkߑ6Zր2(sAKWktڄӟd-$hI&/#ie5f2 46 H-)eL7@S)-7E #MHC3hY"zZ~޴mOҊ! H ^ElBH? 9|+^ECB6p܌HCcQ89ñ/c_k}p? cH' Yv=]{>@(GFȘ͐ȑQhhؒ#@?3>?Q%"m_+%mŇŇI;zxO' !`(G01ADB}D]">pkŮ $"5v/42ccYk~~0,G)$CV|8NP')Pr2:YIfpD"]#D3p,S<%#Z>3DSh%H{̭LE!MPfcL0tS8zѭZ&"8c\n pM"e)YY,FIt"G6͐NH6 MQ6*o t;4õ@k8p\ ֚Z0ǵ6|ooQ[+n9%QWT<2j,0@X1K)7#}P)-&~7#ǎsH׾'fF#d&$3B!&-8^R ͐"eF43CM`D{0?#Z#AϚEMϣC .c#u-Gӏ2orTAQ^mvE0<2"+`^n]']^uQ}~uks4t^QMæR?=k>,@cyU׾'G#?=wzۻkgmry/~x\Czv-y|ݠeYx{Sݰ7t&Bx4:C? 9ѓ'*_~~Γ{?8?cu®ԩkioߋH]mvmKV}5)=W6zQ~Tvm̮_z Yim&H_q=S_A>{RI{Cϝ3}_ϼ|}=_hOבה;P's(_A6~k7:4޳o>k}ʸ~[z>@#7-[t `xq 3/k!&;|l}Qԁ)m1ps{}kc#R6 v=| ۉ7z_F?V5O;r_cӬ凮0ϣWy)6>;Wxleoz;0e'p{* Y{مEM?iu=/qsDqEޚ{H^1ur|c;ûn}LǰzQ#oz nOzRx5ŕj1 /{=W|?^`$=^}zf7 ;۞؛>DϏ~9dج5~5u_fb|\/4OyΣec ?u|z>SwQxK[N+ W?2@}vyk͞!{M^~/qo!;Ͻހ=>@x4r= z]E7v|ws\~z+7?\׵Z8GWel??W=;m~U28v|?~h p{>Y33}_z| #7fcqu|>Q_G50/<9wFi>%vo`\O/g~ϑ#k~Ͼfq}=~xtC:?70~-FeY9r2(77y567R]ÿZ{,=S kXhy<ϙW|<>PYpr/lO0o)>e6{+o]]f\Oa޻r]tE}5,};Zy^:z<ů}o=~.=5=o2Jrw_+ 8JU?ty /~Gr獜_xsW]>Cw7~ji+?}~ىbbᬃ[߯7n|=^NxߡgTe={]{Z|X4O/' Vnm==*'"wp'nKmMWA/5Ȼ|uʧAߟ3p

!Iogxhax,̢P;{T4OU櫾/-TTZD VPNmGj{5Nesh9C+X:Mv(:tCcQtt6CY,$CX:t>CVdZbЅ]XDEԡϳ:t:MFPge,/Q`uJQauZKbЗY,ҡX:UKndtk,b>m|B,}EѡYEšﳨ8#GTYTw${CȢC5EdpqZ,(#dp,X5,<#.apx8mB#ox86G|x8nGx8ڧQSFEh6,5f#ֱh6bU;f6@Qgl$j>g>' Ʉ o@"?O̭-ٵ5rI[ o(QXґBT1!}1i4n&h?`#h{<^~%vKZ<,$Vh4Hk$I0;| >vDNM"܂tgfk]CzZ Coz+nB P%Ti@6@Ia$M +Gخaarl[dMFn%@;8R o,_2_3_7o?9rm  rJWH8]Dn=G䛀_.܁r(pл7wCn1`F"Ef9RGI'؆Ĉ!bPi6jw;°8bol+'C84p9==uuw8%U>\i4ҳsXzVI/`Vtgsbds10 ]L@nL  Zb2|hH3A2Baa>1|BTҒė(sp0|A1|IiWפ,if;w$`h wΡW ѓ #}p鋆$(SBe@C *}d#1ɾ/eMHlM,Qs\uV,A-Cvh9LCr{9-t;|7(IDZ1r oo!YL4*ߊnhez=P66bd"u|;{q([AS%˃"#߃>/?5R~?"cev)lI9CcI92pCΓI\ r1~KB;r)ZpnP&r[+ as3邹y6.WդIku<O8I/F8/A?'/&z(Y-W@a*y(&Fk`:y,|Uވ˛ y ~#;H+2;Pf=+Er- ??$h?!@;'S(%#2 rF|9/_" 'LH$m@5+6Nmt$h(ەJgtQn%w(ݔnh%{(=P66lUba/(GJ_셽C*0Bne3B0 BBkAbfZkVh҃rXK'ptbR3LA]0KuRiF> z6򏫏,ujӐn4s3OuէOk b,9ujZVeuHuHvc#֌ 󣏿?Ӓ $|Z"wxOO iPPVD=HQQD6>d|H7ǒƙSi\BƕH9! 2`N(@/ !"7a"'h'臵I6NGn!~xm< &hHœDm"m2IZ'k(m J:h6͆2ZdiYؚI;pj3. bV+\$\+(9UeZ9X=L TkOhsPf6}G;Oi ~Z{kўA ,iH4|#8C-rm9ʬV`ڋЫ[5l[_֓N+伪0Eh0E7-$R{Sۊ2oi(]ێCnmDZ-~9}hvOOHwOQ(b,t2Tn(qV[LL+ fzrfI ?c%0&J%1Qh0Q™( `L Nԙ3ѻ8zk6c&w,&)fSrNيs )E=02z`Q ވ/,ꁁG=0Fxz@Q < `0zϣ Qxԃ฾`&m[,$sܞM2{w3{$$:B> e.[EzNCQQg\/H_u-KKNx[}@nDUՏ3W G%%Xcq<.C`>not҇E "}th;p.{3]0Wb=t?smc=CಟOY܇'#=b "W ,*D$!bCDы,BDm:iDHf""Eh@Ō1#"D_9~]8cm1ۊg܅[1"<)pHpۑ%";p&M&E/GIwΡGr#9{ y.x!_ @,c`qY̲T^N_Bs6[^+E-)c9r=fن3˞YߔPmmg̲ g=9͙yZ`痱_/9 ɇ1˜|9Y̲gˍr#2sfl/gͤ?wrN 8䃜Advvh ry_6Y[1x+x+fx+oŠTFb,ꊁG]xԕp?Կ!} $AM@yOl*! ! {xjZVQˡ:5GANZ3? XVCSg30 q* C>>w-ɽQ PEu54j=Z`C/z8G%c1"m§3/NE ^@ }Q |܋hNËEa ii ϡqqr&'>4chm h"y3#;fa= }M'#!ӸHܗܗHtО{sHG:CwjN0V H+g~O 'LGΣ:qo83?Im.΃~Sh 7s?=:pC{õCa%_V[Ѝ{=p< g鬭֡++g~BWm#.&mnp+ npm.v!y=^dmG ߠ|Ch0XF@Wdl :c 3@/-*8qy!ؖ웸:tɾ l+KL\g[Y:|Rۚ#7fAo8ݶt]<;V֗ƶ}M@Tr嗎%u`+t)}<tft]f(̈&ݘ] ev-Mɶ|13S80BakڠB;VZV'[\-YBW:µcJ/vD຺)S8ߵPfVI,\MZPMiw337A sk U:=aQY\6%,ͬ^gtmb[KOOqmyiNؔyU?+}qƄgIzGY6K>ldJk/s툯I_ڝp4+dV00Hk] DbJ/K:8IuO/5: k8tp(t٤ȉ̊/]*}褘$nY\''LVvR, ;Q~`V.be\olߜu&~[~mxVY5#͓f*IL?쪟5&ڒ :+ktnZ eYKwNt90iVNOAI?~ 9R2&8XI˲N?~T*lg5 },_tӣUf فЛCeHmʎoG]SK?a.&ܤp?GߐX)#@v/]֓grH3K'ڤOe>=Ԥp.e?aܠ!f'KTS6 ~̓nm/K /c3[M vY)ew;gpE'ȮvE+{>ح;$_’@^1w8;٫];AcܝGgodcqۡwv*ҧp+!Ugծ!렇nsUrU, ܖ]n3,T $zX V2/]LepHgqJ>2&O,OȮ+Y8#4L]rJo7I\hwmJ\brM\n-ْ J\gvHh[r q==.q};!q}0};%}ۖx>m:{Einy{"ў'KBh orWOtϟj^89¾dr}{Փc+뼜e_ϹLw7F-طනeb}{퓇kݻ&^GKNONtf?tddtvUd䙎9 aЋ%'/u@ttC8zBwqhw ,>yc䭎86w8Fym{ݎh|Б>=⮛|1gYFv^L&_pO5rDe>5P#f{գdIcVɖܒISc5t5upR$IƇz$S$8ONLXVr<5k'ׅ %:6Ca֩n;yԙI;]RXh#'ޱZz׋Y?u)+=:)qd&)qk;9u}R+"qz4q e&&uRwI@ŤyꎤTLZ GW9&uvz0idfgG9M=AS$tZ9;is IƗ eăIǜ)er)LK:봗$58˂.10Iv0xf۞9::+0c- KVllvL*.Lt/Iq.tMw.)<(j%\k;;79ݹ-pn<&rbs>r9@uו LNɑ-zUœ0d c#׺;'Iz 63-ۜ0E6w2Oޘ3e{ޜ%gLD0 ɻr<,ݙ\o4<'u[r =3>Z.;| N%ɩ*%sfB#9sxf\7p}Si亜1O|>gfjƜ)RҀ39k`r֗1/:cΦR9?gks:g)9]-YǫZr OGY FX ϗY6V*JXY") ]\Z5β(*(*ŲkͲ(-l.[ ʷ,J)V/YUa9\4汢U3,]AEiUPʰ\*rVͷ4dEU jͪEUUK<p/*OEq7=NOV5Z]<:xx;FuapW ?^5c4[Sбg7qMaŗmŕPWm@Zj\bv + tŦDԺ$9M9 X5ds<<%.tsʀ SwkryTʰ\3t#s{ɍ,2>6%͍Aˉ,ۧ|hLc/܁#R ƖNqC .*wxyBQ))srǖRƗS&0]pNYkqEL?\^&7|FMS斕/Lّ;zk%)s/zuJmnM:s@r`XZ1h-)'s7oO9|WJ}})rw`(Z~$)?*w-HrN =RsOjܳua =3GƉyBHs/U=mr}OS+Rcԥv H^#O^TEtnWꐼ]SMׯ".ulޠW7b0aIy+FZUIKRZgHK-˳WdN˯psUͫpͨ8o~Ŝey +[R:+umEVW,MݜbWoXc-TOݙbSꞼ][Sؑz8@cyG*jSO8vNyuGSWLXq&K{|cE}Jt>͜Zq!-$?eZIҢc+qZZiWV6(ded19i#WƤO,%i*"3*;l޽ݕ=*Ϭ?=kk+A*o_Z9 zBZEʱ+T6#kD2):w%m~~meViKV?Q,xiTNO[__ɯTrRY.}Yb8F(+ώck+6_\U\I!vmtsږRҶл ~]%kTdN(i-!DNh T \$S@eC}F|?mAL "~4%-h@ZhډgHkqWll $ fBn2#qdyE|h@'Q2CALDV тʞ_Z cd!TH*J#   / //N.9PZ-IUңB4[-ySBP&V Ӥu+ uua07G#I#Sq FZZX$}'cO K - -eABI*|'. ٛ .%(-Oȧh{^BniB(Jk}^RBW+w*YViII=S#*%?8^ U6(oay1J@/*b/ xG?5_4__d)Fb[͐ jJGU֪:::[u>YTWVW=zz5ՋmܽzxIՖ+ S`gGX.D|b05%2Jϋ }@(]Mү׈?/*{Do:нt1'E5~J?%ft~}DA $,A,c]H'rӢ%Ҷ&OG m.JCKS[-cI(D@:cQȭXTŇb$Anv${'c{^"$K &vҊ|Қ`iCb Z&m<,X?`7XړUX"+X:WDװL$[ѿX{v"G8[aL>҅ҕԑo{ҝ4bMBb#1?O aB{_ t w+G =B@O|o/'X . ~!8Hp@ 2:]xTAf #dA@& 7HMx$ ]a'I;M,jCujweqj~ߦqrxu"S'Hqm'c)!U9^YEo22DzȲԲҲƲ޲ɲղòR 匥rJUXaHkuuuuu5ޚd`ɲZeYֹb2]e]k`ljfico=l=f=e=km^Q,l ` E:zzaam5͐`Hy<,>(rn-Vȭ nCVʭ<[MùGp+<[ʣwVމmn띹w~+nֻs[_`};;vBYvn}eo1<[ܚrk \sD(9e[nC''p>0b[pn#.ayP}H}RǪcCjGwOq0D2rf5x% C^bJXg2s\j׬ gQEL,f{u/ +c YB5? n XC69Xݬ[Yx>\zZk!ycc}e}̏¿;XGY/؈c;oc},x8{MK[{-\l\[ +gۋ-2[ؕbq٧[*lWe}-GTk~d5̷/,/YYb_$[IJܾ7j:kI1e}o,s`N.{g?9[[؏TBFZOdʎk9n?崽RgtwЫѡ60f1:$n uDT~:G"n]hGkWGltqb~9B8X8 wvhaM¶uxG-q:1'b8yz#ĖlNmw\!OV9im3g9#~?ה Gp]% 1*rT7\gelXyl5ήMGq|\.2g\خrh'%cvW]fzav^A3{ tٞGb͎Z`0fH6Nx68Y>m#lil.vf؎9SBYଲ]rd~sa}l1VhIIoĘ9sh9g8gIr Ir]$Ip%!I$I&WH$ns?z}Zg=k=Yslz@X<U0U$Pqc:"Ш`%@LhQ!W9б`{k@=>C#yb[ )y,0_y%0T̵B':sJ\10P&S #/3Sqf -XP00e.9|UIr`E~CH?h[9{sb^Hu8]#ytsUs3OV&i.Ga`[N[)02PV:=胅] g)~*LD aV1mzX1udq -v,)(,|YJjLeƔLzyKfcM1mr|Ӝ5A޴EyJ7d9b;.)Yˉh^iƼ%[֔8dw撽XQ^rew_^3bºXK)94UX5LڃuA9֡LEyz?6*9+N* ׭bMWi]w9z"U]UѮ6;b6WuU,+e&c+8p- 7n5OŸU#8p7½%Gk O"m(<\xH0ࡢ#E5x勢/wwwzO _7m7;~S gѩn!a_1q=+.Eғ|;TD✼:+< 'ZKȟtՆԁ@QAƽ~#zo?*i5w_GazѠhP6m*b [&LFZX.W#}Q3}c{{*}K3=+}wgM?`_r_ T|uaG:It~W\&ް_^\OWq3[W\zQ@lYoGo׊+ùT붯@o ]ĩrz{#03GsyK^dS^[Bg_]+0;;10@z9̊4ںUz삊.4վ._,7λ7Hj\|?+&[;_1m|;}Ӽe𗣾Yb|| }K}5WTҸ!m/amg퇏a F{W׈]ރރ,@n O`K#u -T7=?? .?̟cS/cKk[{1e'{WǨE qB-I/_37f(ݚvXjEԖc2Zdetcܾ2d)3Fd2F_˫ggdӓ2&<3fR cqƲ-2y26a|ؖe2f8~ މL|83"Ff޹3ۼ3d6lI>.3ՙsB_An{ Uf/J ́޹C)`̌`fAa3ev͜%dfk ||1s7dnNOݕ's?]28DsTGiN̊d?ͪU7aVtVlVY4j{mYYJzf #?iMF\m:fSdO,HQXO ,':jTg$4ӗzg6vW&*H?IB^I4";H>z?l%cWҗ{SǏ&uL p3 A=T``#D` G``wDcB+Fٱ.QOc]nfAw"$S#>o'rq* d:t*$ӓrzʚ5!JD֔wdȚ](kiYfmݔ#k7:@ʳfu&B~4VQe1-;fwCɝ=8{D/{vv~v7*G=.;8&'*'2v9۲wzd9os>mNvWg쮣X+_OבU@1g?zKF(q~ZǻsԆ/u&:W~SXMO:"=QhETz[oIOKOAN<ϐ>#EW>]{CGK>nȂ! '55ߛDDϨF^Fbk`/cbš.& p\a5š:yk`RVcdQhSCZ)3Q/I .ORکϸ?&Rz4N >.t_NZfm=aAD)!uJutlrY%]#0H(F ],%A?Iu\` `jB?Oc%7Nx'uvR7;%nD&?)yYDtPJ#k`To$k$nϴkR"ϣ$KXJi#Ҵk4tHN*"^:q_E]?.I~F_sFUTS*e[d>Myb(Gc%ү6ѯ=QBi0F9KsU;>Lv,FLg;̴e~4Q~??QLGM}+yО'tŕ̺:8~ǝzU*}ty>觹؏~?~J9Gi%qdFUJ%HUHsӮ̯iETu/ypT9|D M>8YD# N:cJH7q3.*Ɓ9&r܆+c$qXulUW3XXjrxKnſv /qS_şqZ2uF<6WJY"r?\ʱDڕY9&sqf1:yɻv&I.w\X6Ed֗ijsLŚ#(QLi9O-[xzRka4O4;~RtqvOfv9B<.-zUUb5Yt$O:㔩(Ӝ5p8J5Y LzUJUukdm6&+sYsJ6qViN$ҮyqD>$$y__Rڧ]I]~@+9Dk7I(&)s-=Ic/i }v14Ż$Z^N}V1+i=T$^S&z.ifZ%cǏR!D$Z%:,IhN)7q^l=l?7I܍-Nmζssh-cnۑ5MsgElv2/i=.#MsH7܋m;ݫmuv?7M{H7͇nܬ:a{~Gq{́zSis'-deuv%s ܉ 1bXr=W&sS/'q,h.ۋ䡎?/$]3l;1ö567vV#J1ZPԑRJν%7J)4R>J(M4LJs)-I(:J(mR}R:\~SR fPtA<ÚPjN%xJ+ݻQE)@G~(2()PCi<ɔQEiP*J(m.J{vtȹt?a}N9_Ӕ?.J4^k]}RjXM)ҽ5W\.SM)߻s]u'? `?[% 4̹rR Oe;(O33333gggggggggg̳A9999 7GѿNHM7)gn{!%*?ԹF^?ùtxFC^5dJOk]/쿄KV_CsBkA8c">HA} 5>ZxCPcob6FVTw,#z|U,1&'D5C#W1NmSxaki ~V&DCNQN;\%47\gtTI4I8Fs4ltGy+}43ٟA cݓ枅k{{Խҽƽfv.~!q 4F{a93@/J lhmc9挦deD3 WBE.{3LVNݺBstut*kx9A!Զtڏ߃P68!7Ќ:9}dZ@ږot֠[3:C8w:xJg0VE-̇E z*u\P7wg&rA]ja+`[]['G~Bӳi]ɄOT @ k#ȒZM< F$O2'lin?0%0PAgѐL?4z=rS[=Q07#@%v50~gXF7G9By74Ơlp.y r1sY7uF`8̀CYc܏on@PȬ@ p3'h5&Ya8@_?#!?eyȜE/B[V^eӨ*pED~v56|;ԪxF|·6C|y A~bJEuCho4%m׀K#NC?> Ys7| shmͽ ;åUky!| xѠȠk1)h;fqo>I3n~u'05sQaۓx\툚g ێ}i#ṕŶȢ^j#<*y>(GߣC udlc^3 xb`=e] Qx7(`<1iQs*%A( ߀n |gDηE(:ǾZv3oF&[5ӮDx~/gu2rm]`<Dؼl Xoxlhd_PmBlYc6Dx†\<ڻٮ֭ /AEvB'bqsc׏Af1.r7iO!! Csx;Jz+`g D'fvx9墙W4"~E~#yB9qGp!lX (jx17)"?#Gy:1d=zua7J# e,Y&'LclkE)1sH}vOπhN<܍0ε 4B8G9Jw 1,=V_#F} KLm6Y?!~ʖAt,"g+sG>'LGvxn;w'P7A'hت)p?ȉp_h9 z&0W@OA5rp}G _ʭyh#'y -:@Bnَd09Hit!\&!RD*YkH!6D=jQai$aL=iwV!#k.h`L$ פ1Mx[_nles m7o1OjVe9Ֆs S>R=a%w畼`,0 p@2qǴ@I4hN"8La(O'F|HzKT<tC#Sg;!h{i,cIIX#ɞ,)懡0譠M]6-)d#&tM{ QГQ of,g$k cuFt*0Kɚ4pZ(䑨ll1W7nk32~yi::%n(=>nےRaTX)VJEOJL vf${$RS+x.xHڞo}25i4 toYgk-:mhXgj;bI1(f4 |rcqwr9ى#ƴ| K\YR<(ۗѕ w 4g#F 侁R/1Z7_.K!? ;ӱM{mF5`^ g`4C-F}O":".4;R`o<.E>xbU0ͼn[xGLk'Ѧ=Epyz6ˀrN`q Ἒe4=6g;~W}]X:#i\Y\`lHF; 7BT62pX|.0ǸV泘Ŋt3>0?Jr3ֱ/bU%or5Ag=.k.iCX1;eKGYE=x7^ QУ`WіW>f'ѮESl#vY56p5Ps݃^&89I۝Ӕo`#k | xȭC.vr s"=£RۏuMXOÞtc4 kӵBs]лx,!;e=!f#imjNZywv}R+h;ݲ?p oEF xWK1 g}png| ݴ/aHX&'.x8N5LC2[6!q{AwP/, 8Y?,}xa`7jl|/h{*vS: cz^ni9b-kV|Ln!~9[{)Do aMV_CƇHxqrrk1x4p ]`P۽7_ajVߌvZ[!7k0^oߌ ԁhпi4> ?'~~S;2s*O ] 7$zLπnf?scTb~t} [b%,X4$:g%֛ZxJ,"YI+w;ȥgC)Ri#^H6N1SNs!A.Qefl4hQ)} $O㹏XF&?|%oGo?38 .|wc}H3>fͮJE;VZ ͽd$Xi!'P+c~ŧ ӣc,Gݺ0ʟ _<.̩l{3ywr909f7O3RdX3E\ʼhTIxIc 䶃gLX [ v0~g̞{C#ϰcޝ'c!uk&vPn۴9={$IO*z<fNxCƖ hEpJ-= N:00ptpCs48l:g>oNև|O~賠][ qȕv[@kv[:nW#04nB3"V)a jo3sS9bg{?)g4hW;z-DͮsK@Ѫh|mw0LJ;3X3C/g>j<~< 3>b}<кe lv`7ƉȝK2 ~J ¡g9@.awz¹r!dwOEwc''`?x YF.Gd2ǬqtEnPGy^`jHy ,=sM@5 h p4,_f q)ɻe> ǁ:ض7-?A9EWh雰QcND = MlCa' se/XF'7 5%t?#03Bg#;B.} f]`)WqPf3?F9˛1&Ҏp}lCt!Z\;jn/!z ~-| NBr{0 Y88 p=hEGTB}g@[ 4 n 9A۳vmCۇ@{N ɯ0GԴ{g! $D12[MXޅ1z)'5ﴋgz]iz`:ӽ~~b.`5اXĐz湠rSAma4[m{? X? ڶ:eA܋;=sx;h㯄ۙwk25Jf470.`KzCz+\`e{ G (hFAfTP0mlq*cY.gZ;Ϳץz[F2Gl/uX셲ul ;r5R|.us,?!\Zvc=@$^FRDu]gh3K@Lk?+=:NNy@(EttOrbv2!(t<0Ju dh_=wyֶKO`_\tbАʴ78ZW<_HGٞsth;+-8ʹю]SIzkԐ"Q<qf홣!}Q0ơyi1_m.57Ӿ >ym 8AXrM/_at a_g@Y/\ 0iX N=`$ 3LOA? qHn0Z@!){ O3kZg+pJ]} p^Nm # h Ϛ̨ ڶ02 ~[@;Uv`KS}_6o{t=`$w6>i9,vOTc@=m3wbAss?EBm1l[2AK&P{8V:#(v?6ހڢMXɴ}3@V_$f/ kh#H Ѡa=# =2e[q:`aׁ"b^C0гۭԅdƯh{hcGP7D`Þ:@lyےum@G}gWl<e˲hS߀ alaJaXvTY>,B":|&ƿ 6#p='B钿S^s4 *$Mg=ӘoX&!ONhf4Z= 'lI<} 3}8O8]-$g}pv>1g1wCp)ɨCKLl NA˷ˈK׮wNLAz3s9r2^ݗw8.@>w1==@cBPjZ6pe[GbI8A>e_Bn{бux<"C`BI2-ó c]`@Md,dց :t"#Kĕg^ :E8: :2(;(W;u]ι^F{EpHD|5b d)-|uah.iA =K2 3=Ğ#t*nZilq봉8cB\s%:10`kFz: "?W_'IXJQn.9u%>:uel)-F~EWx1؝}՞sϹ9RD.{]2l_.},P<j}MDzS}Oݖ C&Њ Z!؃9>ΖP {/E;80`\sdTxV# Mc<.ah :J_Mg +kklbI|Z3;0q7x R؆9׵Agj51j1vmƁь$́_[lR^InQbs7xb,<<zelWQghuC~&,bayu> Т'N/(6bezVڿ&T9 6=QI ćcdicXCzΣn&f?4wpb %o/CKhj‹Pg~tA{gLuVeʍ}'m\j.N NAݓ`92\B@Gn x>pSzjU E{,~oUKpXg1]gr񛬢.2[ЋR~3"~og]߱~wGxϘ7AdV~#FW9ˇbڊԶ- L} cVGoh4}pv/Cg<=߉!'h~V*u`X N֚ \\ \\Fo=":&.`$.a`^X40;Lfs|bS%šE?Fa>dӚwXBIsD5;FXB.OU4g~f7濉7k[unO~'?f:N+&{Sv߿71F?jAV37 i2K,fQ&iТh-^ FjmX[mʴrn Dӗk>~NF2Vv} !K9O. GLyDS|VQ%EeJ#]Z*cypUS{՟4]so]Y*[VLY*YSn-nnAWbb9r~Zұνs\])WWnZ? qqU>WU>՟֪eD;V\5O U>'^݋*LH#ZKHſ1kb%\-fQm"KANj'i7yJ;%t!na{=4_?貧ZzmгT%}C;\m9-FLzdH} u5(5#B5NE{m| -j^-j6aC& u#~uo$YH~Hv$HVԷ/ꛀC}+rw5܁D +rv!g7rʐ KY5z^Z*#{EKVߨ6 iYJ ^ShSjNScZ}&1m6XM/4i 3L43MkkzMoM3hs,4 槮Zõ#&UӴPdȞzqC ת\SsJWa2L5Vuj*kfnQZVu^ݦnQvuZVjTuU{^SUGY_uV卪"IuSdC]u7lz޲&j)t.Od3e E\V孪PXUm1lW RMVe+5EM՟՟ezZƩjlfY2^Ve;5W͕<5OvP|Q-P d'P-"HޡŲZ;RTvU2y*UZ˻u]ސ7՛zK%{۲zG#U[ޕ{z_/jLPd?P&G2I}>nD&Oէң>SsP_՗KV_9PT':%|HQ"Q]a831\g^_/&z7כBQaHsnB>'3s\Q7EM,T#H\&4ƣUbTbE]BTKRWUk?3mEN7h:NfuC4Rw;Ecuߦ^uh!"FTqJSi*Ue,FQ6TAB|q*P*REƊj'ڨ jS$V=j*کijhfzF=#:gճ9C=xzAܩ^T///.WWM^wˢG^=ԫUSP+D/RUjV>F}ZVUz/bfDspm=vmj7EUFQ持j/}4g RG~R?gxX~Ü]|ko%2!biiB32뢐a]úR>/W[}>cAZ=^231F Zr)EbX)֊Mb-C8E+{"!Ëq^{A#?J|^8h{~{A$ ß{M=?)GOŽ ϸ?MB{~ GĽ  rLX>?ȳhy^l2su,cyew,2߱ E^t,б_,r,W"/9YXe"Kͱ+EJXdc̢/E"CXdc7r,cq|m2k˼Xfce68cwlr,c͎Ew,ձ6"8XC"+`𔍰Ȗ"9Xc"|XS"eE>s,DZEp,ϱȗw,cev,sб7Eu,RX;"ñXd7,r?E:9XcXcr,c_q,cE~s,rޱ"_d[&BؖlDe"c# X4,r=e7N[2A&t2SѲPGd"Si|H~+w<"G1y\ OI<%/v[d_W2Q& )G4aH ̕"L|. dd&1"Ryq\+?QUoS"hhl42MF̈1nQ~i^iMyT>deD >Y#(ߏh.U*g?7ʨm1n0ƍF\]DZi 3iT7qQ.UƝFWim-uTf"m]~(wȏeq>-/ɗH˒i|\R%˽G;$]IBk;r\/7ȿˍ]Iw>%r i_*#&):S ?"RD]S5rlw{3Gğ(&IO ψYY1[ss4 bxQ,5%D,Q;GbXPTT+/"η\|'#{?q8!~'O~/Us⼸ .DnɺGS !}>D?Ӈ#T}^ݧ =SҳQz@9B}OR߯пor;~T? YMQ?Og_o9~AKp4)]Ғa2\&K/r&l#''D9I># |CkrXSY&?{rB_+y@~-o;.egsco|e06or;q8f7~0N?'Siq8g7.qɬnֲ[X=V/^uk%XD+r[ɖo Rփ !k5j=l [#T2L+ʶFY+hXVo B*Jc=jY[?Y'$k5zʚjٚf=mMfX3gYֳlk5zΚg=oͷ^X/Z XZWRUkzZia޴VnmޱY ֻ߭&=kjm>[Z;.kUf}f>Z_X/Wku*[X[Gcqu:e~Y w@ElVL =M$! &((3"EDP#  ǜQ1g 0_](9{Ͻ]]=ݻ}*n7J kEu 7wT"5HM&SS4*JR j&JO'S4:NS :Elz=Gϧ z9ΥWyt>]@WkBz-]Df.ХVzAt]IGI74}>K%2}CߣЏ'3%~Ct=D t#2$#b1Cy#P3/ z#|"$ A5Fӛ8A/2 [ cdq!ƭGcz")(O1B<Ag ")ȑJ9v;CX̉ Cd3Y \_Y(#,c,E|D Q&> G!9/ Ax@@x^@H>S*ʀzEB#uĹ cFay wb8T.OB#g70A4dH1/De `Kt b6{41w"X@8VbΑ'~;qQbFƨ2j:h2-Fat=F1` #Ƙ1aZ3Lƌ1g,~3K_BM]VUb*8SD+M;?EeVmj[63_P Z B_À%G{ #‰NKAWs0D<) F$4b:1 !҉y`!K2"@+@ T`@]`V[O t0_Ĉ gogSRT{=lE֓PD~"]PG.uE Dh(r(Oڊ6Jt]]DD0PtST7 D.qG+< 1XrVJ9<&q8* IgIgxR&q$KOKzIz3?<+ II@I D« (ר`*^¨xI%8j|pv9|p |p6=CD%IIsʦ[P6ZW\o{vA; =Lq@ Qb ڏn?ec -@K:Cgt;'lAMꐺOiLIS iF%iEZ6-ɑrҎEx ^WUx ^ oxށw=x>#>O3\( Oς/A>!REH!%2DEtPk4siHPC<* n=QaT@0aPTd U0$50L`*$TJ@Q- O x pL2X8)p 09p. B`FpF#x`9G1 )`sœug7υ6fzJr7]1 z ؗb  "xcLf 5Zhj-U&B]uuhR5=ĥ'S!BG`Xqآ8~Q QN(mQQnXChbz-;at!ͺ E']\Y^#r!ֈX/ bo֋zI^*X/Uڂ4JXGzLgK T5uš:#+DA2\ݰ.=*}E 1k/4>CF/ysZ-ϡ@t@}ۘ"""xP@ޡGRj 5(3 QlZtPP eb/A'5U[X&"v "rwaF~{>p{!/A9Bנ!WP\N# .#^cn!.c"VB](P"!ʐFge}綀=Ne)G{X^"73^=Wm j ! yG_Mcvu]E߉j8 C88p8$qH! !!!!EpRqH*Cj8i8Ŀ+i=': )Z@;/`8q48.AW͇k&axE}scP Bhz az Z P_Xc9/B,vXX  X0pH(>X$5,#[,yI$ /Ek$R,KX,H*Q²AeDȰtU:#9 eAy QA#C`[TC7( գ_ V^ {:BuIU@ }P]F3%0HSHO!K@:$bT7H$n(؏Q5(%`X6`±S"2hl[C|`MEAHp[96b9nr܌e ,r8,2n2bb ac.%QHK},K < 11^"[c Wbac`˭–[m۬[q-\:l=$p={q-ڸupC TntD7~ !,6ձi`͟jnE^O2_!J(Br# i @*Ϡyab,1H# r[/WmD5ZIQTZMA*(ub?+`,ɊX1+>R+@5(ы z1^JgYt6Iѻz/O7[m.}~H?+3Fa)2%cX36-1rƎgGƉi83.L;=Ӂtb\Lƍqg2X,XU~bY_4YCOi#QPFSPF'O?8SY{U JDDe2& xU ~sz4Pξl2jc7nݾ`c?~c;n@=QBHz F$V !t0X߳bpoܛ Up?j~4[c͝} hHQn@ދ|A{ "a{؞؞J؞؞*؞2lOUlO5lOulO lOMlV؞Zn@$Y7X~c?O!SwRw5+iG:x`O&''KXeB& sB#Hr 9lk kZ֬-+gX'֙mv`;Y7+cCp6fcXv<;&34v6;]fKL6aW+|v]ˮc7b`^[VGcq${=^`/Wkl5[ֲ:-\K\@ qpR~F)G#hVS5h9İ朽iOObTsK ! g wχC'CPPԛ¯iX- :_jY5_~¯,H?)~*H_?K?a]?)q*tϥ~M߹?= GO (/t [LpC_Uך)\Kl dQ|w>IdD??S7$2j@ИȘ 1r%weaѱ1r=NCzGǎ O0pJD0a~ Aq]8= ܉s::; B-6˝1e.>6\-ȸx~ ysvjmC9[sM R!q!a\ 4j~H,rymHa~^o|r{i#{[UW/dW_ =ooGGVe^Lԭ]^5fDTMk#lzyT'1E۾٤$-بSmœni^—c8US AnV>8!@hu T@=BrKuYUubCWrTQEi؅tzCqTm>oRM?/wKuHHkgk?&lBbm"qcC6"6"rJ.@$A$ {q=8Ə 3'p2~[ yvJwQ{IѣR6jR}k鸄i.ap+)qGOd ]}"{#/856m\挪n0ה[b7+O|ryjeʃjG)ô[J=YyF|Vh.u]{2B5%yO=xLFP(QϕL,5c.Pen.!O&3m0\-bF%9:Wq)"ؓQɾOq;ܲhŦ-Œ3m-EAg㘁'`֖s8TُM.oorFٻL* r&}1%>YieO۶[izcI}ώ,Y[7j4)HfK },egzW[c>8sLқe( pӚ7KGE:y9xƙ.OGT 9_wcY,VX;M.&h+wMRfigqr;g!1,%:QdgS }K^H٠Ѷюu'K<2BƍQ cȁy +k5C`P؏CdEO/= K$p 2D˅~7)(W2Y'Jm_:vZ'l@egCd7 i7V}F3.h%5dlS Kt};K9y VzPjzWFU L&ϩis?\7MAv϶o?TT6J7l sDSEnEv;ev58T>G,\&-*,i N}~va6GWK_s9JAK:g?zeJ~&;׵5G"L"گ?mHb+jwsn67K׸GO=ԀF ^}jw,-}~>kݓqU%ڿ+VV[rbN]HS;y̶ \h֤qثF9}uE̸N/_.=?IB F  u~`q82LYVVO;eS47Ƣ\72<2$(!̠؄Ȅ |prў㙪osBW03brM;;75M_+:ksgL|m!uxb0U)&rގб2QGޫ ʍNa%g W}\;j+f7<}`afSO} r1 r?Ma72ۻ-=+1_u(Ǫ3*ͨst}%3Q[vcak.״ ء+-aVxڨG€7)# h.("KD 0A {rTM);ook B4azAͽl8&PwIu뼸p<"1 O΃NtֿȇQ_+eͮ"tOO$6>0i.*F@6.9{KrtM{}{`EVOƌ捼TpIv" O\f# O;w~tWˊGOg1p+ֲxJce<]4cLJVSAue39ӎ8Z[}پ)ۤ~/{Æ *{jY>83Ts㖌 7hN 6jhVz)cV{ϸo{֬Kp}d8C߹y۶mKUynI VqTiU42<޷.^Keji8iko-=.vrqY:cz17tuݨ 5}ߟ;K%h]2pvl9=џwӒ-gպ1K6n$&_8ax^?tzJUdØEYC.vM?_D.  OPlqM NxS%#v]]'w_^?v#ˎP=}^\5|%nyV˵=yMpvpbVWrpJV :)3ka^G.&,Sh`%:|iN'׷iZ6s>Qo_Nی;~/V_P%X Aq2㉷nGV%<-:&?g j7~'w~Ti[4j`mNJ9@;; sZ\_Ηnsn < Y\.yQs'PY!cfABD$DsO@pzv#@AT!`'_ j*QZ}ͅ #әwB2eN9?YXhcթ2\v_MduA#¬a3N*1VO7=kԽNb;j^ܡ;~'ǻvLhF6e„ޞ4%<,*f+]dF|Yoj3(;/cZ?(iS{dYVvo#]'I_iyӃWnrRG7?zZ-OgmmS˪Adց1Ee IZha)U;>; ĪMV4AgՕCV8e\S_^oYg_ roxŬNsұvqT[x1ŭ0Y d^ <|USiYY`~tykzGϯZ7q'ϥ?w7Nz`TYϬ&j=v͞G}X˜gt%_Za55cCu<`De;É/PםZ3 m=r;|`*3넼##NM"¥7rKk#ɇ͉r [ZU|Q(Gm!;$tf\h0EV<bM8N 4~Ѝ@P+L(0M2ӑ?!.vD|P\a0)7tCWFqOVS8wͼ Jo7,q( TmmgAjCS^]sjjTe+BRd{p4pdNj8!,{Q ]ƩʺǼI^yIDeJ곳s3o& QZ}#`_F@X=5Z|~=iff(YYa> stream X |U?>sιo[͞}'d' K  $a]}i VE[wjmBmնj["IϜ9?{̙3g晙gsn@!d/ͨjR? f#B+f^9gwmB(V]Xil+C&#BU5_w!\;czKCJ1}OmKk5?C|[Bui[_]v\CNA(; uzmGPVdqW/YSπt[P#M-K{:=1_ p= ᄥ+oۻ!7'@ ?X{RagދPVJs~k!|VZ~ăv#|=? #TngDD\`( ߶H'_R2*!zur4Q_?~#1qcHA EQBRupF)EYSɿvsH88w7C"4G1Ghwr?trL'5c@-azPB=8>xrLzPEsO:$z 17)5o7zX>B)zxNt >2=pOTģI4=*9)/} { rs=Я5#D+NoMseRkw'V.^?9ıf,~=LGS&Fwv kP@^ N&heoмLwRYr-"4gsUh-!“ u-ovpkPX~+ +>I Y:I/W=*O9' )P?N딺Jq0_G~]y ^G㿎-]+Fie)<&'PD񐯘{N}67!̂o~}zʻw:\1Qz ކF߅'3ݛ{UqF+iP-~%pG)_ ܅:ʑBxV "u$93Q~5ܥqQTu:o|$kK_U~sǹ:J!K@93oށ0 =u0x݉/+ѥ-bKyeCW~]rE&C؋p/ZhZQd><]y< X Xz]fh w5ry:?"R?秠(5Of!fK&%}eNT>C!4= sAyG1R?{Or-w*ğ,rSP:W\ \ӄ2BfC^S!oo֜߾ǹq;P9|1*WAx.߇ӽ V¹ `779osTACnzl[;w;sǹq8w;s1E]/uȿf)@֔֙טsǹq8w;sǹ%pbX P ɐaS&)h +h5ڂяCG'9:o7Û{K~?o_~%e9'AΓQjsDk?aΙo\6zVU3g# N0.{'_×lC*$e?-z?w/Bh5ȓŵh'\IA)^}/4v"aʯG 1wS?D&dCP2TAsMnC1 ؈8'x om |ߊ#i,~Q^L A)N 3p-. H?K^0'օCg?qoC}C!L.9]$:hn[_%HqOsfeooӲ\Ev(k8$Zgj7wN{[̖ӧMmlRW[S]UY19V^6 ?/ '>d44jR! 2T٣NOC}j P ޤ>TE%UqH#՝ݽ3ڪ<@*żz啽 1/2Rft/ȞhTmws^[/ 칬הڛM''T7-TUݛGo{eacȿ3 ~trL#?C* 3lPB_ @r@ -@6E~r ə#쌭Ό^0 MUPwRgE4о/ ༿,\ԵΞ=*m* N}QH߹*7Zk U'mMDZًvIWFH{VBMmPȻ}~I9z(=m݋{} =?\Š8vȏPLH,$? !{!15dqu p48h\L#4s)m4{ДPBe}k{ա^Mėr/' ؎A9&Y; y0`}Fȟy?2rwyy?0{F~ț7y0#ȯ#2 #/3#/2#3#d<3e9Sz41T|DȿP!P>Mg GCsP6|?P{*~GIC~l;f TWiWxFDŋT@4sTFgxT =M*瞤4 *S8)G8H*A裢Gxx}TGq;6*TX0 L#4PBGДjBI 9M))SQ@"7d8K _O?ܧwǀA78W!%?xG1{;oA Mou}o|n5]?_.*p%{Q?|-=[{Fw93Ӏ~ $5'k}|kApq>@/fÚ-4[}jic?ҤC{@ޭY 6Vf>&߃뮇SO]FwG.þKB.\ٺ};Z/jֺ}߶V6ְm~[,Womz-[7nڷqn7Z]+m`߆Vau 6}pshq]ߺuݾh팵;Jz׾Ckz`kuƚ5ZW[z╭A.i]oI֞}ݭ]Z; .(hu^ֹ洶Ά gRڼuzi?q_Ck}a]}u5PygFRiqP]'yz=Gi\^+yb+/jTmmo$F6KM]?[*@B$[A Գ4X"ן>D^2<]];.llll\XXXX X8p``)` `1 ,t:ss6l,@+`& hLLL4):@-P T*1@9 0 P (@>  d( HRɀ$@" !@>@< xn 8v `Xf `zhj (r Lo0n qx08 p% > O?>1`o}#];o=w7xk+W/^x<9/< xpsO< ) aCcG>@/Àc? !{w p;6[7 p#`/\ p5*=+.\'01 01 01 01 016 `0 6 `0 6 `0 6 `0 6 `0 6 `0 6 `0 6 `0 01} c01} c01} c? p.No8<nt5=~]nAwOP/z=oe1YiǐY9>28|`@s,,f8)q0bZVbF |.nTq#&4EPZ:ehZCù%B `KD>jZ X֣ N sk>f]mF1f+"7e.F;E$م.AB].GW5t(ۃDWA;_=#u}^t# 6t)oEwϐs7B]"#g@ϢazTehjeՠP]JLqT[ۡn{n㮸@#I R\h;\Ոn?;^+ge}fnC{&~F=MJSv9n1Ct/"c~c}AʇCb>ԏВЀsGca!O#`i~S{J=*!LRг`G/+,~B_Ao`_zU'G=z͇ :`Ex@Eh*>t0Q1>xVULW< S9 (ƕ1sCɯMSpr=rtAsQtG:1/9^;MS(P0KdqyPPωqe|Nv<[YLG˜9!9=T>+G6Xur4-så^2""ذ:;k{JkyM!U)j///W߬Vr\>t2Xb4ٕ IT5oh-gѼZB#Dž2+ JֈC |r@DÈHMXHuV%09SB3 u.h֨ =z%ć!lnrsQQ4arr٦xj Qjjn*O#LPAa/lQ ?W[Bqް+qs%SzB$G/ ?ҩc5z%+ .$~z!CG29xh _:rju%ψcIn[ bpfӤi$qIFiÚ9Er@!%O$pHݭ94ee)]SDb-юcҲ_KSS(ZB(rs=^V&-i.K[f̬-4p1/n#T2}Rpa\A3¨sA+Qh*I*iGD+ ?&ZI$ȉ("8")(e>,ү (Ya^>nXm0%fHILi-prӯ.*_6~x˲ԟ0x.jo ܉R&JNJ(:Q*ugTw`eL#D])D|wY Պf(~zz(`:[N9t!XSd5,J0 4+uj1+imf1)S,fQ14yzgBѼ>EEEEE}PE^Tm&1Ҍ=j*>2lagBà=^1vJj{S=6ǤBKxKj4wcȁb޸8P'Nbۜj-aP 'i=z*c DTT4 H6H7ã89ha9^Z8/:7fUd^8:j$4 L.jD,MR5gWoIOyïL 4v\h@1L,1 2p#y -9GJ3L i1-~U'01J]nl`uG^G f(oU"=Oi :]*E`n>t9+:nЌ8x$I*D B$=6Q=r1Є,V9jçUrlk|iJFP(f"!IZ*Z*Z*Z*Z*4֖P=1靖m>|rF"xKN*W`l_(AO(ͮN8 r#v- ylR(7ˆ6x+Wi "tnЭndnTwhemRemRemRemRemwHeh TɘK1YюEZXdQGh%^%.\cQm~{T8e`Kу1²e.33N7LI'dij2dSѧ&-&} t&ӡ:2侤&_+\fprs;O8LE99CI6^t}qioQ?Tr,Jn8ؼV[U bi.'4rg?3ex틸V<X^^Z R$ω}).Il̄&K' VI4HR'O222DNF-a$$1fu!QpyQ}Dy.#u)!6yGNd\ln];1 /O8Ni9>2MyM؛X|.߬jJN-VRwSjGo藹] ;M瞄xZ{]#‡5XIwJ=)'LV#r㥞/MD/)70ji"#K6dcJox{~seU޷^޼z #svͭ󓸛8ѷ`}}G?rO6KrkqDF~p86%ȥ ʥ ʥ(\t K%j:%k+/yC˵P}~[v E;d/*t$s_6>%"&ōm)SlL>X2#ۦ-Io]@(yrC_&vI54P|T3LJ(uEXR%erIRIRIRIRa19&}eDj 60NDFb4Zh"o +0%p4> Mda4:{S.݀ʐaA+*71y\]>gƚŽʄe/m)YvSK-r&ZQ?#םrse? ^"/S0$+lMJ7|i1:7.fVfLjYmd y#k}O&Xȑdyv68qy&x4utq423'o&-K%&юHiX(TtK̻0ɨQ']O|?51xzKKKKK?JvWLY#fXtɲu|c(qSnB2eÔ Mj~C;*6?1uǜim;gpRJ:?M -)qGt8ͅӜ5 Rd1$t9#a_Sf~dt ёڑ#L㜢l]D=4ipqJ0^+tt2lal5J_ %WO $l:N_]c)Z?RFU.$$)F1&NB'$= g)͡L ?~M9dSG}?Syrec\r/5N/ d -? Ǧߗ`Qp8WYqrK2bYDo"IDqaM|uT(j+ JezhV{a'#w_4#=MH8ߞ't!"9|= zʑO]B&C%N8ZWQo,.+m) A I?gw)ݹS: V_TSc F M#V)-:kI'%J7Yjxn/^So Cۤ%,cM9x9Yrb["'+"5R9w{-aN.l&ܠOL˫5oޤV\iwOJW-)>qVH%eCPٟ[U~߂T/t݉_zZ |R8ά(+% y|?xBJA 0zfA9趘\FF)q(qeL8ƃ4,f7lD?.W|,d*opݡ$WS>s&?<(^lڗL+(`Qδ}o MVN*ոq֞܂+2:?b ~)0c䋞j랻rmkU_eްݴ$nj~7e*ng\um>G|ܾБ!9RzHTf@E{XJߪw0d*tJGtlJh5.fhgw0hq݆,`$Z=b) mtZEn!O9er&wR69b6'.['n^}IllmsIX r.ug&{J'Pg:ZBh=ޤt&+Twj(M!B!nt{aΓ$5ّ='1Fۏ?>%sĸYw LaָZi :Zr`;A FR;0y)l4!'rޤ^7RujɲqoB=D/v>a e$UOȽi4 c#+'.Vg=QYXBT{ ͖M;SuQuzz0WMB&Nkxoۻ(tt+\4vħ7E3A'Mg:|[SoWqM2$dN]*{s3yYpخV|dlxMٴlEÂW5HV7Rd2a@f,/nv45+#a U #\aʾVR0=dZ8 D*- V3Yv~%iYИgT8\MzMgizc/fNǜڔy[R+yB<9'1L3NmN_?=3j6kUyC^{rI$yR4S99>hw4&붅seIUAqe~C4~A0=V/6p~ sΰmSfS.Ϫ>\HC.Á;G[h;Y=&1%g- O ?gAdՑcglx:ϲy<;-}U1&;`Qͯ (-~gQ[YaNύq1t{gOUq !ҋ?@(9w`W;l`.3\qJL;SZa6`HBVXifs0UA7(щoMI"+hVLUkQif6{SjN]88{dȶǘsH=X]Qv)7эi[ "1R5}AN:5kNSP*9Xx9 =^i!UsrF-w|H5R}T'Q.=G> 4 "7JPLvɟpj#mzODkX;[hNf[(J= |bEqq*xseh,h!/q{Z9) Բ7 A~x 6cxEN~Aܡhn'r:\'=!%N&$Wi}=NGκkӢߐw+GGim+vVt` * `|ئNp 2 qxtte&~U Ezkz`Q!d:["Qru#MX"mXUl]{dl*LJ1Fph$BkyA;Pm/>`;<ywD0Xue 9od/gޘP᫈V#WSsɎs.l5%&"'gbipʘxs#܌)3kF?h (޺_X3=\<:Hz+F䤋޹ɓ%)F NZvˍqO_r}S?^՞5hR,RYs;/ _ɫ&9Z\S^Y#< ,]Y<nStl J!϶}R|i>_" Z_dnorHRS4{l8V 1+]9;a[,VX?pS8|% Q <qڮ ;'S*oi]u!91?CWʼnO8J|x1k_k&/0wR-<7RO5J+aGG_+/ۄ6,h:̂&7ܟz!jbjˋsFZjL=g*ネF9_/v2] g ,ҳ~c&`jPǯD-(""e&V$UT&la΅ A8>‘YUvaR\ZaBOBQ]HhkyQ٢c+fK8Yo]\ S&-s y3L_:t%~qz۔Oі-a3ZW8NlK~HLX;3KuR;vڈ.?kZ/KD=H dGg0" 7G#[>=8 ԁY2(k5ۊ^b4]hMրr×XXcm[4nU]A aqJ cXwjF;@SBF[Qlڎv@MI3L׃eL3)g:|6Z#so,oevǺ?Z 6ک9A:q/{|#[bwB QՃc ,YJvz$'bt^حswlkN}̋&58R }\b+`T:FWzErRE+>S%Z]pt426BOSfp$;wVA%0-7N|6ؒ@VN:of4 ږ5!{t.1Q+1%;s4|HGcJN-%@coaMˌ8%Qα8Ir9XʕhHs+ɰ_^ѩ=8 j[j *MjLsI1H/GDog^RZTV}t&?5k1:?t'i^|#w&ouKKd꺱+W|eڲ.N%{1^ߖ]7{-u5v4NsÍ@M52fȦT pشk۷6f̘Yva!M8|'WpNdǾ Z B/VTWs#5kmg5M, duF8^{8ZX[vӟߠ)NEqGUxoCv$z*YZʞQkr㪋9%!9D.*lR&B3qRSQK[њ3fo"9֑US#&ktq.T U쪝W68&_4XY8:z[,~~yVES:}r׹CԹχ]Ngh4SfWS]MMr;m.9C %hvl_g[ .&m䬫(˴."T`pZmv`]]a#X:5ZlyL99^}3:l߹߻ʖN&'id<'r+M88~b H1fQR[ҧLKݨAעv2A۫@Mh&_;V-s5u{/Yм|pATX􌺔1_Y0dHKD.yX+Π[ӄo'#2#=ޙS\|Ǔ'~GM7|A%67͉:ֺ\!g|F1VeuO/Ld"HS.*cqm3 kfίXV(O7jDvtI?.Fvߎtw&p A;[=WkJk_ʚS*4y%?NĞ{ 7oC'pq0oB7Br+^`ARեCɊCk]4ğoNM*.L^\[n`[Min11\guGrNBM<O&8%kHq"FiC~cQHļDgN"I6z=tUZ]Tgq>F/Q<"Zm ׆U'c.ɨG4 yF"r}q"H;0V6%3iDm\כdxkbkA=kl 7`U]lLoa;6=i_lU߅ŝX=Ybj{B!ӣiA~ٍil rꊋqH;hV^Ngh1 gU d};møve}&^yRߤ$pa>EA~=gS@"AeOkc^> [Tw_g?|]zj`OA^%7n@Hyɖz $A ; &gĭǚ88]k ߷OES[ߵ5+LĒ>75~h ,'1awWo{< jmz>jDqw5/˵L-J R:iy76xˆ\*;Y\91LPPn1\8'5C[w,iAS.ATmX}oe.R"}p;E O^;wN kr6b(= 7T/mK]z7w&ۜ@9D#Ei}Z]u**Q@cҘ5xݜ/./&ˋ a| P{깇 y܅%.45`bLd v`/< OדU%'{t>vUpHpTJ&kKs4E9ߛI<:ǝxmGBhT{_[?VM3Q20vǩgسC 9y ]]`HYځI'Ll Ά0X*-5 KA&cE -vbg}T'EpA]z \qBIbIl9:6GP.Ö ֶ= I,6_o%!x8go1dTzLܞM %$MC:vwgWU҆b@G(p.WwYirZQk՜QF2^.A,sj\B8V yx/XLJTHR?+'I S4|Ha%&] Yi>VА&#r<"R 8CK df)„9u^X@HRcp2ДȬۿ0,UB\6K|i iY\G8oKvcv뉸jvAπP$ <LLPsBLjIqP W!%ܘRAjG"ջdUq4΅PX!#˲IY,9urʩۡ}V^x]APf: p.̕7;[]UUʻš #`+XxĐ'ތ@15,qTqib!v=bò'Kl7@&JO85WFZΧ-yԤ/A3XsU}-]ȀjɵDF%Xbѽ։d!X2PvDv [׶GTl3*X]:ldۻ^Ǭ4̳ cDG2#+0D?D@3.x -Ҳmh:1y{ˢGmʌ^/>T9Z ʇ*j Bb+_RP#\dvC]EKO89l1xWEX-@eLXklwwGYl!2oJˣBb+\dzUl&SP YoОKXT,L^Wh/͋ >ޗjZXgN43Vܼ4іY9ʖ c6$SV|)>[F2-A1te<+/|x[.Ē!^53Ru풧FlD<QoED}YDDQGЃA9鱩zg03~g|uuہl apf ^VFɹ>,WoɇpÖkmMC7dX UK\I.ɢ 3X;`џE|ț?#fp\HH59eQvh/MqR{ecW W $N u^qꨉ!%@ |E??3k>keю.lD:Æ=h7(/ĜĄ4/9/_r_feJbO,qv.y^^ yn6~cBl's{t W-&4NOBFQR%cNH^5˅D1Ko]hI^q8[^lNH{²/&B M[asjZW9-R.&GԞř cj?{K==ʳPeAviR=S|2Gkdv ˞UVIWKH9% 6S]]m+p񔱮MZݪeS=܂VzXIP rQHQVʶ`[9ZE%Eebb Y nX73ғ z~HrӉ@O\l CGuacBpe,zd8Et `(ƪF{vы/%뼹P$")8)}Lcq7 x?[9D\qM!Dž-C)9zM7 M^m->`@f6.@|^tG > Y~C'޲Su W}jP[/ë}K{+!8ko*Ia9Pnد<3+!0^z`zuU;|q}揅,k瀟I†f7 =̻Bx +]圮{Jb>CB!z%:B$R{eAXxBބKxb 'U 9b8^<#؃& 90<(!>ibsRVJ?"ȑ4D 8}qC~άTF0L< ݉9nգd~;vශ% D5\4֩D 12b3́^00^zwhOj=k;aa@@?o"IN@I=K<].}MU\)]@U2x Ǐ*sg>p'8\eq.׸FN!bRTGH.#2Da.3\&&n~K@pr($(0,13&=Zb5M(ŋFEHCg*nw&oi}zmTGUDG2Ma,QVr`,'Ғ3?Мb~Z$ 9F*5jp <֨$EKG0NCQh"1s#b_caxi- dF!a~uFFf`G3Ga_  piѢ"Jՠs} cuWSԵr(,cv[+' FqnQœ,G*j ib\gTQoi$%Nacra,=\ gPS9.q?naB4qfCt9\Hp7cJ{KgAY fo\RV A(څ菬.Z7Qj=T fRVXH ;cR]4X|Cx`Yw:-8 -DhܕC+#8q6DR_h TT,v7X۟q/T9]չu ǂ9?{_) UkRcU:chF[f0vPwo6x_4bc#X i.v䞲CA$|lSe=TJ^l šF7Wkj,\VWX^oʑb'`viؤTJ"*A݈/6בv2/E#T;bwd$MX 3bix' {,x6ys8-ґWJFA܈K幛o ojц~"B{/WHp/R*z^JqW+<-qVO^a9#~5W|K/HDsl7ɉ3])fVCE2.7ΥkL.NPɦ fg|b,(eS^Pړ~ooג[c榮aDI,.Fv+ LڎF! Y`IY4gǹK~qO{WP\SY|YS jKIMp"@֎.?%\MQjVZ)'ﹿkPMke7Svdkyʊe iݲ;iݭ)#ϖlMxJ &uq EPaB{j*JmX )*2$NN?yW)-5zf,HW61KerJk{zlv(ƠB N%gi IA-BIkẞ0Q)qdv9%)8d=+|xٷ&6$Qo X>6m1s^"/=?kgzWZ<;ޝ=Zc֛-K1ݳ KYKȢjLYU4n065ac'iV)iq MO;vU XO"ij-Xn%dNَ5Ŏy$c+S\Р>nM.'5%-Rdi5P{f==!JJ.7&VfK}Ow,RZ- J+'?r2<;#VNNhмY _yM!?]`?h@7%3{ I(\rf 2 ?~T}AKхf<<6qhXXZZ}uhîL(9m {R z)-C_0ੴ=H1fHiw[e-<CrewRڋq~E1ߤ6Ջse?Z,rj5fU?58ʷ\BAz7;{sH+GwthLuЋz|y=cЪ UEL 6=| /<)4|ET;0woGNijuh^X$0}hm{o;mkkRbÿ{k#N#ĪtCBZؽЊR^[fZ+͵5ACy^j=6M6͂֞H+C{pXiHMA~-(D<6UK(9^n3 Ф4ӧ܌>=7ia_P: !+)S@@CGv3$E*A[sB#hId{ن ̣sX“Zg4 l3L1'2H.3p?pNq|BUX~ XYo~Yڙ:AJ%-EZjZz!gh^0+H{cd8W"F( :ܕ<X]C4rᔤUvQkA{jcG aM5;IKPvoYB@mE.f!BD<~;|YcS VovJ2从 q3d$ ^IZh3#G҆† )ÔvByDWU?ǩ0yxˍ&D ZKe\="TiPEs$e}WX;ƻ-BtT)nl)f6}B I,;gO wh-Bi6529DKf'K=ddĞ݄z5@9,T/}*h=x.agdazҥwip{AIS:93%R4s)'Ĭ߱a}l L v=}8ٌF;HQ)$2}3Z*Ž8SJIа_!pşXv-'=dx&jqi<':JNRAT󇖞B-@U,G3{_8BhURH3 f> &U[ti|!=XI3w*. ?h f2J5GVK^`0-^ϕ8W?wR綢]wfl6e3P>p.O`>ȊiT\.8 ?~&EdWM}}0T__5dC5ن9~}M([ fk=A uQ LiљQNPr FG#3bF(z7;U6ׄœPj_b>0X132 xYVS6`7!ܭJcpHnRfנˑFL?@3ʼnv!Nt/̼$2-G14mH!|>t=wMA3hˍA#hG>'ZBau#9t\Y4GZ|gc8Gᴯ<JҁF툵4Eݱh'CC+;ʒJH2+?_6K(|Bu&'/!U12TQQUJKة3)K+IGW9|A!4,١}XT{) v^ zs'(ތ1&U`y$+!J~/Tr;~;řgf^\J\1yx1b*9IX/Xf9,W|{nyt98T1;#~R.dO[⽭oD?Y%=n*>Lގy0wAG !pB(|-Lmo%]/UV@m3fȌ[ cuהv?ߵg?F E-Xk`~{R$/QK= '+'IWN-^zZ?!3o9rJ Z :+'7M~H N=ďO|WҰwLq -9%zZG1 3ßP1(0 %VI^P` JTv#o(ڶm{+`ӏzhGs4o9>>q♯/Ղ`yjO3-tv}KN m#hWI_oπ`ldxM[?~㡄`=>&W$7~ pӌΪqϯ#<}"yb y kƂtb)Rƒ*\FJ㼠C )+)ᄔJ^5b6V: Jᆱ]FM`OP@9O}Nj'_~t ɽP˄0If!:S̉#b^^H72ֺ FV7ʏm, _#iX{ٓi - 5t`FFG)~(%ZJ(?L& gța gP]lCy{?'xPuTլ*Q]~M&#c(Nh=᭩Q2Q^D R:wXV1TX^"͚UHIiM(6 MNEQ*ݹ+_l/ŶrMY]*X;e"v&  "Tϥ|}E:/Oxgv<ư/$[uuKZ¬%hQ-h=WfX5sV͞%%٧?ƌý(ٗnN]ECWfy^0{8j .;{=߹~ɃS,Y.xWI|S Ȏ4n>qJ4h;n]AlovK!Ot}BsNN25%h'UIJH'r&NI8 b [Z0=:'Nge4l4h! ԁC_[o=cl<ڷflv&"F,}pgq˽K+OC$x9, g3jxϊ\)ڲ9!岩u@"PJzn\TPT@=FrUBS͜S SPaG9372mVl4BLgU(E\@(E('j?VCLЌ'ɵk*R!'i}~՚:,?eN#]ΠKY5f1eoE&!2RLx_A5?T ڧ-ȤwAI?127=-{ںki#wj<`gGۺwx],I'4J%Hq巬dy}Hһ7fuv;t^p,,%²l'pCPXW^,(FuI "&vXp PuG#ӸÙ}_4*g%Zg;{X}QPlߚIlTRp-$cL9I9 ѨƘyZ`'!]>%~69BִmaE1JBJtoiF]ܼ/@f|||gñM_ț*gx '3MM}-\hB 5K簾W \{`CA*y Zժ& A4A8 ov q)6X\ 3hD88''&#ͤp5{?c:Gx%'J2p ܽ ? zg b *r7Ŗt%UnI[ꐏuy(tH-S|"-6(]B ƍ3aP@^zTxzb#zax;ͼqM qxek/Ḱ6T@h7m+w6mhs4 d9pPzTS!\*4qq>j|i[}qGcGg8DkXRw޶/Ho qcm5΍U͎ ,qyfA7g:Z q|ʅN7鈛rljprh#cPC>. u.rl?C*񂼦m>V)KCk<6>kCŴ2cdtM~41yZ<}m. $| muu|#\E?ƑYGf>l8R-K8g W,GADe&Ӌ [x83/ M;ܹZmFAtRvߺTgO@#֟ }4ܠ4/. =<]ٛ`S*5m͍˚Ύ]W /Um%y-V3hIt,U!{z Ҵ jz3";:MNcmΨRIM!g6d4ͤڤat[5-E kPI)5i0s"@Xl|{eizt<`#tX CC;.`Ûx RC*p@ :vwԮTY\w)o!Y j|TKEwWIY>rp'g@Uo ([ >l,i-Gvjσ >ع%hk[]pq9q 1HJyq`wMKn)8-֠rzY?Y j^[_i Lu4!=͆O.,)] =,|*{kc-]\m ,~,F[s.gGS,8*/7L-K k2:ZI7NP9:6gd|ӫ4v8f> ԳUDo=yqb%[j.zShQqD\w=Yn)&~[MGO)p? 6^ح3?nЋX^巪AcԆ!ZokNǃ~ӴMq@ƴdq863>f=kªV9LW-?$lL-|md_ܠ,q% >Xܾ,-}A_HOaj(֯ }m9kg~PK9ZSdE'f[6:kmZ@$I @ .,ww$by4CNgnk^4tEH>n@h|ﺚp&x>o-; _}ꮝ | #`ʴf)7?uޥi%*hWjSeWVsÚGӒ]d|j '6ЌixQ"8 WZ6vA("(oK玅~.⾭><93ɏxKz4r8{w=Ҿ{_ݻnm]mvx4o;!h$ qQ³!GqӂϪ?+sϓ t_q:i #ތ7ye)m+obR&V r8 QH? U;-5GH֍PloeW }O_`%6 sHqW^MNk)^@T4^|5.1Ijڌz%FlNܛg ZHzIդ/YFzE[~vuƿ~bu`DF$ɦU]5 T҉mu7hmh68!2`Ft`\T*;+^ ߴ"jJάe*h}+nHLCMgȔPy%dG~'/`FI_uYU^n?̭m,ʻVMջ6оI_g֯HQ*ukvt;?6җ]cɌC =X7=nm+ɔVi3C)T5{L5E{F)k1iJ8O[g.1"F]͗a.dq7`)s#95+ T4]—^PP,"Uf0BVoY ' ,ٔx)"aC-֋.xXtLdFҖǗ l޲2+tNK\z aܲsAWۺhw:P[SO/)nmu4$fC,su8cGmpX3@ۿ_n0ZZ= y-6Թ5ޜ+z<@լ~d¬[U DPBwna\ͪL6#j<؉RtCy8Z%_P0[gT]ι aQ܁jv,| (E:ؾY3v6BjY+3X-}-+!q9_yHH1W0_8 E}N# qyT3+BrYLdQR9 5VOV?1+> JEyKmO:.c"?*;&'/ƣwllR:fYXJHxb$DŽ$~gJIMVw y2{KPT#HIZզEA=z W)E N ^  4 bpxEa4FGj-%髲I2 %jF}!p ~xI]߉m5OlǷ=sp?>㋶4{5r䒯} oL>|墬i}浃WTg5[ xc^3[2 {qLŅCB"snHhHd  $Vihv#zQ~*81B<?U(rCqXҲERLtN8($-13$68 x~"!ˣ> %a0q_Aʀl0]b1;/), 5=jM('eܲ,yҰ$vg:(wB%~,q%|[EfE"[2(Z An $T! U- WZ) N@ Zj4p8 :&Wr@.E.?\>7*1J=cOF7SpJi\PXv׆P )V¨EBZ t٠@]WQYơ'E}XhD |ZT8^x% lK*7z'+uV:엧hh`/Āʐp `@DJHK;/,2:^gW༯?mDUG^kw%=r,}hF LR~U\c),?-ثU `BXϖVVJYW}J*EA.I"iC!ڄgC <^a]D[zR8 J3YA Aڂ/N7@<D ݄bNOQZ<%"^~|nO$=M_șj%g9c3;;6V{fg)";1"a|#su͹ǖoE"ZN2׿ sq@N_Ų%ROU* ƺE X]uD h^yF%,BXdN-^({FX IYE ( 8=\/4(!AH`A? :pDU$k!ћ؜ M `jC6AXNCv4 ^72܆́4.c>+fR LIHB'Ĭdf'Ȕ0£Z9JP.#xM9ެ&AIxn KHt"h'ՃJJHz>[ dAƠc1>7k#=1_uGu8p9QXdGq- Z~/n ljWgSɓ{^sOi@sz5_irNx bgޯi>O( dӚTi@.Hqèhr'Uc^dP69(".no+r}7kJ e%j^~EsFX@Z~( 9_.IA5`~UC]һ )lvRϱz x >TcMZb ›tjgPӹhSz2xC($~TPuz]]zBm.1u_MAo9C/N_mݧqn\|DJ:9tH5/  dE+)g=40fL{d4K nepTz-Ͷ`gʪ_TrTxrMY[RjɵJ-h MūJVmMu{ֱ8aKxGU |݌WEtt5bίK*&JՕ2VT)TR xM֠IyB]5G2CsƤ%mRhjN"w±]!ICzG5N?\e|uv /TtY(CdFJ@ qRS( Fpw?e손NVY5vmt' k=25Gp-Ռ;tjLmPۜ'p-pF?NgNF#G Rl c !ݯp^ˉ]Q*u~vl޾m= w,J{jxq*eH[L޸~s]w)dЮf}fWuko\#eJ^TL&.Ihm²fwڣ1j;g zYcq5K@/*e/#'D$jI$ ZS$(%j+=(SP-d*F2`BfH,Ś1?x c1'x@63 eQh,h* ' z?z}Li ШLB/\+2"mz}umN #n\ԗk;:&lZWҷǤ 4}i7;8 nGkC\(VO͉Κ74 ڣ㴳ŗL[qzT"&KCY@xe™r@rAA` >SQa+/KNJ;3JTV:R#;٨ H\Lz_v4e&X5d@|7QROV/jM1M+[PҾ⤜S9}PhJΪՏf6L6[lA#`-&b@\.|Ρ8OWQe*\sM0#=i{S. S8ޤ$SW~pÍC;Y\BJZ8 p{f\1Q(CL3fDEQa:-tb݄ѫFkhҨj ^?tx@ 6׼Dg@+?tF̻z.,ZN&`:\+ypQ~|22ݵwSձwxk|<)} 9T{dtu#.OeV\[f_P߱"@)%f>7@\hCHGCը78#T(̾ tĐbR߆\vZPaf( Ag* X()r G׫4!")%1UT?>4Z%8L|I*uf RHz,\7 ԪO*Zk $Y BEVjy%r##>qf݌b+><^P z{==FqEYpbt:AޛGUdu{:{g,d! @a(A!,P(Aqq\p 1qAEEE ( QIrν;V=ԩSu;Mu\-. $.0~m\ :<QjQ7DX/:SI;Ol6E80. (eLqE3w!#be,*`I6>9k^?mH茈 t8#n翐lO mkd G3(-$Go?Ѫqjͻj\!d^o櫖}%%,̂ymp'~$5t Gʲ.ն֍/]=aة懤'OZ}G~ǀ1Q_>Oz~.aP@3&+1v䠐0hڀ wEbz0j 58\t%NaqpVebۭ³0C,6e$1.׊} pο5]ƿ$aq-A/ Oa OY78SGrK+DItoOWMJL`|)/?#{!}΄ qA>:qPtXzN̾΀1Cfľiq#,QoFF:lpG:|0|G_UG|ll(8,6pWܖL!tۅ. f.ڲ7n^68 萰(dQQ6d2+6FIqЯ^MbshoR.f :/^Y+J-S.S`thHL RfhMTS`L߄ ) Gz`6)7ERv?jv!K41%ed_B3A!iIJKMJHPOB5Z|GoV4v2~|O|'`6xs%߄qg vQ⛂vLk2%00Foq=x`a?6Äwl~\S?3찚#Wd_Y3|@3lIWclJxx?\# !xpT>SxmfS¨US[8wQ+ |v@l 1C(7vn}m~ۗs-߫NݩƦ$#2 Łöa1 qO\H @l?3uߡ^y{,expǯړKҏߓԙw:ʹ!E=u:tLL4f=40i=r>؞iHouX)/SXI2g:!'V#N-}M#,[#mָ̘QS“G%Mg\IV)n AIFvjt\&,p|8,DF ?,lLp1C#"pm4Ά 6f-:;OQoAD# o"9H_lW"]g^WcYіq7HJ@dxTՠ'mci_!.S$ eߖUoU%xcwDAX)˞6U HOla-KA#ãEWCmPh{pM]rĸ#bBWb;2"6oXbOjJقb` XopOmϙ;9kw 5vqdzEc+*hceXlE]4A1ηĔLv3,l1n~bY:vF s 1KCs0kdrӾA A>MMBpe.߉O' "ұk5ݎwVe{TĹ׺S#AIRMO'iv h #B\Aq}_N 8IQS^fpH᪝&;oMdJ JѯI ${Rm(3w-xgyϝ;*V^\z_ +xh^4%K(RS)<:`flڗ,$'uKRX6BCS< 2i=nu­bgڝg?Yf  PM6r+p)6,{gttkP6`XF4\4 @{`Do8gwL #򇏼:'OaّOZ,XF{R֨ѱ}X|u WXlrxtxiG_<%ؕb3f+(,4l>G1`m4j{1<ɺKEh^ayIכY<_iJF'D|ؠ(Q& ӻoC7|h ;b0 s"?sg4B`iMC۾Q(ץų>^>N{ws>J`,j"&8YL4`69g\@7B ޏ/ g|5J>Zu#UŲΔi!J ʞJ<[N7F9OA/9$|wMS6CpCV0c8;f (NW(yIMC%(4"h%fx/K;;QFzǑ"=(2hݿun%\ctjKL#Y 6 #"F4 %6'3?AQ.WΤ`AFˡfDX t䣨c%0%loeE(pGcE8I?C_'Y̩w48}θ&߯ F/X_Qz⮐QB3geg_6(T.vu#y{_.Fы{)_Je, ؞db-,0h%6e~'2]կ?3y+LkJdQD?l A1ESO@DHΚ6`gD[=al3c,bgZ@>߹36ᡎ:݁ cS^*Oy_ӖMNxUwC"#M$3eėp13*]0">هp 7NJ߷{ $kpLXhlUlEKPLxxB@lDD f-]с 0KJpü$7[c,f[|e-f|ŷ9K29j" E9&.4.!}ra/׍~Ҩ}򅿘q1K|#l]Z.%ַ.%0]n ?y@΋1W"I&] lArD?Yսd?P]J|OL>$,'/=J0G|MZMܗEi͊mtq_,ƉOYIrVq.)啴|Υ܋䖾N1]MWGrG172`-I&W2h!&72:䕡;z [=?ٗ+#F']2jd먁4\գF4qLϘ'[?aBg?1dHΌ?3!su9ao&_NrbRj'e|3{4iI29rr1IP]BԼwN3L{8Ϙ2}M3F0㫙g~7+VK~mK`O_^x+^+we+ǹ^17b:Z}y\}MۂGpT!+|EW/*.)J.PU[4򢫋J*n(@6ENjӊ(q,G[Ë/q-vɣK~(R_W\r,SRyZo|XŔy+Vlx⍊}*CYxٲe7,{qk\*o&oC vK!V*]-UTUUM:dmvJ7M~7M~7M~[1+ +6& {yՅK5L{Ճ-'Ly]z.VAW_Cר@T3HgL:ҍy3E:t>bfaAzph wFzzMy-9O@!O4:F\/QE 9B H%ZU[SFtHO&Gz5' n1 ~v%SKdX%Z%ê7ܪdXu:%L=3.WRRt5 fR--NdÞI/U/kЖl*ʆU#/9WktHO&Gg W^MeIo3H7σҙI7ޭ>ݢ>l Zq:E}:O:tzu?tFB Ez2wAT*JS|*OT>ʧRTj.JARE/\~hS:lE|;WH'A:dyWSz `xηp Dy{=|lls~^;yY!'9Ztzz7B#X{bu ?BVOC,hV {>NQ_SI/WŐhV \qTgAGa4|0\  ҫj=tfu1~t0nqfo{*V &3窫C?BW%hŇl %zUVhs55tF^?Y5u'Bک>nW.U߅%jYvql"˫.~t "L5ZWyy`r^*7h>k`3yI󾨁/@+Y5vt,tt]Kzinm Y[kM`I I7k`֦۬BSAWZX>ҼrOF i'x^ U@Ƹ[ KnDEnA[|(-gIg"=t-)hX [δjPjPjPjPjPj@ Ig"=tzzһI7@Pz'ҫIC.A Ez2<[vh^,@?BUO B Sб;Щ't,ғIWWAדnPA72;nfnah#|zZ] %dI:YN%dI:YN%dI:YN%dI:YN%dI:YN%dI:YNÒ i!t$7gЫ [*f ]Φ EEEEEEEEEEE3hS Z} tJgB9ڲS%jɆZl%jɆZl%jɆZaհjXA5VP +T aհjXA5лNfjoދ~Y [zSOy)O=婧/@ǒNŸ K Ez2<[,W[ĵ, KL- VwS%`X KZNHu?tjĐfuFG37B? QkB j8v-X0܂XIg"=t|*JՓXmP[ZK[--hKj Kxz h/;G?mby#tZ ]^'́}5lAAX@.VC/A=P F3HgL:t> ޢnTwBV_n^f恓eV^cI竟IT蟺B܍R95yu,t7Q\6𲲑~^6񲲙-lee/+)e:t,ғIn$ >lXXC*ݩ>:`ҸOv`KwY:U#uYsj'tz)y؏󲕟GY~>U$ϫK?<שE33BS7~WHf~u򴍟< fΡq98݉~9svA:ϡNa'Aۑ_6QrөRFL']K79U>~m<jFXxԉ+!+ZZ{VW i>R.l7T=ŽaN⢚=G={[k5dwQrq۽BF1[Ey)fUP*Ŗj<TtJKגRb5%zxr5EϘ@1E JV{P!eEU˪ָ/\VUXS"Ý[^]xIM{vIuIՊeeBe%UŠj7K tPV]]]bq{֔,EɊbwѲ wiIaMmUI]V{UsW/-EH"Kkk*QeEҒ*. ݕU`77/˖Vո*5 EeײRTv.$í73ڽbY*D[l,\ꮭAql,CV&o(Z݋\ Te.Y\[^X끑[_ rЌH*,.YZXu=oJ~h^QVR1(:]\\lY͒ʑp K2}@e +PTSZӥ{e[@>?jj`O*(B B)B띐/܎3ʄB(,jc& 焍I$ [, [,Yq8KhvfNho "Y#>(HRT%~*nIk蘆yN&I bIIitJʖJ+6H^~VK?JKg]zX:+m:=hi+} 7߇v*}_3l Zp( ~G)w-&>~߽ ~z ~o"#d{>~o} 'oV q`, cd{-F>~ ~_ogk#ͯ ~s,{  1=~ϰȿ)~co?;%փ߻_wmA1P.21XPa ~g:փ߻ }_*͑ \!͓"r)L I*i:-~o[cy:yG*#v9E:+:OTy|+_p7I~FT;Ns/_{Ճ߻VOBF~o-w3}>~(v ]F0l;^ ~z{/;~_V5vK, -RW9x;ׂw6- ~/I{NNHe*}/~'9Vz{'~;K w"~v}{ x{9-x6n/+ S "8!VRB8.~;o ~M 4Ha%l J) ~4m5AZ K1&K'嫤Sr] ~7c&~ ~: 'C<#0o`?~coKJ{;}6ߏq{MB@;.bߧn˿ut]q//H]-{~/,$F pT~+z{} >~YE6{Q39lcx#- g毜: x ?*%֭ Ks23hBq[#:+&!JIϖ "$Oׯdh }*}Wx<,$4L9Fo4[20u WHx:Kn`<=(W9kB=^,`12ah Ys67>9~a=#, fP7 Xa :;ũ_1ڍf{F|[7/=ܭ"Hw s:wm}<àggoԣ==xGvzzz>|_z>+QoF}Ab)b`M#-s~;4lb!l-(M֝fG㈟qܹz\>Q'srwxnz&o6l̶Fy0$ f`~7n[({5.j$;)D32`C 3+N3B q+O-ΚczQBIDbutG>V)tW,j3j tIMF1 _ty<7Ydf1Er*M!APtP<{ȬFY *A*^/T#[6POwvvV%bpE7 K=#A6 fkOtA ]t7Ëyԯ9=GC5ŕ:eʆ.;>bLz-1Z]R4wJ5-hq*kqFfVaܵMO-tV儓"YaFnYgz"Z!MG. cr5rCKW= qJ7t2SٻnY/˩Ty aOvY޸q!ֻwclc*QG ;`ћ}n ƿstwj-"H@HZcB'&,&_Lrڥ6bdb un'2iȤ&m7aTiL|ӡ(XyN|d΀ O A%Mo hNPVA$B Qu4+EO_R"qZ2nC~QG':E&)-PY)P@ UV UDI6d;wXW;Wtxw5;Gwr|:ܬMM֭s j\C't)&fXI<$dzr<9VE㖢_wc 5.s ciyo$GK`=Ǥ BtښilU/9/h|Oc SpKljg=Z5ѩI*oVg3j TUs#=oAFvW_6XLWEFNW'y U+'r1.^|% ݍ6`` c & u~BޛzHy䤰HzX|jPI!v?g.cNN,vI#m%QGDHv\3ưSD"M?P`1ҡ0"(#^ iT% GI(BM( 'm=qҦqj''d ~oН!R1Jx$MNE|Z:?֢eO:`w gHܤ11/FL٬`Q$== b9WT6`t5777u5ٳfƉ8VYd!1EٺnOkgu.:s[G<9Z-z񅍕qSF(ڌNp4{{L~m<}8-{_ߘwoӦM{l{ltÍm@B!5ih 6{[S䕅XUs,:Df,紋5=$͌b)p]h[g31Yu.`U˨w{si{ wwVhSҽ ]te>#1#\,F>,h\ "ͥ1 v =uD)VM%F-Gf8âl^p΅Ư'6Ը%\x={`1U!3̞a_mwػY/2s_g6w?cRJM$r?ki{x6Qqw8n˞+icYt;֋Gn;Cxbahفܩ\7otvkk!̦=ٮ=KuQ]6+^%k{ `Vigy>(PahPiYQd`l̬fĽu]x9y`L:I)ů+&<¹ TZ2<^2`YaL'?Gx4N͒Uw;T:qS3-@{N8| Yea`*I^*<g7Xb*j7l*%.˭a|ڌ0olAa32u^P<3G$VVU%׳5ұL7r7s^>{_UX ׏<:ڑK;#X$OaIgp+f繱I##_10; e1a*L5o~~I'};Iws-Ȥ-B龤ǐM*w~hK#*f礏_6xRg`[D?~mz{^c#_Ԙ8-7ܦӯ z ǎ 3{}8}z̢ F&L.}<}-!,_)Ub>[+>,~¶J5#Ç dR(`Y7lNDqmJ{:Z&!:LLtpn۟''tw 9HI*d$d:}!3{u'sK`On'E_B2 CBÚЕ $dG>y7080R~C%e_^q"}2Ai|+5L'Z]m}##˅G%1əHeZ2_ѴNhZw7%h'O9{?c $?`:38y7C~?ldpuY;ty99kȾ:4H051#_Ձ' n{dVveYݜ+ͻ&kˋ X}I?Ȏ gEBe]e}ecʓ僖OX^r߻-oZAUe﫶UPͪT/~!5jvCgVW[1iœ+0ᆟ&-+V^Vʶ*lU֪qW=}op7n)U7ڸ:guW7ZfɚG֜\;rmڧ<06=}A~aMp'_2x#GcqWs=Ǵ!jR w|͎b&v${bZC^Y)A~ _!?}^$N\0+LzfE/=N<ՃҎ HoFB67yG\N99x3q4q>8/^"Ջcɛ(:?y\s2bv20YsVϡUA;E=3|n2ρ+ Ey=0il| ſZ|3/ȅLq 4jƯ ١5\]3޺_'|xhqZ.A!i3Fҡi | _`WMYy ʊƴ#^@oYfy 9Z3|EԅV<56B^O!#|5h<tɧ3|EG3_`喉_rQ BJZ!/|뵼"1ŹFcb5Kޢn##f;DK3ԗ|oh3*nhc:I sf 5]B,"!x >C>ƴ@{kC@!;\1Ez"\OD]}PW<+v=|Mc<)}IeJ k.}/.}+o|[i dilPJR[a Xll X nAumz`ƱN |6J \\YB3Cˤ+Y4kr-)-,V~@@ <|G'S >ciῘpS@>\}߸1#1liy,eqJ:p-KS@7Hid'~ h~T%@-336w^<-2 oKmۦr|_JN/w^Uct>-O~ "Ew޻|].{]4j9Z%TejIG-|C<-}2HU_D=PϵgPa %_B}2[JQg0,!Uo0Ze D}QkjZ'$Ԙwb@+0a#rE= Fv`G3Ue_#QKmp Ame?bځ,Љ @7lQՓ_J/TO'G'S >Q;o'Swi 8Pշ AJکLyLk  p}>V=,rW5H+q|=x A x~''/#}Ҫ!}reGڪ m9 R)q u1NYLE@1Pٝ,f. ߝ泗G4M7It&llg3[᙭Vxf+< lg"NxZ'< O넧u‹Nc:1xL!maX*R״kZ5VxM+^ i״kZ5Vdz=ف^lE/:kVVz=Պ^iEoN ;z'X'I0F;hXl`,V.s1M{_s0'#M8 ~Q'lx̓'1Oc<y2dT_x'}~|elr f͂k7 n3ۯw+&#l?,ez !P`0PFl`40 8`<0LS4c=f|W?<< l<xv|lk635`oooo|ww(u:V@ &6xGH~xO5@.>7>6> l=xj:ԏ";ԣJ  n ^=$@HV?RRT~Wx0R+x6QȀ0 `̀68 @Mh 6&ۄv"( &o&oD $æAq``i$0 rIdZ[R\[|K2:Vk "61?sQ`#3aUit#`vM;J`G;} B0 pix H>@2QOi@_]@`0 o`$0 Fc@ $> LӁL`w \\́WsyUߝ} 7|[umz` On{? <l< x (l< v`xfw^M|'v M-m(2G-c@<]}OFēdD<OFēdD<OFēdD<)<xvS K+F`7ha6]=f32!Y @f5nRO4ޅHoV6އ9 }@l+-ƿl6f#l6"J~e|؁k;Cq\x /;)-\{{q]=`?ĽlgijcD=K lk3$X]6b3,3@;ЁUR)%pK=D@ 0 n ٔ H 0*]l&YM o/Ǜ `lp` YL@ i&ix H>@zʔg~@ X)"C hH`:3ݗrt_}9/=,F1`x\Eȵ#rZ\ˑk9r-bT,lX jj<9$$!jK˜:%zxW5Ut! !]BHBI2X&ˤbT,eRL*I2X&ˤbT,eRL*I2X&ˤbT,eRL*I2X&ˤbT, !@B0 ` eRşa!RZXHk+D'}>OdX8 aħ7cj-ZF_ }a/l􅍾)))))))))))))))6F_ }a/l􅍾"L|-4~ Gq 4#E;8Z ?+&nr+WJ_9蟃9蟃9蟃9ȑ9ȑ9ȑ9ȑC)u丛@*yn9~006uiq;?X0`"x <F?OnF?OnF?O^E?yO^E?yI?9W1^DE齸-"v"b-Bǐ=1d!{ cCǐ=1d!{ cCǐ=1d!{ cCǐ=1d!{ cCv'g$0h'Dtpk4`y^?CSڞ [,Ԁ2-2-2-2-2-2-2-2-2-2-2-2-2-2-2-2-2]&lFM4GԠch&L4|`5n [֠DVj"ZMDh5&DVj"ZMDh5&DVj"ZMDh5&DVj"ZMDh5&D&7?s_A蛉Zs5DLDL:ԑr~לO9[>&k>q"wԨc2[}Bx'y9YNvfW_~[? 8{?~0 `0<a`8F(0Zֻ!i&e,W-CxP0(0Nf(xLVIW_/WTU_:  h h Z mA;t6phá 6phá@f/Aop \ _oz}  `x<!!0 0< Frwe%OjŵX!X 8;j`9qVVVVVV؏~8a?q؏~8a?q؏~8a?q؏~~~~ױհհհհհհհnv8a7q؍nv8a7q؍nv8a7qbnbŻM` `\ 8Ks \u:4YSUx~ϏQ˹$ ,%X `2,X,ÊyX1+Fb+Fb+Fb+a"XbV,ŠEX+a"XbV,ŠEX+a"XbV,ŠEX+a%+XJ6Vldc%+XJ6Vldc(Vb(Vb(Vb(VbUOSeT>U^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^wFa0 .-Յ"YrsԽ19I'42v irv,:mE3_uSXbXl6+dP]s dN7lls@HRK5n P- iP;Cgsdv,RdԺGfZr 2 iljhk"`ŴD5pgMx*>Ɵ˽֧`9^,mC m d@+iZd@w;  WIYx^ ^-`5ⰺV` V`u`u -6k` 6` &` b c2 a! `C?`0 e0Xe00 a `p ^`/se0`*S1******ڒ`* Se0L`J~(Ǩ |a=X٣jwߨVSigj\͒Z+M"zaxqک2X_M.cK孉ogioi7Z\| fXV̸{`"f(e F,`rbBb":r#O9#%3Ooɵ< يA7ΖAZ<9O䉝̗/]]S8>M|\):Y{'WY<;^W"]x.c ؉g+v{x^<"G8O q=?G^.?\,o'*.aRqc!#[D[*7_?Re5 DI=2RLK&% \<πDˉY Oʍ>Z ܷsKo)@Wrkws.Yl V@^nKYEW[-| C~hVV9d*P~\.:| ] hrY@g^>,<Mo q9hZr ҇XC6ז{ځ:qowݘ8ΑaFd>!H``9<^# dT.' L []83{&cb ˡY!ħ"ۉD@Y6X" 9dV2VeH[교k!k6"O"zrJo 7H^L"y99;HOV"'O e=RéyX6Ywi Ymb[Hle`2VMc<8x<'s9dbl&2|>l! ~ ~ >]zd= ⷥ)A|?]_/g㗳R|_+ R|* 𫕬EA|j%+B|VM9l(\dV/azF|266;X͇,X' s5dm0f{dddZl,W'EdL2k&5&n%ȜɈɈa}]ddddd0L"baX,I$`[`[V[VaS&;NdLS&i+Y)LV 'R&(L6 6c5dmdmXi ZCvAvAAFFfFfFf؆T"+ lRYX*߆DF"~#HgD{ha=h۰bQ(Fo#ʷP;uٲAC9}DT"j* vOîatNDk!vMbӹDD(cb<8^>/O8^˧S}5j.\U!^ }??x>yQ:{xTWq%=rzzGO*T!j( ס&P8f Zf#w粊82V^+__c-{wxO.FnxzU!bdX a\ww뿻qb?sNϭ- _%2U"dړKʑ9ʑ++wa=̷0W9T2уїh,Oͪ>"'lSo>hY0f]rdnd^l1{1Ut/u>zk 'ݱov1z&r/Z&}AK Yww ؚ>_1곌6+fR %3aq""BX4"*BwI C CʙX9P= t w`L7{t\Xu?EH]H\g8e ۹HYe ˹ ˹ ˹0Le0 KTȺu~x_ UJiШFVsTQƑM>OlVZVZVgj 8+^.JWJWKgPǩ+lj8[-[-[-uw;VVKaE=lVZVZVZZIv۬N]Ym,8 rJ}֊LrA)wEsDS2 =8yBBg]|w4@c!sdΧs5Gh_ծP+!Ӽͫ]n@.ͪѬͪEWf[1[̙;,Epc"f(:ԍ/p?+nCn[nޭ c`IdS-TK62}LVt PX |>lA|;ҩzJzJsRRRRRRJ*Fϩ(J(J(J&J42^f3^fl1w;Ww[12nEƭY ?:BRx-Yi9^v j[m !pz۹' # kk0SȝL*Fa$6a#6a#6a#&a"a!a!_Gc9:q3:nFTmFTlt/*',Dp8NLp8?B'pKeϠ \WA_p Hm+k XVU`\k:\ϔ/oA&z#EO3Pe{=m@[˗;Aff|ˌrUs\#_2˫xT$~`hf9hZ2Ne;l/1XI-o-zDk ڀ Dp8\ Wp-\n7~r:;ϝ 1#`7s93r,x<^%2x ^L{ -`-rg@>w-Q  @[<w1f{. w0PNs9xX>u;=6M`3lr9a9a9a A ԀZO#O#O#O#OKd^ "`T*@ǢWF >b#A |~>HLMcqx<πgs`,B9ƢXtE`9Xtp~>UӰjVMêi2[7Lxf]xGc Sdzh!ճW1PJpǩr:@T@j+[0+;r%G/IE+U uM?0 Mc# ( ķ~#9GN?rӏ~#GF?2я~d#uh$ jB6HE6?b/H>OX UTa*0@ LSTa*0%%@J B%P D"T*@J B%!K'K'KI[~0 `0<T2`2`2`2`2`iiiiil#Ȧ>l#Ȧ>lcƺuw6mXw 9!X$ڑy۱ڬ6kڬ6kڬ6kd!d!d!^ ؠTJP%#Gf=(((((j5}>DMQӇC!j5}>DMQӇC!j5}>DMQӇC!j5}>DMQӇC!j5}>DMQӇC!Z\o +Q(Jd% YDAV +Q(Jd% YDAV +Q(Jd% YDAV +Q^"^b)RzK%KKKKK+ փ *fYbzTrY_Vjv@*a:HFY.bev+zIPD~e&׬~7ҧomX"rJa *gYr*gYr*gYT*tJ:B%PIG#T*tJ:B%ѧH[ ^oi`:3eV>}YE}>VQU*cXE}>VQ:Ӧδ3mL:Ӧδ3mL:Ӧδ3mL:c2׀Z@ `eHuВ#LЇ yzt/ lmT)6!m2jls Ĕx C!^lzQ!lz|uM㣟'l ~¦ E jG_aS [6Moa[6*!THCz\O4i U{TMQ-ZB(%~^?DC!z~^?DC!z~^?D RuT]A UW+H RuT]A UW+H zD2{˹l`xPFЂThA*wϢ⳨,*>Ϣ⳨,*>Ϣ⳨,*>Ϣ⳨,*>Ϣ⳨,*>Ϣ⳨,*>Ϣ⳨,*>ⳎZ䟔;J^K<[E[I'^!nRSō 2&yXeȫڰFv˗Z+Y#W&Rnb \F?OfKTYZ,tste7 "f-Ke 1- YhU ?qH3>5fW^ֲN^$6EZrd.vԏ-wڹpmSc#wc]#y w;iX^J*S~HB[]-;9jh&Ֆ U44Vӏj&zl(J=&RkTCb"#˔ ].`xA?@4M \ sŅ`/')4x< /"Q,U*Ё^|hZh AAtǁ zrr`&GDx<OV%2x ^U=]WuKiVaX"]5h5%Z-Vkꥡ54keoR=%!/MiZ=1WIC78߄Ep0Q`4i`,ޑ,0 9!| >s<0| tXE`1Xe |7`X 6f l!A.zkxۖ;8 Βylۍ`*i>c>< @:,b,n g`[V#̵bT*T&)hr@Gp5C|!0L/mm=^n,s=m_p 7˭޻TοG^nMr{RsWqte7 ` }Ļx>G/IE+U uM0 ̖a*p5 ׂƂq`<cqx<πgsy^/W50LSKd9IBgOhTrxMHc>?ag٦mg٦mg٦mg٦mg٦mg٦mg٦mg٦mg٦mg٦mp)"jgҳFYQЩS;7wnܬΖ%#|hZ+wXŦiD|VMF9S)Lglz&ɦglziASѓLFa#D l(}@>q+6bh¹mp~/ѿKWIt Ozߐ3X-k9{Vˈ;89L DopǩmѰ:[n0q_Drf Gq7k5a9G9(qF/t[xLIЄo[i ur̯F}#H0F1Ƃq7|oz{ӣ'Mݛ޻7vo_ni;Z־’_3Z~Nu݇bZ]hBݕt][;1w6P~V"m,&s)<汱tO*Lq:l*:Dg9k]̙ߝ)&xvOa{axXJ>O& /pw2w&sgwQ.E!YJQ7=LMGQޔ/y1B677#7#7#7#760 Oxbej9o#gA6J|DrUgOgo0Z 0bX͈IVТ8 J><ĕaO&!5<ditXzPUE`]AOv&yvvq.}Br~1Yg1m6lAC̵˩Kș:c@=-_[q99rUA6?#>tއd'>$; ۣ1CbmhzR'vD{y wI#w'wOݿKp ݊'NɊ82^99GflGflN[E~a8Sn`&76߆ ūFFf,o<|ed+aNp/o `8]bd*0ɋDO3Y鉂2Yi A0`& b0#h5_ ]D-yJn/ꑯ;)`2I،QjQ4e#BzGzGzGzq'{hG40VaƦr#gy`:r0᧫ӿWiʗ;V^ar)8_\^_$CLG -xqVQ2b9kB8so 9w4nbs sG1c:,v`/O}{]pOȧ;:c,D ޞ:LGjNwZǵZ/zЁ]&ފ#z gՙ]8ߍ=8ߓ;$pfrj\*WdδmEgkETSyHn8_%gh퐵$Fqގޝk=vi}[^22ewdN^\\?=8ד뽸~<i͸ɜmdh#Ν tz7ptӋ{gesda,Ïqp#C+d;V{w\A4(;>%ֹvU> _7nV?Ai,%q:ծj#d~dd tOc)5lԑvXNVoպ.[5)0r"帝4A3`;s un8s_}x&͢9ghIۊJUVQ5ubq".W*f{7 rv#ȿb*_;ܵʽH[ܳ:R3ru%"$q)NWF/L-'qxN] >"{I9eL-Q̈(bY9ElVR5?Errأܩ)l.(W*peQ_{e::(oIYlPg*g)g(?}˕ ++?WW+ש+77)}[[ww*W{ʕjr:B/iy:I T+5]]j%SI)nV Q{H jcUSMQ\m>>S-VmEmh{M=z\~z~~z>LRQF_п3zAoҋԷ]y|Xj޳ٳUWCBOݳ۳[)y= uS{bZijϳOԫQ~ãD1FZF[݌4qq8ٸƸA;͸xT;xxBxxVӘdLmdmfcL1kooiY,m񑑮=h|n,62Z#[{b^5vykFѦF6ofWCy<߼Hl^b^?ն7j;B?]ZyyۼET3U͇rs9Vo7'Ϙ9ɜ{77ts|Ӝ2gd#s\aO079ifYcVuf)z{y{7yO={~lwzH{n޿Wy{z^A{>{A}ww>›MGz{>}Z}>;;I}>;;Mw#G3޹޹*^9o_ƽq}RO1IO$JF.>+CRg}vRפ[|)S_?_?}>_w7oooo77Z_{7N_{oo^mm_^o7_tsM}˴zNnd[[$!ka=lF[#Fzz8zz8lelcckͶ>6γYX_XK˭e2J++*kkqɸ ZA6+ [a+HvZƽ^+n1 q5aL x@@\mJ}js1%+x30.0Θxx+TyKW&s^7f6f7h6ib,mҢIcmM:636 G.uYk ^r,鲄c(y+ptgVW^"#Ls5"k1 ^IyǀeG ,?⾭}6Hjs9ҖP?%xyurb]2*WɢQQe," NSfHT,+8d<]d1vp%.f{u\/s|(ߑo} r{xP{G=(xз;{G>u A*Dw3^8SUp+R7Xrk=>,%샌;mSr' q4䈣5?o ^g's/ q¹b牭H\)Eܤ()b(?0#.^T(HSsB1V-QKējD#rzsZ֊z^bӛELnnk)]bpZ) "XfdFMdҐbӉNO'BubӉ>VVZV5Nluz ek(yN;RJk(NT:RJG( NwUmįMZ7iěԩ1(7ib6g)J}??Rn^sʇW:~?/ˡ*Q]mX!>MJ"ljVtq~S4]zzzGAe rHVw;DK5O)ڨjh]k[_[זThQVx;/5r~|ݎ77>}ӝBwEBwKt[rZtczh z7;Nw,Z}>oˉw\i^ə̫i^m^-f_;qr-^G$w>_LbVͼͼ]450=;n5wH!穁`b>ęP2#4?61|c{y ͼϘru93//KK93S)H2՜Sd77yj9Y3ۜ͝qcs.3|3Yh.Bb8Yb.A*\˘M<6Isf\3Ot5B8e0WǙ{(LaXaV!sY͝13f-}_g1rY fhi73{ȳҔWzD''N6l;لw d&Mx'l$OyS89EXGxO͜"42K[!oWfNeD;LhivVVU$nkHbX%UjV*c߶l/ʹª^hoX5SkŹΪj V%EۀZtz@0D W $|us䵖iH&ny=]D@@W8#Ѓ}r}xYf⩷o3l|7hdC9P4shF4 _fCp*ȃ _HmdC*F&c_5{57v`}nlnlnJSPnQn}2x  K^'T7K&%dI%,͉Ԩ<̓-~̀4]E r}͵[[DGVlN.v;yonP,Zx} fnKv>%>/5/%z/3/_q:9J즹p[[8M37 8nnv٭=-EX~y7c{?NΗtaN35Gxv9fqqw2t|ss<guz//s}^7wf=ݜAY--6&cN<W]cu?^D:Hr>q?cr>r;q9DuO Y|':?=O_.Wy:zN{\8J=q^f }wX'갧mK|x|9|^KsOdd)r娟BOɏus1_䆟3߾V`#:<~ d@+9Sfg W!rc[?͜5I(qmXſ#?v3Y;qٕkF0w*Ϳ\ң$/=]C姇 gAiS~СrK'p~zB#r9H=:F;X.yFșKw森+v;[!blzc}OƻL]{ kX@~Ԙ6qPF8SWCʃUS{.G՞ynyh'u森7Lc%Sqw[ft͑sܟwbEBK2JpȜddUp9D8&GZ._%l%Һr롣Ng`_yw3Z?|G$?UnF]J8? FZ721am%r.&ߑ~GwFWrb9Wu`Ī^~1e]=^WG]oJ׭|=SuOqo0$FG}:uXŇTtuuxA48]?CwF~r|D>&o$֡bL~2~ې >OHX|3]p_ DO_oxkC% ?n y/oDwP6?w&&_,wo|Wc ~c1YQ(ܗ>J"ÜoVMHO'Xqc>o>}q\>-5fXZw}+k6o7O&(#id8fu>noQVg M黏>b|7c9O'G[-C_Q{_-xo&~F)=5A:oE Z68Q,H??4?ǿ7j}b>wؿ#zyikR5@#7ez0lmvڗ~a iӟ|]%oc߽Ko IO&2$܏Nw^zɃ3w`d&3Sb|tS0_Dcۥo*X24o+灿o?'=77XxaWǥ7_K{|R:d眅Ӎ{חǿi,w/+뤎\|Q7OGǭߤ>l?Mk0v+7mο?PFOp/?)Im +;ƸkPPg9*ߡ[M%Ep,yc5HyB%e :N׊avL`̌¼tgrg&C4;whv:f#e|ag6'Ghv:>9Fӑ/Ugul+FN(Hΰ_;o߰`w{%v?;GÎ_5}}r=' h2&Œ4 s3)di4&3Un,_DcV9%frOnA:'[$kdrL$ҬoL=Lhh7FO31EbcT)f0fiVR|h7{c|o{c4ӧRYAs1oo;4xc6o̻4xcGs1G7>g4nfwc4A< yX׍NI4(>;>A3BC7lΣjэX ƶX?,9> S)lǰ| ]?§7i5f\c?goѼkJwͻ~/oӼkh5v]cDмkٯмk?nدk}} vٯm4f_cIkwo{^} {9o( Cً4+GΏG2hV6fe13"e4lzdjd,.rVdlfdndȧ#D>ȹȲ2YVdyd*YNdu˲"ȞGdDDɊhv7li`7߀-)!:9i%6(a `a2f$Ā}lВd &g1x`_Y :yr.\s.wBf)c1`π $`>OaV՞V{6Zhsj[v,CǤ9 |.ZsyȧshcЦhcЦǡMmSh Ц'M*yn!_#C`SʧO+w'OC[r,~ X# ~2dchh3??dffYDY")  !{@? e = k,C 7@ }E|׺߯~߯wOH<(_Jd-j)5d uPA [$<ʷI.&J_!Eԯ12O1M1̦ޅw9Fd*~JRT?#r ω)h2%_*~Ixiid I$$y^qLSZk 7Q\Td2y* kkd⏊?±]W\OPSAϊ?b_or,89)0"8 '\$ErS)D @h.唜՝q $\%\*((OҠc\{E\Eܓ\6lh'˅mps@=.h/ ܳ0BWB<YΕEE8旹OyqopjbN{rYI g@FG>3"gDdșPOL<MLvPnG$p;@ $p;@ $p;Hv9vzE*G͇kQA}ATZFm$l?Em:?>ϟ0NI$SH @A.N I&,F<*5I Lz7 FcL*XnH`ЧYp@nCY@{ /Av ~$ yDBг[膞=B/q& +`d࠰JVApk50PE?( BK—`u:Xy\X/'OPJ2n$ B}+ k.|6$K.lvo H0 --wA}ayLa?p ?~= a/@( l?.39)=%q~!B/I`38$r$EwGhJDõ'Gc?B[+ɬEQ> -I$iR> 4H$i ̮t9ițÌc%c%(JdȌ+"3V!3Gf 2d3&Q`(0DaQ`hߣ= ߣ=S1L= =1O5=/cZߓL} h&9 4$Lˤ+̫?@;2 xAv͝ȟF.ɼ )#ۤ ,|o1"N{א?, Y s Yl~K Cr04 3 M C`i?Sg夘f'S|u vG?q쏁S.{= ?f-z9 `d f0¬nYߡCC4[2f6Jcu({4Qgiٛ8IƌG2FB=J)d G(M6E6ZFޟ?yl, )ϖ= )Y:ld9LY&ԳdY g9 <YyR)1-+x [9 |^H`>W%u$2 ;? ?+0)E_6)'s2MŜL1'S-F LUB<>0Pbc#'(*?Z(?,2d3WWARN_>9},rr,@6l~rc@v^<yyrr9%A|.S.^,\ȳ#[W DnZ:ȭ[@,~)'!泡=ϑ|>C^% @ơ1L)_οT|5kk:^_4)F8 L4)w.ͻa+/%-| ,p4)f&fn_I0)?σ8'#;;+waU~ lEcA@~")(+1y^Ę_iS3y` <0)h'Bv#!)g) #1y"xL3 )f&3<{Ʉxf 3y # A΅f 0S y$^`2!z",8#Q E%Q( H[ =򀤹a.iE梛a#SfNI%R9ӤxnJ;Lurv̂(00yBC `,iF, biCpB|BcGZRh|'0>y&D)O`YП' a<`4<D/^ 2k]uw}ꫣאD^ u03> 0saf.L̅r̼+Ȗ_n=%8Af``pppp0 8 AUY"ayHY\@X1ɳdL=Ԝ2e>E KAmy%ct@hsC1O㛂~N}Y0Qm961/6XdjS?V}e_7c XU` ȕPhZOXl׼dbfmknZO^<2yG`cc^Fa{Q0 ˚Olѭ[6h,l\SU{E'yT }ίgxt=DB@EM_qKxW$Gك{Yr@tcu?A̟Luj" >r_]+ |kzT]zgUװXGWow7nh  ˡ~CZhaFh nu8FÀ m1jC$2LRl FC àO2luLe&e!_TO_:Fna/E,0Kutp7?p$CeF+uB7Q[n3e᳃?cd}A*}Ab@^xI1coenL }JcocwuE/Ϻպr}Gغcccޱ ]J{:6C}C;T# a=qqOaf멎} g:N-ӁuZCv🵑NgwڄN/dTTvƅy-3o-3iݧlY}+l9}l}kmE}me}l}[鬅 #1t.Fyzh5t.]NM.k]oMio3tzVA<=wu7lCbe7bisa\Ј?w˱Ε 1Vvb 1/]sӹmyދ  tnJnΝöֶs_)΃}gx69w޶X%9WmÝ'!ȺoʥĶ4x _\Qz@4VC5h;yѿƿKl':Hdi/-͔$DKs$ G46y}iXGYd;yӿvaWa./#֥dʒbזăA%1!Q6Kĸri}$?ڤ\ڡ%nIc.m$Ք-5)qID?.u5,)8ȥMKJ7] MKԏqגK,m*[_k\bKcoKwvAb,m6vvs|e}wv+Hww 9w[e\;]gVbLg4.v/0}W=:cfXF'TcEJֲہҧ(6tw[CjuKR0ʸ%{qMKF ^+V ׵dwo,Ɩ--ۍZJwww1nQR׽C(,>rQ 8Ң>e%G_y㹖KƋ-+-˺ hEs[V7[Vu-k{)e}^ݲ)`7Ŵl L-GPoo]"s5%IPgI6I3e0o9խ2e^`k9ߓi*lԓc*iړo*oT}=EVJzJM Z ӢVƤk7YZzLךc0ufL֜iYk~OiEkU=E\ZPַMZ뻷6{vzL{Zm=M[]=C=l:3d:a*oo:պgXw3={M[Ww.0]mrusa3i9jZwծVB^zNZ[Lk5gQ9lsQ녞k=57zn^`2m|lhSҶ8ikKUJ{qƙ[҃cf[Vo:TH1 mJt@[Yoyu[eoyд7Wol6\@мM[lj3w{+mZ¶P"Ũ߼-ػ|WCK^;}gғgyYd| {6O}'VnknJOoyԾw)m]17mػN’a\#,3șq!`9Na2ah6Leٙd>JKȃ K$AQx$*\ 7IR|_}BV(IV(u["9Gi"~$SI$F2hDG$ ? I)"b&Ta;N<$ $12fSaļ| k1>GeZAyi/tߒo˿tߑɷ1˿'3 [>*QQi s_3ˬAGWtFtt+n29grOpgB f{+c\9WrBV-tly9?$n 7 swMl%}sㆸp#p'Xw;vpl'!w]Bvq箲}5&,DDoEF<`ģW"#fE̋{#+ًLx;bPnĐl:#K1}Y2=,='dy'# "~G |:]V>?+,˵M I..rR,aB,kY37~:3 7E`gwFf&Zf/}c0?$G̏1sQ`#23I3vs Bb|^/&mג5|w’(*5%45KRa[,jb, r(ՖAfːeeزrrrr2j9k`lfaeUi&ZSPkZiη.j&걶[(kߺҺƺκѺźͺӺۺA$s֋+֛69[-QFarf_xPǠOC-ZZjyuiu~?)!&jvj\b|{9yͥσ6/9`0;/6W6W2c> ߞFmAme1#y |y7f6wL0f9'1 HmG'M>ͼӱZׁ}\ͻ{A͵<8buu>c擎S[ͧg~@Kc>8o]ׁ}\&E%j%Uuǘuy]vc$`규w^\r^'`ku~W cVbuVlqV@+nt}" ŵm,Nk+r]])[kup4WmtemkĚʵUu^Q EP*V*Bv2l]ö6[,ʰ-t uqГIu⾄ue]'%()01 pKsΫ$ T _IXt?tikwmAwCOVlkܩԾֹ3mtg۶msRێ n. gnwm[Ev]GmĽN:&{[g;ιn튻vBI} ?)&j:7ESb.޽)ɽ }ONGcRH>% 1Qؔ^K)ý~>pG >[S{mk[ކ/ϢtvKB'>6Wh*qR}$L7NHOT~1>M*g-s%"&lν ۛwѤsi79܇|#s0|jto OQ[Դ}m4vڹ`s/[t sn9ebnQ=ٴ}Z[zզM1zM[=i6m=]i'8$W~юO?FInjz=8a|{tHZqs .;9VR!{:Cm\GQSQPnC74_Ͳ{aP9O)1:94{f'0'p,YЦQOyu|:T|R>2Go#[X[X[Lt[faD9Oб1W6Q{vaea#q:c8OlO) ͱɷ (o C≷N.(q ];y( N^hf">Q5Q]9=V-&w-M< wͫ30j:Ikɤh^]Pn>ۡWTp)x*챞'xɞ͞QSaP?=x ^iE>R<eƳ<<霰7xV՞nlnl R uoNj&g͹^;0^+e ͕޾Zo|5fwcݻFosw'28w7.>4{64k^=)h=ݼ{y"K6yJnu:>'7# ] cڧ/0>!W.+еnPAY7ۡ}Ow@wXw ݨU*gut~\]гz^)t}>>F_//ї+( uŢMzޣo}~J:F6Nn>A]O@1Iir/@x|hO@Go~PsX|:>A㉉Xȃ%ħЇih > }>OCic4q|OC4t> ͂9wd(ih.> OCƧCk B|&,>Dg%Lt>}IfI>}3h>} V3*|&b0Rt1]LD_ŧaƼǼGL |&(_.1FK>@ _kp-w[]@r :EvjCeUڵXk/ij q:AK%tZ[۵{GyH{q)Zް@o&O5{8h9\\+Jh Cy$hGՏ)>'&Qm]x A,h&'qP@ G x~[<|󟃆ѻ>z>8{TMc5y pG$ħܳ~YxĻϴb"9[CU>M΢c55EYG*,:^sHsD,:.Z(D]3PӢK%pei.\aLK‰EWdEWM&O4W*Rɹs|mQ\RTYEښ̥z(irGԶji1nҀ[`;][a<#T&s֥u3A]5p~pz&r}*upLE7_;Hn+.:vvs7in/:;݁eX;kڃ>X k]t+ukG'hѭӎEQ{ZjhVmkta\^(jvRF=ۧ;:6WjIҝ]#+D5RFm0շ+ٮ[3g6SwF5GQ3x1}G gǀp7[/%r  ܱJ-_/u0xF4W4CUvҜ Nmםև4{+kp.~~;]=Pl$Xq7')83tN{Wcb Atfb@Pamvؐ42 9QC>_[CP0=>AWk1C(jC@ :~@"8yjQYmnaqZAɒoѲz kD[gQZ,Z%Z3.K%ݒe5E7 mrRlQjG-eHep+TĢ0Χ6ɸР6jG5G&Ы!ː#5HҸFҨޤ4cƍ-mƝ}ڳgtk#Z`< sƋp?j.ɸfجv$7EbL0GL m)۔g*J`SImզ:8ʴȤ3YLa9S)dZL+U0hLka!?æAݴ h5PM[MM:vjLLGLMLgLMayjj3ԛ)Xk̂9֜`N6b̙sȦPi"UC<_3L¨{H:J\(P PeƆu%Zu-͇ m@1A88v(*k/>b0!ѰȐ1Q`!((&#)yy"eF+ 9%ӈq'aG`*2^: l@GPK"*J=P'k\pdaHNEKjqYHYxT OM{K?k#pHDG3"j};DXe{=Q:IcJH$߁{ |R@=Ps&X6㞀uvGgO{A3Ce,3 >+:/ɨ(>[c;a{Gb3`ގʃd{a;6r˾T~L/ktrҵ=}1Mؔ6@ṅ>C8tU\_yppEԿT9UQ}m&ɪx@R#FѾw^q>WOϷPU%c"p?.VcZ 0ݭ1*U+>q&t\鱬j;G?H^j˞{N\w,h_' 8&N?v_&ljUuDjQ> |PR?pS-ExHvudznzݢO;j¾?J\8񞫄IMI  | dTT9vg>{ , wN;9Vhe#'i!i]hk@j܆o5ۥ6S;&FVɖ=ʼnLE=^'9$2$;G|t Wxk( :2g^H,̛6(oA׽̉]vVom)jTV T9V_=+jՀ?6.T*K6@Mt`5PS2IWq@GA\S1E?Y`!@0+k[$lNNI+&!\l1ұ]p|< *O,3yΙ/*qN-'wBeUMre.i^nϤGgn-u.}eZ\,L^֊lIjMB$n-^D ɷiLCG*WA_::::Y-'S3*/UgK%ʽPJ˫UPʂE G:T z@| 0Cs l`X+.n;뵸S =Onq趹8B*>)ڡ'/RCx !lb}`=O1zsnz>(\\Y*V%ߌ}DYp8>\t 5^tևPP@iEy*ey&sma~Fq[YhGy  ^h-?6\Ù0!8 9ϐ$I D$g # AD"Id$'I$Iɒ3W \z}Κwڵj׮]Xd#B^p#=I_ eVJ_7h6M?![{57WaG,=8HBisM g@o3Yׁ [v}BBrEti`Åx M (g;Dk\\|HA-%yqh\s=B`<f3^ԎW?=\\ѰH#ss̯4>^7cM֐<JN"4$BC"4$+Σ<8=:}dnι>F4vuS4GPE"/INzY:xbޮB(h.͋n?cM;7 ꞁ5BA@Om뢹#q[o]V1p0ك,DA|l+E@Մ_BL $l1 `jXc)d`.]8ߋz/lBYD,5M5D[yW'PkK**s"gnB=7`N<ّh^ i vF1}u&t+JA!׋ iul8`r`V\80ɮLi/uD{H: {1y' y$=qؑS/;Pڞߡ̠CJwjBU PkRk'2tGieA xg$*[D[c֤U3 J7xPYQzh?YubZ;VC6eyБyʚD-7ƫIz ШMB\1XsHCsh 3AW}dy*ܙ}gW\а])yBsD?a^ (µ6B[a&coZe*&m]^fLGT΍)/z u!/z[hi(-il[ԚCh?4<.|3I_ l+ς,HhDQx:IhΆLAxEIʡٛ;4'J[CW] kFV0+`E$q;VHG` 8܂M#skIk-">)oFndq'=zp!0xJie^@2,fݑa(z$ VG#qjlh\'0aW'Ekdǵ ))h^\.63'I3Tm3-؟Wy Rׇd+c#vK`CҏZdb,S@en$+Rl44}ܢKy l Oҝg(kco{">r<ȊGzcGP(*B?u?8F:cM4Shks}fmp2G>OAIcM; id[FYZkA`SB̅T"vij\%Zb}?1 ǼQpvhA^菶2k(uh)ckd4^fZgO K)l@, a_wAD-< zگt-s3e'tb*@s'h zJc!з<ǰۚ͸gb{n1Ca( X.yƌYMm3pXFp xf-[M+S '#:hz#_%ȽZ0G^ 9fz~M~B|シ; )y]2(Fі 'XҎX{/ńTjW2fW;i H? Yo7pw+Zyzd~\,qI^lrMah3ťb׶07jKCɏGȡG̅TEuq;wkIOB~^6W0iIhDߠ1:= $NFPG,] v#&;ǸžKxKS"ˇZ!|MqwΨuO-0.ӱo}iWnF;߅\2C{s+ ߣ|I4+i]@ tYxB%=ܠՈXqބ c "'͈76{*g=ȸ;6"T**fr עsh-OMu"% 2i5g_OjO0+i{GIG{v9 :yH6 >\ |J TiL&V $OO̽Y 4u^ m?|Q;%䂐=6{4=58 Z#A)8mЮ#Im2UԆ,$2p+p%:$~L<2C!qkp7 qW;P Ei4 w@28DN7'x?@DwSL"d2}Zu!/e/u>$ $@/&Ihhptz`"  ^\0"zS`d>I|tD}]|x -xՓX d^\2Ii#?s}Ơ !lUfSiQNG3=FjL , Ҿ֗8ڞį~ 0<$qi@+_D*=)wD?na7z#;AeB~kb+t=Pb*'hb4y sق"#Hʥ as#Qw<@ؓAHJ1} tБZWQh1kNvNB4X.c@3=,&rΈ=ZC1JDmv+Dn%Ǎ&$K@Hdf7*3c8nB9J2J-y Ps9 ]^t*+ "R)q~+.h=]n~r_=,!"Zk FӂG72W{/а$ tAWO|D-t..{-]G (@WOo`e2-$7[@G@/!h7bP'0OFhʤ) ?C5uI@)p}qשp/F·)2$WQAa{%$xHtXw:†h'ťHld  si-3hq˸K>@(sђ !oZ ͅ`}hF@|Cg14#,?v$CO1 e< mZ&Qn-p7u/gϩSb ́x8 \]\b=u$pFh' ;L4;CMfIDhIoeiжt'Muk 6gMsR;mY m[E4?H 3PJ*KVK Әu b$:)\̡D"h+虲 y>XPqoQˡ#A( q" A^PA;C)&<[h4H&d V_H%@'яՠC:4$k/p Ϭ%q &E4E3i}=HE ~V:`z`>BM#z0YZOAtu=t5i+Z"3Fwpпp c̴N< \BhN( {qHVGiB28팠;pp=֠k3؋J>X \ ||H&m`{QH~g=ǀ ZVQH?襠&k@NDV:wt6n1" tw=` `,5q lw@&mw xQvFpCCr8k\Mpk],`I\wQ K 3wB~0- zm6 ml_"Х!X9"-hL%hX ?z q(1V\ cyG]=B&aOQuWYfrgbFАCQ:dɮ'㺙`.8q- KkA 7Z-Aׅ"=A ?]YWmpboݘ9h3LNA+$ 7R!;G]#8|76,;jLw6=?䧀&#hD̴m8 Ĝ2-G 3<>Tfc D- Ս6uqB by$?ǍPSHY%.sM{>x˄[[(5 /d1`M:c3M#`y By P(-@7ep7AgGw*{ЭAg !GkE)} 3;@/}XL@]W>',p@oG{B ~&KAOMր ̉P7 2e@Ai,&@ź ̏7Qk3-t[%QwQ 7wB~0-Bw~fTЉq!EKCr@ԗ픐 (iLhe$/Ei42,+6]_|Ȉ\G@dWdhsDZ06J.ZW?:[ =hE 9z&f1X2caIWlpboh5y7ĜG m㘏Q׈.ߍ*pv>$<\C-ۣC~ 8n06KD+:Va܍@rj}1w>cL%o6ۀ'DB pdՆInvG )a "( |X&|Ղ mBy $"ui>9nCw,IiTIoɉ"#~7 NcB0ҫVWm+6fdatȇo]Cqod18N-p> aztD]B TdXW݉_H,=uP<'OaLT޽Ÿc>U{A78H4J˃$.mu 0W8i2a lc.4S~ Y~йPjn S DnPڋ:I'dg9KiDd'R{<=? .F?}  y\A(6|\:dzލҎ^˩%Y0 z*+T?q=:iޔHw#⟡1] m!.SdlXiM1} Gq ͳ Vp6G_'q'QzJuit\49OTs Zm;EX23u}/k=щq98PgSIˠhU!N\4A Zlu$#ˆC#$fJ}@2fEi!W 2ad1>nHf;A%NX$V4G @lGhpNAhpJC68//h9xczpV¸c@>ZQ 9~QBi\x2k9*A`CHv9|<$e$Z=x24$#pHG\-b+OiJ^"ܵGYUga o6z[kTnB[hHgmEdqjwF{s5e6C ox/->oNԥ߸sh9*Zn\%̓pkjEkz6d;n =<=Fٍ~=X~,K+(#2Ci$z]= |1^eQ E8RdbM9|99Ƃ'[oK zzZ]snat6" V@q΁B HY^ >F,Ғ I_AW6Z~ b+&bݣ81<ƫV[W%nSZ|  :yP7=˨uFx#%131ޝFBO|ƈ.ۜ؈?Oķ0c@ǀ.HoG'75?[[>w]w @ijA@̷/_0B ZÂx.@n:1&WjOƂwkJOdI D-hIIM@@} 𨄓\z߃Ko뤷8BCQEf?@(;;6/V3([~tcM2vOod];][Vtlי]ee(Wn$ [\$kKRKY$ˡB$+˪z%~s,b6ٓO|,R VUeuz__=6c]ه?MCYbXjVbojm֚ud5a#؍fXc3 ^cYzVUfX].kmoMb=Y_6 gW- tk)/oF00 XX Xen:&VX`-;}Às+[g[ulָ|ԪsNsBS}@ F#tm,, ll/ع{'s,ppp.p1p9p pS.-;ہHW2 02~`h}R9Łetm٪K&VX``nzdx(x4lBn;7t2:|Dh3ح[t , , l  XО[c!  <*A-O } h0``ncsE%倕}5̀m]r q(KoR?WQqfЙ3:* ^#uts Pęx{3$f; ȿ;^⩿RXJ J $_:ffYcV_8rU:e,Vp,/V<cloGE@".zabX(։┸&JdqYU6do9LN ܧk krᯜxx B/f\_=zYxS <+_9o+IyT9^9y۟~6|5+^87k+q.t s{{Jlw</z;&w,+{z/"װ{_WF@W r~ïx^2M ErjyWΫr^Q,VUҖiDZ6| u aze 5c cVjX&;C&UYUM^ i)5=2k􎪫dSӭ f"P9PGc@]ԻPiw%U&Enӯ8T1>Nu }vBNuJnWn֥Sǭ;_I^$/{W<[ ^R%5QR-܇G /9(9l?z9v"T[5 T TV߬63KidSp/?Pj>MƓ~l1ľ36\x6A$DJb_t"$2l)r)"ZbSE6'۬oE|,bĶOŧl+Ʋbv8-kBKdy$*\ȩr*F1fK%/`6[f[-/d7f7/bv7͞fO^ъum牁@a4uU.*|ҧ2L2ʬ2PUeUv]*Lr2\UyeJ_嗩TU!UHQETVUEe*t*)ӫR̠ʨ22*TyU^Fʪ̤&2JRdfFYT;NfUT'MuQ]dv@PUwST=e.PVT?G Pd^5X T05LF2FT#e5FX5VRxYXMTe5IM)j,ifj%Kj,檹 5_͗BPVbYF-UKeYL-Է[ZVjZ-+j֫ڤ6j"mjvڥvj#R߫e ATYKRdmQQGQYWWe=uRiuZ~V?ꦺ);|GSd#@=Gl9C)XOzyfbYg'D 9D旕utsf 0[Xlcalgc̮fWjƙq,Td)TsʣD!Yhҳx~C1Z:3al fl9[Ƕ0;γkx !BB>ı{Ho{|cϐ1NS}q c8cϐOc\` Gȧ8 =0B>ñ{p{|cϐSˍ1.d4C# {aB=$^c{w Yfge,3ɳd"S#022tFRaabQ)]Vs|X~-r%w=r^?n#h[r\T8-M_\9Zj.]' r$Un1r>_ΧmbknZ;cOlFwygv+'l̆OY<gl8{H6ֳ 6c6}d6Met6ͤl6e|@ǃEl1[–7l߲l%[V5lmb߱lvdnGǑ>쐎*?#(;Ǝ줎1;~f/:\`%v]aWٯ:\g7Mvfw]!{'7=cYKdIڍ-ꈺ/ DCh${h*梅h)Z֢h+ډx_tDgEĊ qBiqF$Ί98/.Ⓒ,WqM\7_#n;⮸'x$'7T<EHI:w)4)-iK eYW֓{l.; 9X/rF.r\+<$yT yR<+/F $_\q8f7N'Siq8gb7.Keqոf\7n7[mq׸g7Gcxf<7D# avY]ޮ`W+ٕ*vU]~ˮa״kٵ:v]]~n`7߱ڍ&vSnaԟVv'Ŏ?8i?{Ocoڟ؃S;j?۟#({=k${=ŞjO3,+{^l/_ {^g7Mwf{fow;]n{g`CaG}>fO'Si}>gb/Ke}վf_o7[m}׾g?vh's<{^h߷Gc/}?q>r8;}~Ng3 q>u❡03g3r&9)Tg3ݙtf9_99\g3Y,t9K72gY|lv8[mvg|w8CaGs9p~q.8+ίus׹R>Ӆs>SVQ^ߏF]vR6Mi?XoYc9QNd_ºu[Wn*WVF18g/Lfcpu_B,;ڿD]>WXKâ_Cg@ IGg} g0jŠM(K;qgƓ}DQgܧGI;5~gTS$*iTI#t%@hB׸K9/$CI(JT%iQBE+*?P%EE&EQL/__lOš Kk_]7kfnc?+YYm2:P:kc뿸*ÿ_ VWvz]WŲ:<(逸3߼:4uT{S_vN/@@X E <2*:&6HHx- dd d d d v🯷*DVd*T%wك5xߟ:|9zRXoU9eFUH:[Zˌg9xޚmy[VY!> .7+q<ħ&|%?Z"},zYO `)L Qbb{i2 t.\Jbdm1<یVؽ3f531xZGOͧ<[CykYyvk5綦[ y~kVY;yyku׷Yxu7~~-tn[[I:7hK5viɗӗo|1WW{++ÿ|}**|:?CFF%מ~~ߒgq^g:':yW{No<0=p^ ~$RI-<|<^Zg%^I/.x5f|"޲͚f:3hfF(3jf39̜f.3k3fY,GQ~'I~gO,/ u~Ð!M>s eҿ3tW ; ɑ~dЖˮ{{iǧZ\%Jʳ ,b '{5a c'k?c)ه7KOZ=;x(Kh3,#ގyMZ,RF,FafyGdy?sz(rpX='zdf;.} 7+*:5]f ˫-AĈ1E[>:c#茱hLfxcG1??01q쿠s>N_IXZXN2d):c1:z 3+cXQŠX++uVBz}%KƗRLӲ#)j齌葥FF|:{_~+~_otWtc$e_COc"iQyzQ^W#VMJ zgB=":xO_;УG^a)x;^x}bYذv y{8l)3˒=cYz[ŲcEN6+ZSIg Xo,fڿkI6ccV࿰u M~mѫ]U l^-_8i1dbgu.]Yn"9БP>`ve`-V(Pu2/ۈk4 #aX?x?)ʛj.n{2%ՅJĿYu͔C q#I!qDl!PqA )ġdCCaC)R"Foo=rFp?ӭx^Uyݺ=t2| >/o{Am3W-?&҈"ȥ[ҽϡmFz{Mxq86%ql/cK^Vzѱ5/c^"J.&t4Vip\mzshhqS8n%1c/9I0:%q\ϩ#A2 }Gc#SAxyA-#t klŋhl_؆w?4vн1W+qK^Cd3 ߔWtOjOCF7t-zgkL4&B}ُ4˩gUcvl6 gc6-f+cG 7#7#7#7 #l6lFq.FnFn>Fn/O Si`x,Osf$cx["V0tA\`Z݉k#iڤjGDWǓ =!:B1Ri8"@|5- ސէ{_Xt}E''rzTJu+lkwwwwJ( e*KܟO'9:91Xg3ޙLttV95Zglt693Ys޹\v:ל-s/`|?`@r1B"E%%oJJ TPTJ*\=Q*Jd6vz5W8 .oɰ+ Žr\¬oX k[uަ*,5Ut~sf]\W7n$wܧ[Xk`X`XkwC'QBJ+XzDskWF_8>B~X!cv̂EϋzQ;?=QU-2z?GwOa 000g g83%3353 3-3B[jkcZtXS?S?^݀셺itVG}#r`Mx OX~?ϼl H%҉"b4[mf7SeRUV]TU^_ŨB**ʩjZ6ꤺTwS}jWjƪjijfjZjVTZ^mR[6CR{u@R?:NMuGSԣUw.޹,Tm^KwL3/wej!Mسj{^:G/,j75-ƢU:}LϴCϱ^h-/zgdyOEzҧiڋݗK?G/}^4o^՟g'^^}^hipoz,:ˮF|^ cx泥zmf;0;g,濂ztOVvzK=A9?iz%J~~ݗջ{&#M?a|<~Hg KӶ_u} WK;l&5Rtj+zUM"޷,_] SӹD.M5Gajj:4YL1ESTMO UUaV_4+1iV6o5݁ϲ^{j9!fF3zt\ l!31Dy! . =opQpwhzSʨ s$tLN&es጑ܿe G_(G‘pd Ƿ>82 #@82 #q[(p!yG‘p!yG‘p!yG‘p!yG‘p!yG‘p!yG‘p!yG‘p!yG‘p!yG‘p!yG‘p!yG‘p!yG‘p!yG‘p!yG‘p!yG‘p!yG‘p!yG‘p!yG‘p!yG‘p!B~{7\a| c\C*y䶘10'OpDXfn%Eɢ[77fԍNYÜ&k.:fq2#|bǾC V!#^@ck@p\uXzlQ)m?ZMݮhoX)D1)Ӊ/AnwnץsLh"®ӺU.[dNOooٵK.m"5KquLѯQLowjn\N,1u0Htc^/\pL#}Z#- DI!|3&{tV,c7Ƕk5| (^@"y ^lbP?P]{o:z z ~1s6ho9Rqg|?duO]_PFUY6x~T': Vfsh4!Gwz&YgᨒM3vߘeeC_0l!G%SN~ mlnK6f8.8y߳m&{Lگ҃|j]Y/T h~#=?,XfC.d̄lA\Mf79YôQrݿde w)UTϥ]E84}?̸yBEcN9+!4j 13hfP:3uw^V8w7OSχ elN?NZv?۵K-ci1)i膖OKӴ97GWyRһ@Ϟ=_4Ef5=|%/=QwF*IV_8ټ'#.>rqOp{ & m5G_rkkׯ\6~:w_ws?`QE+l~LҴгrC^*e}庝ugw凚edsLlJ'}xsސػ;g;[dDo֪Y|] KK-z=[Vo͚BOoXc{9w<4Qa3f/[ Ղ*OGW hq~}!muj(E9:ĊIڋZGm߶Jq,@tL Ecb DO!74:?>\1[e=rRS>y[?vop͌ `8Vm3%ظ-&|cвQK}z 13&zĝ ]]r— &r s/JR)8!SOfŖo9phH\=㆛nX3U?bЁfŮ%VoK11'7t,])BL0q㭚.@f FGݲht[7[XBy (X4oтE mW6 (\M˗B)8>3v#;Idٍ3cEvXC4m%̐%k&1eN[)*[.e_BEgt{{?cfw^9~6 9,#[)xISwA\:&(=콉2bXi@/C4{δC8U9+kVN-C旧 /m5]2t${޵8nl +Lz@dciX )|HJMsC (e}@dtVL a<}j)og<_.zLcʑ3JkF\[%n`jM^iWC39O' ULQ4ET?2Mb!bsM)ȉtK|^:ߠ~6a׌K4{<\.V{4Jp\~V*Mܒ\޽o):ͧVu޳՗t%sLl3_| %ݗX$M/ Qu{}^Q}g>sܶc"Њw1jlҎ~Wϕ&3>+l4v|Ӏ2XiԵd*#3CАjC3*xuLvZ{t !~f{IGJJ_8@ON;X{= ՛q .6@qmqj3S9]xV©] &` C٪J?/ۛ8➕ @dx>TogMz͊DMzdngz yK SѳƠZm d>xr¬:8'8ݳ(^h&՚X5f/Ju}6i\2Ua>^C)&PqnɵNbVJiJȭnĩ oh缗ejVjtPT)ꃡ*A<:%053m+w4ٺmh:^,;![ʭ !Irv 0\U#ѺU[Փ9R0F _b[h2WU9ufdgUϲwQF kX̛䍦g>9ـ%gXӔo0WEA`k ҽrg̰3ر!3 Vv&vg] ـ2ܠ8<[T21ɏWY@ms){% 1ח|;xFA;]:z>CvXZ % ?Ol@mB> H~,p+F׀;"@!BCzxł=v@ \'ozxɰ<䃵{פs|e7o90m+{Y(RHU6r9v9 H#~F"JUj5p". +ƃ7Rؼl;:6'G) 9ԘߘyRĂKTV5gT ?R"z6J?} ~f*A^T¼Fq_EPQY(k_f{Umrܠ+9 x@fǨ)&) nAir_H,:.\3m"'[(W)ZMzYjWm!x,U GN`ljէZڼx5iwr]-ʶG'ZRqAKK:3BLyN!obm*ÆnX5 [´ ƋƟoN1*cm.d}.Dثã7Q)i}o#csι;<Zv35[z 5> ,moU?[/['\!-1j($l}̝=9#@9/ڻxnR\*KpW=$8 f2·xg.wv y 9@h;?[{@O0c/gZxnvxo4a.1]%%/&.݋ iT~"ߤYx{]TnCXBpaċ}:뿨DqT eU8;P$71gXM[g K h^)$Xr OVv3׶rHK h_ݖiZ8^:]&3N[.G]jCMv=yW[!uÒʗY" e/UllvI<_v<,,Wbs6Wa6k#6N;WkOsS{'-)nD(Wq17ի=mG/@C]˶%Rݸ1?ULS~S/ˀ \QP\НcB0;oRoVyq:DK@VKȇPSC`OӁFq{󻈩H4^WE"ֆ]WBB9O LlA~`yCloƑN bMrCcdxy:y`3) }CG,3tFݒޝB71Z 3oZTrY!SfFuƯqQ aXХbZKa;Ӈ֎HP Vsvp9:Z+-`Vun>5 Q/?&j'~`bza$FLZ@Z>WY!-SNӴR*\fz_r8'G5J#𽎵0ZOJ\ח ¹ LC ?_h;Ik$ !COKH!m'EB T5)6u{6z(rEAҨtO~%G{4>`f{‚(κ&]Bv -L7#7G1[,Ij,ZUҧNsݚi/4MvLryӔvz&͠>9:ahmj)_VZmL^gԝiȢKpZ>I{UH Yl^z8ȩ'?Wy5/Ke?`(ڕŗK\b+ B>BgdNiT* @O endstream endobj 4 0 obj << /Type /Font /Subtype /TrueType /FirstChar 0 /LastChar 255 /Widths [ 0 506 506 506 506 506 506 506 506 506 506 506 506 0 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 226 325 438 498 506 729 704 233 311 311 498 498 257 306 267 429 506 506 506 506 506 506 506 506 506 506 275 275 498 498 498 463 898 605 560 529 630 487 458 637 630 266 331 546 422 874 658 676 532 686 562 472 495 652 591 906 550 519 478 324 429 324 498 498 300 493 536 418 536 503 316 474 536 245 255 479 245 813 536 537 536 536 355 398 346 536 473 745 459 473 397 343 475 343 498 506 506 506 257 316 435 711 498 498 401 1061 472 344 874 506 478 506 506 257 257 435 435 498 498 905 444 720 398 344 842 506 397 519 226 325 498 506 498 506 498 498 414 834 416 538 498 306 506 390 342 498 337 335 300 563 597 267 303 252 435 538 657 690 701 463 605 605 605 605 605 605 775 529 487 487 487 487 266 266 266 266 639 658 676 676 676 676 676 498 680 652 652 652 652 519 532 554 493 493 493 493 493 493 774 418 503 503 503 503 245 245 245 245 536 536 537 537 537 537 537 498 543 536 536 536 536 473 536 473 ] /Encoding /WinAnsiEncoding /BaseFont /ABCDEE+Calibri,Bold /FontDescriptor 11 0 R >> endobj 11 0 obj << /Type /FontDescriptor /Ascent 750 /CapHeight 0 /Descent -250 /Flags 32 /FontBBox [ -519 -306 1240 1039 ] /FontName /ABCDEE+Calibri,Bold /ItalicAngle 0 /StemV 0 /FontFile2 9 0 R >> endobj 5 0 obj << /Type /Font /Subtype /Type0 /BaseFont /ABCDEE+Calibri /Encoding /Identity-H /DescendantFonts [12 0 R] >> endobj 12 0 obj << /Type /Font /Subtype /CIDFontType2 /BaseFont /ABCDEE+Calibri /CIDSystemInfo << /Registry (Adobe) /Ordering (Identity) /Supplement 0 >> /W [3 [226.074] 891 [498.047] 929 [705.078] ] /FontDescriptor 13 0 R >> endobj 13 0 obj << /Type /FontDescriptor /Ascent 750 /CapHeight 0 /Descent -250 /Flags 32 /FontBBox [ -503 -307 1240 1026 ] /FontName /ABCDEE+Calibri /ItalicAngle 0 /StemV 0 /FontFile2 10 0 R >> endobj 6 0 obj << /Type /Font /Subtype /TrueType /FirstChar 0 /LastChar 255 /Widths [ 0 506 506 506 506 506 506 506 506 506 506 506 506 0 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 506 226 325 400 498 506 714 682 220 303 303 498 498 249 306 252 386 506 506 506 506 506 506 506 506 506 506 267 267 498 498 498 463 894 578 543 533 615 488 459 630 623 251 318 519 420 854 645 662 516 672 542 459 487 641 567 889 519 487 468 306 386 306 498 498 291 479 525 422 525 497 305 470 525 229 239 454 229 798 525 527 525 525 348 391 334 525 451 714 433 452 395 314 460 314 498 506 506 506 249 305 418 690 498 498 395 1038 459 338 866 506 468 506 506 249 249 418 418 498 498 905 450 705 391 338 849 506 395 487 226 325 498 506 498 506 498 498 392 834 402 512 498 306 506 394 338 498 335 334 291 549 585 252 307 246 422 512 636 671 675 463 578 578 578 578 578 578 763 533 488 488 488 488 251 251 251 251 624 645 662 662 662 662 662 498 663 641 641 641 641 487 516 527 479 479 479 479 479 479 772 422 497 497 497 497 229 229 229 229 525 525 527 527 527 527 527 498 529 525 525 525 525 452 525 452 ] /Encoding /WinAnsiEncoding /BaseFont /ABCDEE+Calibri /FontDescriptor 14 0 R >> endobj 14 0 obj << /Type /FontDescriptor /Ascent 750 /CapHeight 0 /Descent -250 /Flags 32 /FontBBox [ -503 -307 1240 1026 ] /FontName /ABCDEE+Calibri /ItalicAngle 0 /StemV 0 /FontFile2 10 0 R >> endobj 8 0 obj << /Type /Pages /Kids [ 2 0 R ] /Count 1 >> endobj 15 0 obj << /Type /Catalog /Pages 8 0 R >> endobj 16 0 obj << /Title <> /Author /Subject <> /Creator (Microsoft Reporting Services 12.0.0.0) /Producer (Microsoft Reporting Services PDF Rendering Extension 12.0.0.0) /CreationDate (D:20220421020007+02'00') >> endobj xref 0 17 0000000000 65535 f 0000000010 00000 n 0000004103 00000 n 0000004300 00000 n 0000964741 00000 n 0000966141 00000 n 0000966696 00000 n 0000000065 00000 n 0000968087 00000 n 0000732206 00000 n 0000841873 00000 n 0000965937 00000 n 0000966267 00000 n 0000966496 00000 n 0000967887 00000 n 0000968149 00000 n 0000968202 00000 n trailer << /Size 17 /Root 15 0 R /Info 16 0 R >> startxref 968445 %%EOF